Una estrategia convergente para la generación de una biblioteca de ADNc virtualmente secuenciada a partir de ostras del Pacífico sin referencia

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Describimos una estrategia para utilizar muestras de ARN de muestras de ostras del Pacífico sin referencia, y evaluamos el material genético en comparación con los datos del genoma disponibles públicamente para generar una biblioteca de ADNc virtualmente secuenciada.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El acceso al material biológico de las especies de referencia, que se utilizaron anteriormente en experimentos clave, como en el desarrollo de nuevas líneas celulares o proyectos de secuenciación del genoma, a menudo son difíciles de proporcionar para estudios adicionales o terceros debido a la carácter consintontivo de las muestras. Aunque ahora se distribuyen ampliamente en las costas del Pacífico de Asia, Australia y América del Norte, los especímenes individuales de ostras del Pacífico son genéticamente muy diversos y, por lo tanto, no son directamente adecuados como material de partida para bibliotecas de genes. En este artículo, demostramos el uso de especímenes de ostras del Pacífico sin referencia obtenidos de los mercados regionales de mariscos para generar bibliotecas de ADNc. Estas bibliotecas se compararon entonces con el genoma de la ostra disponible públicamente, y la biblioteca relacionada más cercana fue seleccionada utilizando los genes de referencia mitocondrialCón C Oxidase subunit I (COX1) y NADH Dehydrogenase (ND). La idoneidad de la biblioteca de ADNc generada también se demuestra mediante la clonación y expresión de dos genes que codifican las enzimas UDP-glucurónica acid deshidrogenasa (UGD) y UDP-xilosa sintasa (UXS), que son responsables de la biosíntesis de UDP-xilosa de UDP-glucosa.

Introduction

La adquisición de material biológico vivo al que se hace referencia puede ser difícil debido a largos plazos de entrega, razonamiento empresarial o regulaciones aduaneras específicas de cada país. Como alternativa, el material biológico requerido también puede recogerse de muestras fenotípicamente idénticas. Sin embargo, estas muestras pueden variar significativamente a nivel de genotipo, y por lo tanto las comparaciones con genomas de referencia almacenados digitalmente de la misma especie a menudo se hacen difíciles o incluso inútiles debido a la incompatibilidad del material de nueva fuente con métodos de amplificación de ADN existentes. La secuenciación de genes altamente conservados de muestras individualeses una herramienta ampliamente utilizada y poderosa para identificar la especie 1, como los genes mitocondriales conservados que se utilizan con frecuencia como genes de referencia para la evaluación de la calidad de las bibliotecas de ADNc2 ,3,4,5,6. La razón subyacente para el método aquí presentado es que la alta conservación de las secuencias genéticas mitocondriales en muestras de ostras anónimas individuales en comparación con las secuencias correspondientes del genoma de referencia indica que otros genes también pueden mostrar una bajo nivel de divergencia, dada la tasa generalmente más rápida deevolución del ADN mitocondrial en relación con el ADN nuclear 7, lo que permite la amplificación y el aislamiento de una amplia gama de genes científica e industrialmente relevantes simplemente utilizando públicamente datos de secuenciación disponibles como referencia.

El objetivo general del método aquí descrito es presentar un flujo de trabajo optimizado para generar una biblioteca de ADNc de ostras virtualmente secuenciada que se puede utilizar como ADN de plantilla para la clonación de genes de ostras. En la secuenciación virtual, se elude la secuenciación del genoma de novo; en su lugar, una secuencia de referencia conocida y almacenada digitalmente se utiliza directamente para utilizar o diseñar imprimaciones para la producción de cDNA que finalmente comprenderán una biblioteca (o se agregarán a una preexistente). El objetivo es producir una biblioteca convergente de ADNc, lo que significa que las similitudes entre las secuencias de ADNc generadas y la secuencia de referencia se pueden clasificar de baja a alta divergencia. Una ventaja clave del uso de la subunidad 1 del citocromo C Oxidasa (COX1) y nadh deshidrogenasa (ND) como genes de referencia es que incluso los especímenes de ostras altamente disyuntos geográficamente pueden ser perfilados debido a la alta conservación de estos genes mitocondriales. Habiendo demostrado el enfoque con estos marcadores bien establecidos, demostramos su aplicación a dos candidatos a enzimas que participan en la biosíntesis de nucleótidos de azúcar y pueden ser de relevancia industrial8,9, 10. El potencial biotecnológico de la ostra del Pacífico aún no está explorado. Por lo tanto, creemos que este método convergente para la preparación de una biblioteca de ADNc prácticamente secuenciada también será adecuado para los investigadores no especializados que quieren generar ADNc a partir de este material biológico relevante.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTA: En la Figura 1se muestra una descripción general esquemática.

1. Recogida de muestras

  1. Obtener muestras de ostras. Mantener las ostras en hielo durante el período postcosecha, el transporte y antes del uso y proceso de laboratorio dentro de 4-7 días después de la compra.
    NOTA: Para este protocolo, se compraron ostras en Zhong Cai Wholesale Market en Nanjing (procedentes de Ningde, Fujian, China y Lianyungang, Jiangsu, China), Haijie Aquatic Product Company en Qingdao (procedentes de Qingdao, Shandong, China), Jucheng), Jucheng Aquatic Product Company en Yantai (originaria de Yantai, Shandong, China) y Jinxiu Aquatic Product Company en Qingdao (procedente de Qingdao, Shandong, China)).

2. Aislamiento de ARN por extracción de guanidinio tiocianato-fenol

  1. Preparación de la muestra de tejido ostra
    1. Corte aproximadamente 100 mg de tejido blando homogéneo desde el centro geométrico aproximado de cada espécimen de ostra con un bisturí esterilizado, y transfiera las muestras a nitrógeno líquido.
    2. Eutanasia la parte restante de las ostras congelando a -80oC durante 1 h y desechar como residuos biológicos.
    3. Moler el tejido de ostras congelado en un polvo fino en un mortero (200 ml) lleno de 50 ml de nitrógeno líquido.
    4. Pesar 75 mg del tejido congelado de cada espécimen en un tubo de centrífuga estéril de 1,5 ml y mezclar con 1 ml del reactivo de extracción de guanidinio tiocianato-fenol. Centrifugar la muestra a 14.000 x g a 4oC durante 15 min.
  2. Transfiera el sobrenadante a un nuevo tubo centrífugo de 1,5 ml, agregue 200 ml de cloroformo y mezcle bien utilizando un mezclador de vórtice durante 10-15 s hasta que la mezcla se vuelva de color blanco lechoso.
  3. Centrifugar a 14.000 x g a 4 oC durante 15 minutos, y transferir la capa acuosa superior cuidadosamente con una pipeta de 200 ml sin perturbar la interfase en un nuevo tubo centrífugo de 1,5 ml.
  4. Añadir 500 l de alcohol isopropílico y mezclar las muestras suavemente por inversión, luego dejar las muestras durante 20 minutos sobre hielo. Centrifugar a 14.000 x g a 4oC durante 8 min y retirar el sobrenadante.
  5. Resuspenda cada uno de los pellets en 1 ml de 75% EtOH, y centrífuga a 14.000 x g a 4 oC durante 5 min. Retire todo el sobrenadante.
  6. Repita el paso 2.5 una vez. Secar los pellets durante 6 min a temperatura ambiente. No secar durante más tiempo; de lo contrario, puede ser difícil disolver el pellet de ARN en el siguiente paso.
  7. Disolver el pellet de ARN seco en 25 ml de agua tratada con DEPC (dietilpirocarbonato) y mantener el tubo sobre hielo. Utilice muestras de ARN dentro de las 24 horas.

3. Generación de la biblioteca cDNA por transcripción inversa

  1. Para cada muestra de ARN, prepare una mezcla de reacción utilizando el sistema de transcripción inversa comercial utilizando una pipeta de 10 l: Añadir 4 l de solución de MgCl2, 2 l de búfer de reacción 10x, 2 l de solución dNTP, 0,5 ml de inhibidor de la RNase, 0,7 l de AMV Reverse Transcriptasa, 0,5 l de Oligo(dT) 15 imprimación, 1 l de la muestra de ARN extraída y 9,3 l de H2O en un tubo de PCR de 300 ml.
  2. Incubar la mezcla en un termociclador PCR durante 60 min a 42 oC, y luego aumentar la temperatura a 95 oC durante 5 min.
  3. Almacene la biblioteca de ADNc generada durante un máximo de 12 meses a -20 oC.

4. Amplificación y purificación del gen mitocondrial

  1. Preparar la mezcla de PCR con una pipeta de 10 ml. Añadir 0,25 l (1,25 U) de polimerasa de ADN de alta fidelidad, 2 l de solución dNTP (2,5 mM de cada dNTP), 0,5 l de la imprimación delantera COX1 o ND (100 m), 0,5 l de la imprimación inversa COX1 o ND correspondiente (100 m), 1 l de la biblioteca de ADNc (100 oM), 1 l de la biblioteca de ADNc. , 5 l de solución tampón de 5x y 16 l de H2O destilado en un tubo pcR de 300 ml.
  2. Realizar la amplificación de PCR utilizando los siguientes parámetros: Después de un paso inicial de desnaturalización a 95 oC (duración 5 min), 35 ciclos de reacción de PCR que consisten en un paso de recocido a 55 oC (30 s), paso de alargamiento a 72 oC (2 min) y paso de desnaturalización a 95 oC (30 s) , realice un paso de alargamiento final durante 5 min a 72 oC.
  3. Utilizar 5 l del producto PCR para verificar mediante electroforesis de gel de agarosa la calidad del producto PCR obtenido. Observe el gen COX1 o ND amplificado como una sola banda en 759 o 748 pares base, respectivamente.
  4. Purifique el resto del producto PCR con un kit de limpieza de PCR.
    1. Añadir 100 l de solución 'PCR-A' (tampón de unión de ADN que contiene altas concentraciones de sales chaotrópicas11) a la muestra. Vórtice brevemente para mezclar el contenido.
    2. Coloque la columna de purificación en un tubo centrífugo de 2 ml. Pipetear la mezcla de reacción de 4.4.1. en la columna. Centrífuga a 14.000 x g durante 1 min a temperatura ambiente.
    3. Deseche el filtrado del tubo de centrífuga. Devolver la columna al tubo centrífugo de 2 ml, añadir 700 ml de solución 'W2' en la columna y centrifugar a 14.000 x g durante 1 min a temperatura ambiente ('W2' es una solución de lavado que contiene altas concentraciones de etanol para la eliminación de chaotrópico residual sales de la columna de purificación).
    4. Deseche el filtrado y devuelva la columna al tubo centrífugo de 2 ml. Añadir 400 ml de solución 'W2' a la columna y centrifugar a 14.000 x g durante 1 min a temperatura ambiente.
    5. Precalentar 1 ml de agua desionizada a 65 oC en un calentador de bloque metálico. Transfiera la columna a un nuevo tubo centrífugo de 1,5 ml. Pipeta de 25 oC de agua desionizada precalentada en caliente de 65oC hasta el centro de la membrana de la columna blanca. Deje que la membrana se empape durante 1 min a temperatura ambiente.
    6. Centrifugar a 14.000 x g durante 1 min a temperatura ambiente y desechar la columna.
  5. Almacene el producto PCR purificado durante un máximo de 12 meses a -20 oC.

5. Secuenciación y comparación del gen mitocondrial

  1. Envíe las muestras de PCR purificadas del paso 4.5 para la secuenciación de Sanger utilizando las imprimaciones de avance COX1 o ND pertinentes como imprimaciones de secuenciación. Opcionalmente, las imprimaciones inversas COX1 o ND también se pueden utilizar para la secuenciación bidireccional.
  2. Después de recuperar los resultados de la secuenciación, compare las secuencias con la secuencia del genoma de la cepa de referencia de ostras del Pacífico (NCBI Taxonomy ID: 29159) utilizando la herramienta en línea NCBI Nucleotide BLAST (blast.ncbi.nlm.nih.gov) (Figura2 y Figura 3 ).

6. Aplicar la biblioteca de ADNpara la clonación de los genes MgUGD y MgUXS

  1. Amplifique y purifique los genes MgUGD y MgUXS utilizando las respectivas imprimaciones delanteras y inversas de MgUGD y MgUXS mediante PCR siguiendo los pasos 4.1. a 4.4.
  2. Transfiera 2 ml de tampón de digestión (10x concentrado) y 6 l de agua desionizada a un tubo centrífugo de 1,5 ml. Añadir 10 l de los productos de PCR MgUGD o MgUXS purificados junto con las endonucleaseas de restricción Nde I y Xho I (1 l cada uno, 20 U). Incubar a 37oC durante 3 h.
  3. Preparar el vector pET-30a predigerido: Transfiera 500 ng del vector pET-30a a un nuevo tubo centrífugo de 1,5 ml y recabe el volumen a 16 ml utilizando agua desionizada. Añadir 2 l de tampón de digestión (10x concentrado) junto con las restricciones endonucleaseas Nde I y Xho I (1 l cada una, 20 U).
    1. Después de incubar la mezcla a 37oC durante 3 h, añadir 1 oL de fosfatasa alcalina (1 U) e incubar a 37oC durante una hora adicional. Inactivar la fosfatasa alcalina calentando a 75 oC durante 10 minutos en un calentador de bloque de metal precalentado.
  4. Transfiera 4 l de los productos de ADN MgUGD o MgUXS digeridos a tubos de centrífuga frescos de 1,5 ml y añada 4 ml del vector pET-30a digerido. Añadir 1 l de tampón de ligadura (10x), 1 l de ligada T4 (3 U) e incubar la mezcla de reacción a 22 oC durante 3 h.
  5. Transformar electrocompetente E. coli Mach1 Células competentes por electroporación utilizando los productos de ligadura. Extienda las células transformadas en placas de agar LB que contengan kanamicina de 50 g/ml. Incubar células a 37oC durante 16 h.
  6. Verifique las colonias para la inserción deseada por secuenciación de Sanger usando las imprimaciones de terminador y promotora T7 específicas del plásmido. Preparar plásmidos de los clones bacterianos validados.

7. Pruebas de expresión y actividad de MgUGD y MgUXS

  1. Transforme E. coli BL21 (DE3) Células competentes con plásmidos que llevan los genes MgUGD y MgUXS y extienda las células transformadas en placas de agar LB que contienen kanamicina de 50 g/ml. Incubar células a 37oC durante 16 h.
  2. Cultivar una sola colonia en medio LB de 5 ml con kanamicina de 50 g/ml durante la noche. Transfiera el cultivo a un medio LB de 400 ml y agite continuamente a 200 rpm a una temperatura de 37 oC hasta que la densidad óptica a una longitud de onda de 600 nm (OD600)alcance una absorción de aproximadamente 0,5.
    1. Reducir la temperatura de incubación a 20 oC y añadir 400 s de isopropilo-D-thiogalactopyranoside (concentración 1 M). Inducir la expresión de las proteínas recombinantes durante 3 h.
  3. Cosecha las células por centrifugación a 4.500 x g durante 15 min a 4oC. Suspenda los pellets en 10 ml de tampón de lisis (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM de flúor fenilsulfonil(PMSF), pH 8.0).
  4. Interrumpir las células por sonicación durante 20 min (40 ciclos de encendido/apagado con una amplitud de 20 m durante 15 s a 4 oC). Centrifugar a 14.000 x g a 4oC durante 20 min y recoger el sobrenadante para la prueba de actividad.
  5. Realizar el ensayo de actividad de MgUGD incubando 2 l de lisato celular con 2 l de UDP-glucosa (10 mM), 4 l de NAD+ (10 mM), 4 l de MgCl2 (10 mM), 2 l de tampón Tris/HCl (500 mM, pH 7,5) y 6 l de desionizado H2O en un nuevo 1,5 MM mL centrífuga tubo e incubar a 37 oC durante 30 min.
  6. Realice el ensayo de actividad de MgUXS incubando 2 l de lisato celular con 2 l de ácido UDP-glucurónico (10 mM), 2 l de tampón Tris/HCl (500 mM, pH 7,5) y 14 l de H2O desionizado en un nuevo tubo de centrifugación de 1,5 ml e incubar a 37 oC durante 30 minutos.
  7. Atemple las reacciones en los pasos 7.5 y 7.6 añadiendo 20 s de metanol y 40 s de cloroformo a cada mezcla. Después de vórtice las mezclas de muestra, centrifugar a 14.000 x g durante 6 min a 4 oC y recoger la capa acuosa superior de cada tubo.
  8. Analice los productos de reacción utilizando espectrometría de masas MALDI-TOF en modo de ionización negativa en el rango m/z de 500-700. Mezclar 1 l de mezcla de muestra con 1 l de matriz de muestra de ácido dihidroxibenzoico de 2,5-dihidroxibenzoico (1% p/V en acetonitrilo acuoso al 50%). Observe los valores m/z esperados en 579 y 535 para el ácido UDP-glucurónico y UDP-xilosa, respectivamente (Figura4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La Figura 1 muestra una descripción esquemática del método de preparación descrito de la biblioteca convergente de ADNc derivada de individuos de ostras del Pacífico. La Figura 2 muestra las secuencias de los genes COX1 y ND de un espécimen de ostra distantemente relacionado con alta divergencia de las secuencias genéticas COX1 y ND del material de referencia. La Figura 3 muestra las secuencias de los genes COX1 y ND de un espécimen de ostra estrechamente relacionado con baja divergencia de las secuencias genéticas COX1 y ND del material de referencia. La Figura 4 muestra la aplicación exitosa de la biblioteca de ADNc para clonar los genes industrialmente relevantes MgUGD y MgUXS.

Figure 1
Figura 1 : Visión general esquemática del método de análisis descrito para identificación molecular de Espécimen de ostras del Pacífico utilizando COX1 y ND como genes de referencia. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Alineación secuencial de las secuencias genéticas COX1 y ND de un espécimen altamente divergente en comparación con las secuencias genéticas COX1 y ND de la referencia Ostra del Pacífico tensión. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Alineación secuencial de las secuencias genéticas COX1 y ND de un espécimen estrechamente relacionado en comparación con las secuencias genéticas COX1 y ND de la referencia Ostra del Pacífico tensión. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Visión general esquemática de clonación molecular, expresión recombinante y detección de los productos de reacción de MgUGD y MgUXS. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El protocolo presentado permite la identificación genética de muestras de ostras sin referencia con fenotipo similar de los mercados regionales de mariscos en comparación con los genes COX1 y ND con una base de datos de genoma de ADN de ostra disponible públicamente. La importancia de este método radica en su simplicidad, ya que sólo se necesita una sola reacción de PCR para la evaluación de la biblioteca virtual de ADNc. Los dos genes mitocondriales COX1 y ND conservados se amplificaron a partir de una biblioteca de ADNc que se generó mediante la transcripción inversa de extractos de ARN de cada ostra. El método de aislamiento de ARN (paso 2.1) se simplificó moliendo directamente el tejido de ostra en nitrógeno líquido. Después de secuenciar los genes COX1 y ND de cada espécimen, las alineaciones de secuencia revelaron que algunas muestras muestran una alta similitud con la cepa de referencia. El pariente más cercano mostró una identidad completa de las secuencias genéticas COX1 y ND.

Los pasos más críticos de este procedimiento son el paso de extracción de ARN; con el fin de minimizar la degradación del ARN, es esencial reducir el tiempo entre la cosecha del tejido de ostra y la extracción de ARN.

La clonación exitosa se ejemplificó recientemente clonando el gen ugetestra12 y en este caso clonando los genes MgUGD y MgUXS13, que validaron la practicidad de la biblioteca de ADNc generada, permitiendo la clonación de cualquier número de genes de interés sin necesidad de estrategias de clonación engorrosas utilizando imprimaciones degeneradas. Este método de identificación molecular por amplificación de los genes COX1 y ND para generar bibliotecas de ADNc prácticamente secuenciadas también puede utilizarse en aplicaciones futuras para otros materiales biológicos que no tengan muestras físicas de genomas referenciados Disponible.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado en parte por la Fundación de Ciencias Naturales de China (números de concesión 31471703, A0201300537 y 31671854 a J.V. y L.L., otorgar el número 31470435 a G.Y.), y el Plan de Talentos Extranjeros 100 (número de concesión JSB2014012 a J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics