असंदर्भित प्रशांत ऑयस्टर्स से एक वस्तुतः अनुक्रमित cDNA लाइब्रेरी के उत्पादन के लिए एक Converging रणनीति

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हम कैसे unreferenced प्रशांत सीप नमूनों से आरएनए नमूनों का उपयोग करने के लिए एक रणनीति का वर्णन है, और सार्वजनिक रूप से उपलब्ध जीनोम डेटा के साथ तुलना द्वारा आनुवंशिक सामग्री का मूल्यांकन करने के लिए एक वस्तुतः अनुक्रम CDNA पुस्तकालय उत्पन्न करते हैं.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

संदर्भ प्रजातियों की जैविक सामग्री के लिए उपयोग, जो पहले प्रमुख प्रयोगों में इस्तेमाल किया गया था जैसे कि उपन्यास सेल लाइनों या जीनोम अनुक्रमण परियोजनाओं के विकास में, अक्सर आगे के अध्ययन या तीसरे पक्ष के कारण प्रदान करने के लिए मुश्किल है नमूनों की उपभोक् ता प्रकृति। हालांकि अब व्यापक रूप से एशिया, ऑस्ट्रेलिया और उत्तरी अमेरिका के प्रशांत तटों पर वितरित, व्यक्तिगत प्रशांत सीप नमूने आनुवंशिक रूप से काफी विविध हैं और इसलिए जीन पुस्तकालयों के लिए प्रारंभिक सामग्री के रूप में सीधे उपयुक्त नहीं हैं. इस अनुच्छेद में, हम क्षेत्रीय समुद्री भोजन बाजार से प्राप्त unreferenced प्रशांत सीप नमूनों के उपयोग का प्रदर्शन करने के लिए cDNA पुस्तकालयों उत्पन्न करते हैं. इन पुस्तकालयों तो सार्वजनिक रूप से उपलब्ध सीप जीनोम की तुलना में थे, और निकटतम संबंधित पुस्तकालय mitochondrial संदर्भ जीन Cytochrome C Oxidase subunit मैं (COX1) और NADH Dehydrogenase (एनडी) का उपयोग कर चुना गया था. उत्पन्न cDNA पुस्तकालय की उपयुक्तता भी क्लोनिंग और दो जीन की अभिव्यक्ति द्वारा प्रदर्शित किया जाता है एंजाइमों यूडीपी-ग्लूकुरोनिक एसिड dehydrogenase (UGD) और UDP-xylose synthase (UXS), जो से UDP-xylose के biosynthesis के लिए जिम्मेदार हैं एन्कोडिंग यूडीपी-ग्लूकोज।

Introduction

लंबे समय तक वितरण समय, उद्यमी तर्क, या देश-विशिष्ट सीमा शुल्क नियमों के कारण रहने वाले संदर्भित जैविक सामग्री का अधिग्रहण चुनौतीपूर्ण हो सकता है। एक विकल्प के रूप में, आवश्यक जैविक सामग्री भी phenoically समान नमूनों से एकत्र किया जा सकता है. हालांकि, इन नमूनों जीनोटाइप के स्तर पर काफी भिन्न हो सकते हैं, और इसलिए एक ही प्रजाति के डिजिटल रूप से संग्रहीत संदर्भ जीनोम के साथ तुलना अक्सर मुश्किल या यहां तक कि नए स्रोत सामग्री की असंगति के कारण व्यर्थ प्रदान की जाती हैं मौजूदा डीएनए प्रवर्धन विधियों. व्यक्तिगत नमूनों की अत्यधिक संरक्षित जीन ों को अलग-अलग1 प्रजातियों की पहचान करने के लिए एक व्यापक रूप से इस्तेमाल किया और शक्तिशाली उपकरण है , इस तरह के संरक्षित mitochondrial जीन है कि अक्सर cDNA पुस्तकालयों की गुणवत्ता के आकलन के लिए संदर्भ जीन के रूप में उपयोग किया जाता है के रूप में2 ,3,4,5,6. इसके साथ प्रस्तुत विधि के लिए अंतर्निहित तर्क यह है कि संदर्भ जीनोम के इसी दृश्यों की तुलना में व्यक्तिगत अनाम सीप नमूनों में mitochondrial जीन दृश्यों के उच्च संरक्षण इंगित करता है कि अन्य जीन भी एक दिखा सकते हैं विचलन के निम्न स्तर, परमाणु डीएनए7के सापेक्ष mitochondrial डीएनए विकास की आम तौर पर तेजी से दर को देखते हुए, बस सार्वजनिक रूप से उपयोग करके वैज्ञानिक और औद्योगिक रूप से प्रासंगिक जीन की एक विस्तृत श्रृंखला के प्रवर्धन और अलगाव की अनुमति एक संदर्भ के रूप में उपलब्ध अनुक्रमण डेटा.

यहाँ वर्णित विधि के समग्र लक्ष्य के लिए एक वस्तुतः अनुक्रम सीप CDNA पुस्तकालय जो सीप जीन की क्लोनिंग के लिए टेम्पलेट डीएनए के रूप में इस्तेमाल किया जा सकता पैदा करने के लिए एक अनुकूलित कार्यप्रवाह पेश है. आभासी अनुक्रमण में, डे नोवो जीनोम अनुक्रमण दरकिनार है; इसके बजाय, एक ज्ञात, डिजिटल संग्रहीत संदर्भ अनुक्रम का उपयोग या cDNAs है कि अंततः एक पुस्तकालय शामिल होगा के उत्पादन के लिए प्राइमर डिजाइन करने के लिए सीधे प्रयोग किया जाता है (या एक पूर्व मौजूदा एक करने के लिए जोड़ा जाएगा). उद्देश्य एक अभिसरण CDNA पुस्तकालय का उत्पादन करने के लिए है, जिसका अर्थ है कि उत्पन्न cDNA दृश्यों और संदर्भ अनुक्रम के बीच समानताएं कम से उच्च विचलन के लिए स्थान दिया जा सकता है. साइटोक्रोम सी ऑक्सिडेज सबयूनिट 1 (COX1) और NADH Dehydrogenase (एनडी) संदर्भ जीन के रूप में उपयोग करने का एक प्रमुख लाभ यह है कि इन माइटोकोंड्रियाल जीनों के उच्च संरक्षण के कारण भी अत्यधिक भौगोलिक रूप से विक्षिप्यता सीप नमूनों को प्रोफाइल किया जा सकता है। इन अच्छी तरह से स्थापित मार्करों के साथ दृष्टिकोण साबित करने के बाद, हम तो दो एंजाइम उम्मीदवारों जो चीनी न्यूक्लिओटाइड biosynthesis में शामिल हैं और औद्योगिक प्रासंगिकता का हो सकता है के लिए अपने आवेदन का प्रदर्शन8,9, 10. प्रशांत सीप की जैव-प्रौद्योगिकी क्षमता अभी भी अज्ञात है . इस प्रकार, हम मानते हैं कि एक वस्तुतः अनुक्रम cDNA पुस्तकालय तैयार करने के लिए इस converging विधि भी गैर विशेषज्ञ शोधकर्ताओं जो इस प्रासंगिक जैविक सामग्री से cDNA उत्पन्न करना चाहते हैं के लिए उपयुक्त हो जाएगा.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: एक योजनाबद्ध ओवरव्यू चित्र 1में दिखाया गया है।

1. नमूना संग्रह

  1. सीप के नमूने प्राप्त करें। पोस्टHarvest अवधि के दौरान बर्फ पर कस्तूरी रखें, परिवहन और खरीद के बाद 4-7 दिनों के भीतर प्रयोगशाला उपयोग और प्रक्रिया से पहले.
    नोट: इस प्रोटोकॉल के लिए, कस्तूरी नानजिंग में झोंग कै थोक बाजार से खरीदे गए थे (निंगडे, फुजियान, चीन और लियानुंग, जियांग्सू, चीन से शुरू), किंगदाओ में हैजी एक्वाटिक उत्पाद कंपनी (किंगदाओ, शेडोंग, चीन से शुरू), जुचेंग Yantai में जलीय उत्पाद कंपनी (Yantai, शेडोंग, चीन से शुरू) और किंगदाओ में Jinxiu एक्वाटिक उत्पाद कंपनी (किंगदाओ, शेडोंग, चीन से शुरू)।

2. ग्वानिडिनियम थायोसाइनेट-फेनोल निष्कर्षण द्वारा आरएनए अलगाव

  1. सीप ऊतक नमूने की तैयारी
    1. एक बाँझ स्केलपेल के साथ प्रत्येक सीप नमूना के अनुमानित ज्यामितीय केंद्र से सजातीय नरम ऊतक के लगभग 100 मिलीग्राम कट, और तरल नाइट्रोजन में नमूने हस्तांतरण.
    2. 1 ज के लिए -80 डिग्री सेल्सियस पर ठंड से कस्तूरी के शेष भाग को यूथेनाइज़ करें और जैविक अपशिष्ट के रूप में त्यागें।
    3. फ्लैश फ्रोज़न सीप ऊतक को 50 एमएल तरल नाइट्रोजन से भरे मोर्टार (200 एमएल) में एक महीन पाउडर में पीस लें।
    4. प्रत्येक नमूने के जमे हुए ऊतक के 75 मिलीग्राम एक बाँझ 1.5 एमएल अपकेंद्रित्र ट्यूब में वजन करें और गुएनडिनियम थायोसाइनेट-फेनोल निष्कर्षण अभिकर्मक के 1 एमएल के साथ मिश्रण करें। 15 मिनट के लिए 4 डिग्री सेल्सियस पर 14,000 x g पर नमूना सेंट्रीफ्यूज।
  2. एक नया 1.5 एमएल सेंट्रीफ्यूज ट्यूब के लिए supernatant स्थानांतरण, क्लोरोफॉर्म के 200 डिग्री सेल्सियस जोड़ने और मिश्रण दूधिया सफेद हो जाता है जब तक 10-15 s के लिए एक भंवर मिक्सर का उपयोग करके अच्छी तरह से मिश्रण।
  3. 15 मिनट के लिए 4 डिग्री सेल्सियस पर 14,000 x g पर सेंट्रीफ्यूज, और एक नया 1.5 एमएल अपकेंद्रित्र ट्यूब में interphase परेशान किए बिना एक 200 $L पिपेट के साथ ध्यान से ऊपरी जलीय परत हस्तांतरण।
  4. आइसोप्रोपिल अल्कोहल का 500 डिग्री सेल्सियस जोड़ें और प्रतिवर्तन द्वारा नमूनों को धीरे-धीरे मिलाएं, फिर बर्फ पर 20 मिनट के लिए नमूने छोड़ दें। 8 मिनट के लिए 4 डिग्री सेल्सियस पर 14,000 x g पर सेंट्रीफ्यूज और supernatant हटा दें।
  5. छर्रों में से प्रत्येक को 75% EtOH के 1 एमएल में पुन: निलंबित करें, और 5 मिनट के लिए 4 डिग्री सेल्सियस पर 14,000 x g पर अपकेंद्रित्र।
  6. चरण 2.5 को एक बार दोहराएँ. कमरे के तापमान पर 6 मिनट के लिए छर्रों सूखी. लंबे समय तक सूख न करें; अन्यथा, अगले चरण में आरएनए गोली को भंग करना मुश्किल हो सकता है।
  7. डीईपीसी (डाइएथिलपिरोकार्बोनेट) के 25 डिग्री एल में सूखे आरएनए गोली को भंग करें और ट्यूब को बर्फ पर रखें। 24 घंटे के भीतर आरएनए नमूनों का उपयोग करें।

3. रिवर्स प्रतिलेखन द्वारा cDNA पुस्तकालय पीढ़ी

  1. प्रत्येक आरएनए नमूने के लिए, एक 10 डिग्री एल पिपेट का उपयोग कर एक वाणिज्यिक रिवर्स प्रतिलेखन प्रणाली का उपयोग कर एक प्रतिक्रिया मिश्रण तैयार: MgCl के 4 डिग्री एलजोड़ें 2 समाधान, 10x प्रतिक्रिया बफर के 2 $L, dNTP समाधान के 2 $L, RNase अवरोध करनेवाला के 0.5 $L, एएमवी रिवर्स के 0.7 डिग्री एल ट्रांसट्रांसेस, 0.5 एल ओलिगो (डीटी) 15 प्राइमर, निकाले गए आरएनए नमूने का 1 डिग्री एल और 300 डिग्री एल पीसीआर ट्यूब में एच2ओ का 9.3 डिग्री एल।
  2. पीसीआर थर्मोसाइकिलर में 60 मिनट के लिए 42 डिग्री सेल्सियस पर इनक्यूबेट मिश्रण, और फिर तापमान को 5 मिनट के लिए 95 डिग्री सेल्सियस तक बढ़ाएं।
  3. -20 डिग्री सेल्सियस पर 12 महीने के लिए उत्पन्न CDNA पुस्तकालय स्टोर।

4. Mitochondrial जीन प्रवर्धन और शुद्धि

  1. पीसीआर मिश्रण को 10 डिग्री सेल्सियस पिपेट का उपयोग करके तैयार करें। उच्च निष्ठा डीएनए पॉलिमरेज के 0.25 डिग्री एल (1.25 यू) जोड़ें, डीएनटीपी समाधान के 2 डिग्री एल (प्रत्येक डीएनटीपी के 2.5 एमएम), COX1 या एनडी फॉरवर्ड प्राइमर के 0.5 डिग्री एल (100 $M), इसी COX1 या एनडी रिवर्स प्राइमर के 0.5 डिग्री एल (100 डिग्री सेल्सियस), 1L DNA सी लाइब्रेरी के 5ं बफर विलयन के 5ं प्रतज्र हल तथा आसुत ह2ह का 16 प्र.श.
  2. निम्नलिखित मापदंडों का उपयोग करपीसी प्रवर्धन प्रदर्शन: 95 डिग्री सेल्सियस (अवधि 5 मिनट), 35 PCR प्रतिक्रिया चक्र 55 डिग्री सेल्सियस (30 s) पर एक annealing कदम से मिलकर एक प्रारंभिक विकृतीकरण कदम के बाद, 72 डिग्री सेल्सियस (2 मिनट) पर दीर्घीकरण कदम, और 95 डिग्री सेल्सियस (30 s) पर विकृतीकरण कदम , 72 डिग्री सेल्सियस पर 5 मिनट के लिए दीर्घीकरण कदम को अंतिम रूप देने के एक प्रदर्शन करते हैं।
  3. प्राप्त पीसीआर उत्पाद की गुणवत्ता agarose जेल electrophoresis द्वारा सत्यापित करने के लिए पीसीआर उत्पाद के 5 $L का उपयोग करें। प्रवर्धित COX1 या एनडी जीन को क्रमशः 759 या 748 आधार युग्मों पर एकल बैंड के रूप में प्रेक्षणीय को प्रेक्षण कीजिए।
  4. पीसीआर क्लीन-अप किट के साथ पीसीआर उत्पाद के बाकी को शुद्ध करें।
    1. 100 डिग्री सेल्सियस के घोल को 'पीसीआर-ए' (डीएनए बाइंडिंग बफर जिसमें चाओट्रोपिक लवणों की उच्च सांद्रता11)को नमूना में जोड़ें। भंवर संक्षेप में सामग्री मिश्रण करने के लिए.
    2. शुद्धि स्तंभ को 2 एमएल अपकेंद्रित्र नली में रखें। 4.4.1 की प्रतिक्रिया मिश्रण पिपेट। स्तंभ में. कमरे के तापमान पर 1 मिनट के लिए 14,000 x ग्राम पर सेंट्रीफ्यूज।
    3. अपकेंद्रण ट्यूब से छानना छोड़ दें। 2 एमएल अपकेंद्रित्र ट्यूब पर कॉलम को वापस करें, 700 डिग्री एल समाधान 'W2' को कॉलम में जोड़ें और कमरे के तापमान पर 1 मिनट के लिए 14,000 x ग्राम पर अपकेंद्रण ('W2' एक वाशिंग समाधान है जिसमें अवशिष्ट कैट्रोपिक को हटाने के लिए इथेनॉल की उच्च सांद्रता होती है शुद्धि स्तंभ से लवण).
    4. छानना छोड़ दें और कॉलम को 2 एमएल अपकेंद्रण ट्यूब पर वापस कर दें। कमरे के तापमान पर 1 मिनट के लिए कॉलम और सेंट्रीफ्यूज में 400 $L समाधान 'W2' जोड़ें।
    5. धातु ब्लॉक हीटर में 65 डिग्री सेल्सियस के लिए deionized पानी के 1 एमएल पूर्व गर्मी। कॉलम को एक नई 1.5 एमएल सेंट्रीफ्यूज ट्यूब में स्थानांतरित करें। सफेद स्तंभ झिल्ली के केंद्र में 65 डिग्री सेल्सियस गर्म पूर्व गर्म deionized पानी के 25 डिग्री एल। झिल्ली कमरे के तापमान पर 1 मिनट के लिए लेना.
    6. कमरे के तापमान पर 1 मिनट के लिए 14,000 x ग्राम पर सेंट्रीफ्यूज और स्तंभ को त्यागें।
  5. -20 डिग्री सेल्सियस पर 12 महीने के लिए शुद्ध पीसीआर उत्पाद स्टोर।

5. Mitochondrial जीन अनुक्रमण और तुलना

  1. अनुक्रमण प्राइमर के रूप में प्रासंगिक COX1 या एनडी आगे प्राइमर का उपयोग कर Sanger अनुक्रमण के लिए चरण 4.5 से शुद्ध पीसीआर नमूने भेजें। वैकल्पिक रूप से, COX1 या एन डी रिवर्स प्राइमर भी द्विदिश अनुक्रमण के लिए इस्तेमाल किया जा सकता है।
  2. अनुक्रमण परिणामों को पुन: प्राप्त करने के बाद, NCBI न्यूक्लिओटाइड BLAST ऑनलाइन उपकरण का उपयोग कर प्रशांत सीप संदर्भ तनाव (NCBI वर्गीकरण आईडी: 29159) के जीनोम अनुक्रम के साथ अनुक्रमों की तुलना करें (blast.ncbi.nlm.nih.gov) (चित्र2 और चित्र 3 ).

6. जीन MgUGD और MgUXS क्लोनिंग के लिए cDNA पुस्तकालय लागू

  1. पीसीआर द्वारा चरणों 4-1 का पालन करते हुए MGD और MgUXS जीनों को उन्नत और शुद्ध करें। 4.4 करने के लिए.
  2. पाचन बफर (10x केंद्रित) के 2 डिग्री एल और deionized पानी के 6 डिग्री एल एक 1.5 एमएल अपकेंद्रित्र ट्यूब में स्थानांतरण। 10 $L शुद्ध MgUGD या MgUXS PCR उत्पादों के साथ प्रतिबंध endonucleases Nde मैं और Xho मैं (1 $L प्रत्येक, 20 यू) जोड़ें. 3 ज के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट।
  3. पूर्व-पाचनवाले पीईटी-30क सदिश को तैयार कीजिए: पीईटी-30ए वेक्टर के 500 एनजी को एक नए 1.5 एमएल सेंट्रीफ्यूज ट्यूब में स्थानांतरित करें और डाइऑनीकृत जल का उपयोग करके मात्रा को 16 डिग्री सेल्सियस तक ऊपर रखें। 2 डिग्री सेल्सियस पाचन बफर (10x केंद्रित) के साथ प्रतिबंध endonucleases Nde मैं और Xho मैं (1 $L प्रत्येक, 20 यू) के साथ जोड़ें.
    1. 3 ज के लिए 37 डिग्री सेल्सियस पर मिश्रण को इनक्यूबेट करने के बाद, एक अतिरिक्त घंटे के लिए 1 डिग्री सेल्सियस क्षारीय फॉस्फेट (1 यू) और इनक्यूबेट को 37 डिग्री सेल्सियस पर डालें। पूर्व-गर्म धातु ब्लॉक हीटर में 10 मिनट के लिए 75 डिग्री सेल्सियस पर हीटिंग द्वारा क्षारीय फॉस्फेट को निष्क्रिय करें।
  4. पचे हुए MgUGD या MgUXS डीएनए उत्पादों के 4 डिग्री सेल्सियस को ताजा 1.5 एमएल सेंट्रीफ्यूज ट्यूबों में स्थानांतरित करें और पचाए गए पीईटी-30ए वेक्टर के 4 डिग्री सेल्सियस जोड़ें। लिगेशन बफर (10x) का 1 डिग्री एल जोड़ें, 1 डिग्री सेल्सियस का लिगेज़ (3 उ) और 3 ज के लिए 22 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण को इनक्यूबेट करें।
  5. विद्युत सक्षम ई. कोलाई Mach1 सक्षम कोशिकाओं को बदलने के लिए लिगेशन उत्पादों का उपयोग कर विद्युत पोरेशन द्वारा। एलबी आगर प्लेटों पर रूपांतरित कोशिकाओं को फैलाएं जिनमें 50 ग्राम/एमएल कानामाइसिन होता है। 16 ज के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट कोशिकाओं।
  6. प्लाज्मिड-विशिष्ट T7 प्रमोटर और टर्मिनेटर प्राइमर का उपयोग करके Sanger अनुक्रमण द्वारा वांछित प्रविष्टि के लिए कालोनियों का सत्यापन करें। मान्य जीवाणु क्लोन से प्लाज्मिड तैयार करें।

7. अभिव्यक्ति और MgUGD और MgUXS की गतिविधि परीक्षण

  1. रूपांतरण ई. कोलाई BL21 (DE3) गुणी कोशिकाओं के साथ mgUGD और MgUXS जीन असर और एलबी agar प्लेटों पर तब्दील कोशिकाओं का प्रसार 50 g/ 16 ज के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट कोशिकाओं।
  2. 5 एमएल एलबी माध्यम में एक एकल कॉलोनी की खेती करें जिसमें 50 ग्राम/ संस्कृति को 400 एमएल एलबी माध्यम में स्थानांतरित करें और 37 डिग्री सेल्सियस के तापमान पर 200 आरपीएम पर लगातार हिलाएं जब तक कि 600 एनएम (ओडी600) की तरंगदैर्घ्य पर ऑप्टिकल घनत्व लगभग 0.5 के अवशोषण तक पहुंच जाता है।
    1. ऊष्मायन तापमान को 20 डिग्री सेल्सियस तक कम करें और आइसोप्रोपिल के 400 डिग्री सेल्सियस को जोड़ें-डी-थायोगालाक्टोपाइरानोसाइड (संकेंद्रण 1 द)। 3 ज के लिए रिकॉमबिनेंट प्रोटीन की अभिव्यक्ति को प्रेरित करें।
  3. 4 डिग्री सेल्सियस पर 15 मिनट के लिए 4,500 x ग्राम पर सेंट्रीफ्यूगेशन द्वारा फसल कोशिकाओं। 10 एमएल लाइसिस बफर (100 एमएम नैकल, 50 एमएम ट्रास/
  4. 20 मिनट के लिए sonication द्वारा कोशिकाओं को बाधित (40 पर / बंद चक्र के साथ 20 डिग्री मीटर आयाम के लिए 15 s पर 4 डिग्री सेल्सियस). 20 मिनट के लिए 4 डिग्री सेल्सियस पर 14,000 x ग्राम पर सेंट्रीफ्यूज और गतिविधि परीक्षण के लिए supernatant इकट्ठा।
  5. यूडीपी-ग्लूकोज (10 एमएम) के 2 डिग्री एल, एनएडी+ (10 एम एम) के 4 जेडएल, एमजीसीएल2 (10 एम एम) के 4 एल, 2 एल के ट्राइस/एचसीएल बफर (500 एमएम, पीएच 7.5) केसाथ सेल lysate के 2 $L, और 6L के साथ MgUGD की गतिविधि परख का प्रदर्शन करें। एमएल अपकेंद्रित्र ट्यूब और 30 मिनट के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट।
  6. यूडीपी-ग्लूकुरेनिक एसिड (10 एमएम), 2 एल ट्रास/एचसीएल बफर (500 एमएम, पीएच 7.5) के 2 जेडएल के साथ सेल lysate के 2 $L को इनक्यूबेट करके MgUXS की गतिविधि परख, और एक नए 1.5 एमएल सेंट्रीफ में 37 के लिए डीओएनीकृत एच2ओ के 14 डिग्री एल का प्रदर्शन करें।
  7. प्रत्येक मिश्रण में 20 डिग्री सेल्सियस मेथनॉल और 40 डिग्री सेल्सियस क्लोरोफॉर्म जोड़कर क्रियाओं को चरण 7-5 और 7.6 में क्यूच करें। नमूना मिश्रण भंवर के बाद, 4 डिग्री सेल्सियस पर 6 मिनट के लिए 14,000 x g पर अपकेंद्रण और प्रत्येक ट्यूब के ऊपरी जलीय परत इकट्ठा.
  8. MALDI-TOF द्रव्यमान स्पेक्ट्रोमेट्री का उपयोग कर के प्रतिक्रिया उत्पादों का विश्लेषण ऋण आयनन मोड में m/z श्रेणी से 500-700. मिश्रण 1 $L के साथ नमूना मिश्रण के 1 $L 2,5-dihydroxybenzoic एसिड नमूना मैट्रिक्स (1% w/V में 50% जलीय एसीटोनिट्रिल). यूडीपी-ग्लूक्यूरुनिक अम्ल तथा यूडीपी-जाइल्स के लिए 579 तथा 535 पर अपेक्षित उधे मानों का प्रेक्षण कीजिए (चित्र4)।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

चित्र 1 प्रशांत सीप व्यक्तियों से व्युत्पन्न अभिसरण cDNA पुस्तकालय के वर्णित तैयारी विधि का एक योजनाबद्ध अवलोकन दिखाता है। चित्र 2 संदर्भ सामग्री के COX1 और एनडी जीन दृश्यों से उच्च विचलन के साथ एक दूर से संबंधित सीप नमूना के COX1 और एनडी जीन जीन के दृश्यों से पता चलता है. चित्र 3 संदर्भ सामग्री के COX1 और एनडी जीन दृश्यों से कम विचलन के साथ एक बारीकी से संबंधित सीप नमूना के COX1 और एन डी जीन जीन के दृश्यों से पता चलता है. चित्र 4 औद्योगिक रूप से संबंधित जीनMgD और MgUXS क्लोन करने के लिए CDNA पुस्तकालय के सफल आवेदन से पता चलता है.

Figure 1
चित्र 1 : के लिए वर्णित विश्लेषण विधि के Schematic सिंहावलोकन की आण्विक पहचान प्रशांत सीप नमूना संदर्भ जीन के रूप में COX1 और एनडी का उपयोग कर. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2 : संदर्भ से COX1 और एनडी जीन दृश्यों के साथ तुलना में एक उच्च-divergent नमूना के COX1 और एनडी जीन दृश्यों के अनुक्रम संरेखण प्रशांत शुक् ति तनाव. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3 : संदर्भ से COX1 और एनडी जीन दृश्यों के साथ तुलना में एक बारीकी से संबंधित नमूना के COX1 और एनडी जीन दृश्यों के अनुक्रम संरेखण प्रशांत शुक् ति तनाव. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 4
चित्र 4 : के योजनाबद्ध अवलोकन आणविक क्लोनिंग, पुनः संयोजक अभिव्यक्ति और MgUGD और MgUXS की प्रतिक्रिया उत्पादों का पता लगाने. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

प्रस्तुत प्रोटोकॉल एक सार्वजनिक रूप से उपलब्ध सीप डीएनए जीनोम डेटाबेस के साथ COX1 और एनडी जीन की तुलना से क्षेत्रीय समुद्री भोजन बाजार से इसी तरह phenotype के साथ unreferenced सीप नमूनों की आनुवंशिक पहचान की अनुमति देता है. इस विधि का महत्व अपनी सादगी में निहित है, के रूप में केवल एक पीसीआर प्रतिक्रिया आभासी cDNA पुस्तकालय के मूल्यांकन के लिए आवश्यक है. दो संरक्षित mitochondrial COX1 और एन डी जीन एक cDNA पुस्तकालय जो प्रत्येक सीप से आरएनए अर्क के रिवर्स प्रतिलेखन द्वारा उत्पन्न किया गया था से परिलक्षित किया गया. आरएनए अलगाव की विधि (चरण 2-1) सीधे तरल नाइट्रोजन में सीप ऊतक पीस द्वारा सरलीकृत किया गया था। प्रत्येक नमूने के COX1 और एनडी जीन अनुक्रमण के बाद, अनुक्रम संरेखण से पता चला कि कुछ नमूने संदर्भ तनाव के लिए उच्च समानता दिखा. निकटतम रिश्तेदार दोनों COX1 और एनडी जीन दृश्यों की पूरी पहचान दिखाई.

इस प्रक्रिया का सबसे महत्वपूर्ण कदम आरएनए निष्कर्षण कदम हैं; आरएनए गिरावट को कम करने के लिए, सीप ऊतक और आरएनए निष्कर्षण की कटाई के बीच के समय को कम करना आवश्यक है।

सफल क्लोनिंग हाल ही में सीप UGE जीन क्लोनिंग द्वारा उदाहरण दिया गया था12 और इस के साथ MgUGD और MgUXS जीन क्लोनिंग द्वारा13, जो उत्पन्न cDNA पुस्तकालय की व्यावहारिकता मान्य, ब्याज की जीन के किसी भी संख्या की क्लोनिंग की अनुमति अपभ्रष्ट प्राइमर का उपयोग कर बोझिल क्लोनिंग रणनीतियों के लिए आवश्यकता के बिना। COX1 और एन डी जीन के प्रवर्धन द्वारा आणविक पहचान की इस विधि वस्तुतः अनुक्रम cDNA पुस्तकालयों उत्पन्न करने के लिए भी अन्य जैविक सामग्री है कि संदर्भित जीनोम के भौतिक नमूने नहीं है के लिए भविष्य अनुप्रयोगों में इस्तेमाल किया जा सकता है उपलब्ध.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

यह काम चीन के प्राकृतिक विज्ञान फाउंडेशन (अनुदान संख्या 31471703, A0201300537 और 31671854 जे.वी. और एल.एल., अनुदान संख्या 31470435 को जी.वाई.) द्वारा भाग में समर्थित किया गया था, और 100 विदेशी प्रतिभा योजना (जेएसबी2014012 को अनुदान)।

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics