Uma estratégia convergente para a geração de uma biblioteca de cDNA virtualmente seqüenciada de ostras pacíficos não referenciadas

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nós descrevemos uma estratégia para como usar amostras do RNA dos espécimes de ostra pacíficos não referenciados, e avaliamos o material genético em comparação com os dados publicamente disponíveis do genoma para gerar uma biblioteca virtualmente seqüenciada do cDNA.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

O acesso ao material biológico de espécies de referência, que foram utilizados anteriormente em experimentos-chave, como no desenvolvimento de novas linhas celulares ou projetos de sequenciamento de genoma, são muitas vezes difíceis de prever estudos ou terceiros devido à natureza consumptiva das amostras. Embora agora distribuído extensamente sobre as costas pacíficos de Ásia, de Austrália e de America do Norte, os espécimes pacíficos individuais da ostra são genetically completamente diverso e são conseqüentemente não diretamente apropriados como o material começar para bibliotecas do gene. Neste artigo, demonstramos o uso de espécimes de ostras pacíficos não referenciados obtidos de mercados regionais de frutos do mar para gerar bibliotecas de cDNA. Essas bibliotecas foram comparadas com o genoma de ostra disponível publicamente, e a biblioteca relacionada mais próxima foi selecionada usando os genes de referência mitocondrial citocromo C oxidase subunidade I (COX1) e NADH desidrogenase (ND). A adequação da biblioteca de cDNA gerada também é demonstrada pela clonagem e expressão de dois genes que codificam as enzimas UDP-glucuronic ácido desidrogenase (UGD) e UDP-xylose sintase (UXS), que são responsáveis pela biossíntese de UDP-xylose de UDP-glicose.

Introduction

A aquisição de material biológico referenciado em vida pode ser desafiadora devido a longos prazos de entrega, raciocínio empreendedor ou regulamentação aduaneira específica do país. Como alternativa, o material biológico necessário também pode ser coletado de espécimes fenotipicamente idênticos. No entanto, essas amostras podem variar significativamente ao nível do genótipo e, portanto, as comparações com genomas de referência armazenados digitalmente da mesma espécie são muitas vezes tornadas difíceis ou mesmo fútil devido à incompatibilidade do material recém-originado com métodos de amplificação de ADN existentes. A sequenciação de genes altamente conservados de amostras individuais é uma ferramenta amplamente utilizada e poderosa para identificar espécies1, tais como genes mitocondrial conservados que são freqüentemente usados como genes de referência para a avaliação da qualidade das bibliotecas de cDNA2 ,3,4,5,6. A fundamentação subjacente para o presente método apresentado é que a alta conservação das sequências de genes mitocondriais em amostras de ostras anônimas individuais em comparação com as sequências correspondentes do genoma de referência indica que outros genes também podem mostrar um baixo nível de divergência, dada a taxa geralmente mais rápida de evolução do DNA mitocondrial em relação ao DNA nuclear7, permitindo a amplificação e isolamento de uma ampla gama de genes cientificamente e industrialmente relevantes, simplesmente usando publicamente dados de sequenciamento disponíveis como referência.

O objetivo geral do presente método descrito é apresentar um fluxo de trabalho otimizado para gerar uma biblioteca de cDNA de ostra virtualmente sequenciada que pode ser usada como DNA de modelo para a clonagem de genes de ostra. Em sequenciamento virtual, o sequenciamento do genoma de novo é contornado; em vez disso, uma seqüência de referência conhecida e armazenada digitalmente é usada diretamente para utilizar ou projetar iniciadores para a produção de cDNAs que acabará por incluir uma biblioteca (ou ser adicionado a um pré-existente). O objetivo é produzir uma biblioteca de cDNA convergente, o que significa que as semelhanças entre as sequências de cDNA geradas e a sequência de referência podem ser classificadas de baixa a alta divergência. Uma vantagem chave de usar o subunidade 1 da oxidase do cytochrome C (COX1) e o dehydrogenase de NADH (ND) como genes da referência é que mesmo os espécimes altamente geograficamente disjunção da ostra podem ser perfilados devido à conservação elevada destes genes mitochondrial. Tendo provado a abordagem com esses marcadores bem estabelecidos, demonstramos sua aplicação a dois candidatos enzimáticos que estão envolvidos na biossíntese de nucleotídeo açucareiro e podem ser de relevância industrial8,9, 10. o potencial biotecnológico da ostra do Pacífico ainda é inexplorado. Assim, acreditamos que este método convergente para a preparação de uma biblioteca de cDNA virtualmente sequenciada também será adequado para pesquisadores não especializados que desejam gerar cDNA a partir deste material biológico relevante.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: uma síntese esquemática é mostrada na Figura 1.

1. coleta de amostra

  1. Obter espécimes de ostra. Manter as ostras no gelo durante o período pós-colheita, o transporte e antes do uso laboratorial e processo dentro de 4-7 dias após a compra.
    Nota: para este protocolo, as ostras foram compradas no mercado grossista Zhong cai em Nanjing (originária de Ningde, Fujian, China e Lianyungang, Jiangsu, China), Haijie Aquatic Product Company em Qingdao (originário de Qingdao, Shandong, China), Jucheng Companhia aquática do produto em Yantai (originando de Yantai, Shandong, China) e companhia aquática do produto de jinxiu em Qingdao (originando de Qingdao, Shandong, China)).

2. isolação do RNA pela extração do thiocyanate-fenol do guanidina

  1. Preparação da amostra de tecido de ostra
    1. Recorte aproximadamente 100 mg de tecido mole homogêneo do centro geométrico aproximado de cada espécime de ostra com um bisturi esterilizado e transfira as amostras para o nitrogênio líquido.
    2. Eutanizar a parte restante das ostras congelando a-80 ° c por 1 h e descarte como resíduo biológico.
    3. Moer o tecido de ostra de flash congelado em um pó fino em um almofariz (200 mL) preenchido com 50 mL de nitrogênio líquido.
    4. Pesar 75 mg de tecido congelado de cada espécime em um tubo de centrifugação estéril de 1,5 mL e misturar com 1 mL do reagente de extração de tiocianato de guanidínio-fenol. Centrifugue a amostra a 14.000 x g a 4 ° c durante 15 min.
  2. Transfira o sobrenadante para um novo tubo de centrífuga de 1,5 mL, adicione 200 μL de clorofórmio e misture bem usando um misturador de vórtice para 10-15 s até que a mistura se transforme em branco-leitoso.
  3. Centrifugue a 14.000 x g a 4 ° c durante 15 min e transfira cuidadosamente a camada aquosa superior com uma pipeta de 200 μl sem perturbar a interfase num novo tubo de centrifugação de 1,5 ml.
  4. Adicione 500 μL de álcool isopropílico e misture as amostras suavemente por inversão e, em seguida, deixe as amostras por 20 min no gelo. Centrifugue a 14.000 x g a 4 ° c durante 8 min e retire o sobrenadante.
  5. Ressuspender cada um dos pellets em 1 mL de 75% EtOH, e centrifugar a 14.000 x g a 4 ° c durante 5 min. Retire todo o sobrenadante.
  6. Repita o passo 2,5 uma vez. Seque os pellets durante 6 min à temperatura ambiente. Não seque por mais tempo; caso contrário, pode ser difícil dissolver a pelota do RNA na próxima etapa.
  7. Dissolva a pelota secada do RNA em 25 μL de DEPC (diethylpyrocarbonate)-água tratada e mantenha o tubo no gelo. Use amostras de RNA dentro de 24 h.

3. geração da biblioteca do cDNA pela transcrição reversa

  1. Para cada amostra de RNA, prepare uma mistura de reacção utilizando um sistema de transcrição reversa comercial utilizando uma pipeta de 10 μL: adicionar 4 μL de solução de MgCl2 , 2 μL de tampão de reacção 10x, 2 μL de solução de dntp, 0,5 μL de inibidor de RNase, 0,7 ΜL de AMV Reverse Transcriptase, 0,5 μL de oligo (dT) 15 primer, 1 μL da amostra de RNA extraído e 9,3 μL de H2o em um tubo de 300 ΜL de PCR.
  2. Incubar a mistura em um thermocycler do PCR para 60 minutos em 42 ° c, e aumenta então a temperatura a 95 ° c por 5 minutos.
  3. Armazene a biblioteca de cDNA gerada por até 12 meses a-20 ° c.

4. amplificação e purificação do gene mitocondrial

  1. Prepare a mistura de PCR usando uma pipeta de 10 μL. Adicionar 0,25 μL (1,25 U) de DNA polimerase de alta fidelidade, 2 μL de solução de dNTP (2,5 mM de cada dNTP), 0,5 μL do primer dianteiro COX1 ou ND (100 μM), 0,5 μL do primer reverso COX1 ou ND correspondente (100 μM), 1 μL da biblioteca cDNA , 5 μL de solução tampão 5x e 16 μL de H2O destilada num tubo de 300 ΜL de PCR.
  2. Realize a amplificação do PCR usando os seguintes parâmetros: após uma etapa inicial da desnaturação em 95 ° c (duração 5 minutos), 35 ciclos da reação do PCR que consistem em uma etapa do recozimento em 55 ° c (30 s), etapa do alongamento em 72 ° c (2 minutos), e etapa da desnaturação em 95 ° c (30 s) , realize um passo de alongamento de finalização por 5 min a 72 ° c.
  3. Use 5 μL do produto do PCR para verific pela electroforese do gel do agarose a qualidade do produto obtido do PCR. Observe o gene COX1 ou ND amplificado como uma única faixa em ambos os 759 ou 748 pares de base, respectivamente.
  4. Purify o descanso do produto do PCR com um jogo da limpeza do PCR.
    1. Adicionar 100 μl de solução ' PCR-A ' (tampão de ligação do ADN que contém concentrações elevadas de sais de agente11) à amostra. Vortex brevemente para misturar o conteúdo.
    2. Coloque a coluna de purificação num tubo de centrifugação de 2 mL. Pipeta a mistura de reacção de 4.4.1. na coluna. Centrifugar a 14.000 x g durante 1 min à temperatura ambiente.
    3. Elimine o filtrado do tubo de centrifugação. Retorne a coluna para o tubo de centrífuga de 2 ml, adicione 700 μL de solução ' W2 ' na coluna e centrifugue a 14.000 x g durante 1 min à temperatura ambiente (' W2 ' é uma solução de lavagem que contém altas concentrações de etanol para a remoção de agente residual sais da coluna de purificação).
    4. Elimine o filtrado e devolva a coluna ao tubo de centrifugação de 2 mL. Adicionar 400 μL de solução ' W2 ' à coluna e centrifugar a 14.000 x g durante 1 min à temperatura ambiente.
    5. Pré-aqueça 1 mL de água deionizada a 65 ° c num aquecedor de blocos metálicos. Transfira a coluna para um novo tubo de centrifugação de 1,5 mL. Pipetar 25 μL da água deionizada quente pré-aquecida a 65 ° c para o centro da membrana da coluna branca. Deixe a membrana mergulhar por 1 min à temperatura ambiente.
    6. Centrifugar a 14.000 x g durante 1 min à temperatura ambiente e descartar a coluna.
  5. Armazene o produto purificado do PCR por até 12 meses em-20 ° c.

5. sequenciamento e comparação de genes mitocondrial

  1. Emita as amostras purified do PCR da etapa 4,5 para o sequenciamento de Sanger usando os primers para diante COX1 ou ND relevantes como iniciadores de sequenciamento. Opcionalmente, os primers reversos COX1 ou ND também podem ser usados para seqüenciamento bidirecional.
  2. Depois de recuperar os resultados de seqüenciamento, compare as sequências com a sequência do genoma da cepa de referência de ostra do Pacífico (ID de taxonomia NCBI: 29159) usando a ferramenta on-line de Nucleotide BLAST da NCBI (blast.ncbi.nlm.nih.gov) (Figura 2 e Figura 3 ).

6. aplicando a biblioteca cDNA para clonagem dos genes MgUGD e MgUXS

  1. Amplify e purificar os genes de mgugd e de mguxs usando os primers para diante e reversos respectivos de mgugd e de mguxs pelo PCR que segue etapas 4,1. a 4,4.
  2. Transfira 2 μL de tampão de digestão (10x concentrado) e 6 μL de água desionizada para um tubo de centrifugação de 1,5 mL. Adicionar 10 μL dos produtos MgUGD ou MgUXS PCR purificados juntamente com as endonucleases de restrição Nde I e Xho I (1 μL cada, 20 U). Incubar a 37 ° c por 3 h.
  3. Prepare o vetor pET-30A pré-digerido: Transfira 500 ng do vetor pET-30A para um novo tubo de centrífuga de 1,5 mL e levante o volume para 16 μL usando água desionizada. Adicionar 2 μL de tampão de digestão (10x concentrado) juntamente com as endonucleases de restrição Nde I e Xho I (1 μL cada, 20 U).
    1. Após a incubação da mistura a 37 ° c durante 3 h, adicionar 1 μL de fosfatase alcalina (1 U) e incubar a 37 ° c durante uma hora adicional. Inative a fosfatase alcalina por aquecimento a 75 ° c por 10 min em um aquecedor de bloco de metal pré-aquecido.
  4. Transfira 4 μL dos produtos de DNA MgUGD ou MgUXS digeridos em tubos de centrifugação frescos de 1,5 mL e adicione 4 μL do vetor de pET-30A digerido. Adicionar 1 μL de tampão de ligadura (10x), 1 μL de ligase T4 (3 U) e incubar a mistura de reacção a 22 ° c durante 3 h.
  5. Transforme as pilhas competentes electrocompetentes de E. coli Mach1 pelo Electroporation usando os produtos da ligadura. Espalhe as células transformadas em placas de agar LB contendo 50 μg/mL de canamicina. Incubar células a 37 ° c por 16 h.
  6. Verifique colônias para a inserção desejada pelo sequenciamento de Sanger usando o promotor T7 e iniciadores de terminador de plasmídeo específicos. Prepare plasmímetros dos clones bacterianos validados.

7. testes de expressão e de atividade de MgUGD e MgUXS

  1. Transforme e . coli BL21 (de3) células competentes com plasmís que carregam os genes MgUGD e MgUXS e espalham as células transformadas em placas de agar LB contendo 50 μg/ml de canamicina. Incubar células a 37 ° c por 16 h.
  2. Cultivar uma única colônia em meio LB 5 mL com 50 μg/mL de canamicina durante a noite. Transfira a cultura para 400 mL de meio LB e agite continuamente a 200 rpm a uma temperatura de 37 ° c até que a densidade óptica em um comprimento de onda de 600 nm (OD600) atinja uma absorção de aproximadamente 0,5.
    1. Reduza a temperatura de incubação para 20 ° c e adicione 400 μL de isopropílico β-D-tiogalactopyranoside (concentração 1 M). Induzir a expressão das proteínas recombinantes por 3 h.
  3. Células de colheita por centrifugação a 4.500 x g por 15 min a 4 ° c. Suspender pellets em 10 mL de tampão de lise (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM fenilmetilsulfonilo-fluoreto (PMSF), pH 8,0).
  4. Interrompa as células por sonicação durante 20 min (40 ciclos de ligar/desligar com amplitude de 20 μm para 15 s a 4 ° c). Centrifugar a 14.000 x g a 4 ° c durante 20 min e recolher o sobrenadante para o teste de atividade.
  5. Realize o ensaio de atividade de MgUGD incubando 2 μL do lisado de células com 2 μL de UDP-glucose (10 mM), 4 μL de NAD+ (10mm), 4 μL de MgCl2 (10 mm), 2 μL de tampão Tris/HCl (500 mm, pH 7,5) e 6 μL de H2O deionizado num novo 1,5 tubo de centrifugação mL e incubar a 37 ° c durante 30 min.
  6. Realize o ensaio de atividade de MgUXS incubando 2 μL do lisado de células com 2 μL de ácido UDP-glucurônico (10 mM), 2 μL de tampão Tris/HCl (500 mM, pH 7,5) e 14 μL de H2o desionizado em um novo tubo de centrifugação de 1,5 ml e incubar a 37 ° c durante 30 min.
  7. Saciar as reações na etapa 7,5 e 7,6 adicionando 20 μL de metanol e 40 μL de clorofórmio a cada mistura. Após vortexing as misturas da amostra, centrifugue em 14.000 x g por 6 minutos em 4 ° c e colete a camada aquosa superior de cada tubo.
  8. Analise os produtos da reação usando a espectrometria maciça de MALDI-TOF no modo negativo da ionização na escala de m/z de 500-700. Misturar 1 μL de mistura de amostras com 1 μL de matriz de amostras de ácido 2,5-dihidroxibenzóico (1% p/V em 50% de acetonitrila aquosa). Observar os valores esperados de m/z em 579 e 535 para o ácido UDP-glucurônico e UDP-xilose, respectivamente (Figura 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

A Figura 1 mostra uma visão geral esquemática do método de preparação descrito da biblioteca convergente de cDNA derivada de indivíduos de ostra do Pacífico. A Figura 2 mostra as sequências dos genes COX1 e nd de um espécime de ostra distante relacionado com alta divergência das sequências genéticas COX1 e ND do material de referência. A Figura 3 mostra as sequências dos genes COX1 e nd de um espécime de ostra intimamente relacionado com baixa divergência das sequências genéticas COX1 e ND do material de referência. A Figura 4 mostra a aplicação bem-sucedida da biblioteca cDNA para clonar os genes MgUGD e MgUXS industrialmente relevantes.

Figure 1
Figura 1 : Visão geral esquemática do método de análise descrito para identificação molecular de Espécime Pacífico da ostra usando COX1 e nd como genes de referência. Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : O alinhamento da seqüência das sequências GENÉTICAS COX1 e nd de um espécime altamente divergente comparado com as seqüências do gene COX1 e nd da referência Ostra do Pacífico estirpe. Por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : O alinhamento da sequência das sequências GENÉTICAS COX1 e nd de um espécime estreitamente relacionado comparado com as seqüências do gene COX1 e nd da referência Ostra do Pacífico estirpe. Por favor clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Visão geral esquemática de clonagem molecular, expressão recombinante e detecção dos produtos de reação de MgUGD e MgUXS. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

O protocolo apresentado permite a identificação genética de espécimes não referenciados da ostra com phenotype similar dos mercados regionais do marisco pela comparação dos genes de COX1 e de ND com uma base de dados publicamente disponível do genoma do ADN da ostra. O significado desse método reside na sua simplicidade, pois apenas uma única reação de PCR é necessária para a avaliação da biblioteca virtual de cDNA. Os dois conservaram os genes COX1 e ND mitochondrial foram amplificados de uma biblioteca do cDNA que fosse gerada pela transcrição reversa de extratos do RNA de cada ostra. O método de isolamento de RNA (etapa 2,1) foi simplificado pela moagem direta do tecido de ostra em nitrogênio líquido. Após o sequenciamento dos genes COX1 e ND de cada espécime, os alinhamentos de sequência revelaram que algumas amostras mostram alta similaridade com a cepa de referência. O parente o mais próximo mostrou a identidade completa do COX1 e das seqüências do gene do ND.

As etapas as mais críticas deste procedimento são a etapa da extração do RNA; a fim minimizar a degradação do RNA, é essencial reduzir o tempo entre a colheita do tecido de ostra e a extração do RNA.

A clonagem bem sucedida foi exemplificada recentemente clonando o gene12 da ostra uge e nisto clonando os genes13de Mgugd e de mguxs, que validou a praticabilidade da biblioteca gerada do cDNA, permitindo a clonagem de todo o número de genes do interesse sem a necessidade de estratégias de clonagem complicadas usando iniciadores degenerados. Este método de identificação molecular por amplificação dos genes COX1 e ND para gerar bibliotecas de cDNA virtualmente seqüenciadas também pode ser usado em aplicações futuras para outros materiais biológicos que não têm amostras físicas de genomas referenciados Disponível.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Este trabalho foi apoiado em parte pela Fundação de ciências naturais da China (conceder números 31471703, A0201300537 e 31671854 para J.V. e ll, conceder o número 31470435 para G.Y.), e o plano de talentos estrangeiros 100 (número de subvenção JSB2014012 para J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics