Une stratégie convergente pour la génération d'une bibliothèque d'ADNc pratiquement séquencée à partir d'huîtres du Pacifique non référencées

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous décrivons une stratégie pour l'utilisation d'échantillons d'ARN à partir de spécimens d'huîtres du Pacifique non référencés, et évaluons le matériel génétique par comparaison avec les données génomiques accessibles au public pour générer une bibliothèque d'ADNc pratiquement séquencée.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L'accès au matériel biologique des espèces de référence, qui ont été utilisés précédemment dans des expériences clés telles que dans le développement de nouvelles lignées cellulaires ou de projets de séquençage du génome, est souvent difficile à prévoir pour d'autres études ou des tiers en raison de la nature consommatrice des échantillons. Bien qu'ils soient maintenant largement répartis sur les côtes du Pacifique de l'Asie, de l'Australie et de l'Amérique du Nord, les spécimens individuels d'huîtres du Pacifique sont génétiquement très diversifiés et ne conviennent donc pas directement comme matériau de départ pour les bibliothèques de gènes. Dans cet article, nous démontrons l'utilisation de spécimens d'huîtres du Pacifique non référencés obtenus sur les marchés régionaux des fruits de mer pour générer des bibliothèques d'ADNc. Ces bibliothèques ont ensuite été comparées au génome d'huîtres accessible au public, et la bibliothèque connexe la plus proche a été sélectionnée à l'aide des gènes de référence mitochondriaux Cytochrome C Oxidase subunit I (COX1) et NADH Dehydrogenase (ND). La pertinence de la bibliothèque d'ADNc générée est également démontrée par le clonage et l'expression de deux gènes codant les enzymes UDP-glucuronic acid dehydrogenase (UGD) et UDP-xylose synthase (UXS), qui sont responsables de la biosynthèse de UDP-xylose de UDP-glucose.

Introduction

L'acquisition de matériel biologique référencé vivant peut être difficile en raison des longs délais de livraison, du raisonnement entrepreneurial ou de la réglementation douanière par pays. Comme alternative, le matériel biologique requis peut également être recueilli à partir de spécimens phénotypiquement identiques. Cependant, ces échantillons peuvent varier considérablement au niveau du génotype, et donc les comparaisons avec les génomes de référence stockés numériquement de la même espèce sont souvent rendues difficiles, voire futiles en raison de l'incompatibilité du matériel nouvellement méthodes d'amplification de l'ADN existantes. Le séquençage des gènes hautement conservés d'échantillons individuels est un outil largement utilisé et puissant pour identifier les espèces1, telles que les gènes mitochondriaux conservés qui sont fréquemment utilisés comme gènes de référence pour l'évaluation de la qualité des bibliothèques d'ADNc2 ,3,4,5,6. La raison sous-jacente de la méthode présentée dans le présent est que la conservation élevée des séquences de gènes mitochondriaux dans des échantillons d'huîtres anonymes individuels par rapport aux séquences correspondantes du génome de référence indique que d'autres gènes peuvent également montrer un faible niveau de divergence, étant donné le taux généralement plus rapide d'évolution de l'ADN mitochondrial par rapport à l'ADN nucléaire7, permettant l'amplification et l'isolement d'un large éventail de gènes scientifiquement et industriellement pertinents en utilisant simplement publiquement données de séquençage disponibles à titre de référence.

L'objectif global de la méthode décrite ci-dessus est de présenter un flux de travail optimisé pour générer une bibliothèque d'ADNc d'huîtres pratiquement séquencée qui peut être utilisée comme modèle d'ADN pour le clonage des gènes de l'huître. Dans le séquençage virtuel, le séquençage du génome de novo est contourné; au lieu de cela, une séquence de référence connue et stockée numériquement est utilisée directement pour utiliser ou concevoir des amorces pour la production de cDNA qui finiront par constituer une bibliothèque (ou être ajoutées à une bibliothèque préexistante). L'objectif est de produire une bibliothèque convergente d'ADNc, ce qui signifie que les similitudes entre les séquences d'ADNc générées et la séquence de référence peuvent être classées de faible à haute divergence. Un avantage clé de l'utilisation de Cytochrome C Oxidase subunit 1 (COX1) et NADH Dehydrogenase (ND) comme gènes de référence est que même les spécimens d'huîtres très disjonctées géographiquement peuvent être profilés en raison de la haute conservation de ces gènes mitochondriaux. Après avoir prouvé l'approche avec ces marqueurs bien établis, nous démontrons alors son application à deux candidats enzymatiques qui sont impliqués dans la biosynthèse des nucléotides de sucre et peuvent être d'une pertinence industrielle8,9, 10. Le potentiel biotechnologique de l'huître du Pacifique est encore inexploré. Ainsi, nous croyons que cette méthode convergente pour la préparation d'une bibliothèque d'ADNc pratiquement séquencée sera également appropriée pour les chercheurs non-spécialistes qui veulent générer de l'ADNc à partir de ce matériel biologique pertinent.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

REMARQUE : Un aperçu schématique est affiché à la figure 1.

1. Collecte d'échantillons

  1. Obtenir des spécimens d'huîtres. Conserver les huîtres sur la glace pendant la période post-récolte, le transport et avant l'utilisation et le traitement en laboratoire dans les 4 à 7 jours suivant l'achat.
    REMARQUE : Pour ce protocole, des huîtres ont été achetées au marché de gros de Zhong Cai à Nanjing (provenant de Ningde, Fujian, Chine et Lianyungang, Jiangsu, Chine), Haijie Aquatic Product Company à Qingdao (originaire de Qingdao, Shandong, Chine), Jucheng Aquatic Product Company à Yantai (originaire de Yantai, Shandong, Chine) et Jinxiu Aquatic Product Company à Qingdao (originaire de Qingdao, Shandong, Chine).).

2. Isolement d'ARN par extraction de piocyanate-phénol de guanidinium

  1. Préparation de l'échantillon de tissu d'huître
    1. Découper environ 100 mg de tissu mou homogène du centre géométrique approximatif de chaque spécimen d'huître avec un scalpel stérilisé, et transférer les échantillons en azote liquide.
    2. Euthanasier la partie restante des huîtres en congelant à -80 oC pendant 1 h et jeter comme déchets biologiques.
    3. Broyer le tissu d'huîtres congelé saxède dans une poudre fine dans un mortier (200 ml) rempli de 50 ml d'azote liquide.
    4. Peser 75 mg du tissu congelé de chaque spécimen dans un tube stérile de centrifugeuse de 1,5 ml et mélanger avec 1 ml de réagent d'extraction de piocyanate-phénol de guanidinium. Centrifuger l'échantillon à 14 000 x g à 4 oC pendant 15 min.
  2. Transférer le supernatant dans un nouveau tube de centrifugeuse de 1,5 ml, ajouter 200 l de chloroforme et bien mélanger à l'aide d'un mélangeur à vortex pendant 10-15 s jusqu'à ce que le mélange devienne blanc laiteux.
  3. Centrifugeuse à 14 000 x g à 4 oC pendant 15 min, et transférer soigneusement la couche supérieure aqueuse à l''eau d'une pipette de 200 l sans perturber l'interphase dans un nouveau tube centrifugeur de 1,5 mL.
  4. Ajouter 500 l d'alcool isopropyl et mélanger les échantillons doucement par inversion, puis laisser les échantillons pendant 20 min sur la glace. Centrifugeuse à 14 000 x g à 4 oC pendant 8 min et retirer le supernatant.
  5. Suspendre chacune des granulés dans 1 ml de 75 % et centrifugeuse à 14 000 x g à 4 oC pendant 5 min. Retirez tout le supernatant.
  6. Répétez l'étape 2.5 une fois. Sécher les granulés pendant 6 min à température ambiante. Ne pas sécher plus longtemps; sinon, il peut être difficile de dissoudre la pastille d'ARN à l'étape suivante.
  7. Dissoudre la pastille d'ARN séchée dans 25 'L d'eau traitée par DEPC (diethylpyrocarbonate) et garder le tube sur la glace. Utilisez des échantillons d'ARN dans les 24 h.

3. génération de bibliothèque de cDNA par transcription inversée

  1. Pour chaque échantillon d'ARN, préparer un mélange de réaction à l'aide d'un système de transcription inverse commercial à l'aide d'une pipette de 10 l : Ajouter 4 l de solution MgCl 2, 2 l de 10x Reaction Buffer, 2 'L de solution dNTP, 0,5 'L d'inhibiteur de rNase, 0,7 'L de AMV Reverse Transcriptase, 0,5 L d'Oligo (dT) 15 apprêt, 1 L de l'échantillon d'ARN extrait et 9,3 L de H2O dans un tube PCR de 300 l.
  2. Incuber le mélange dans un thermocycler PCR pendant 60 min à 42 oC, puis augmenter la température à 95 oC pendant 5 min.
  3. Entreposez la bibliothèque d'ADNc générée jusqu'à 12 mois à -20 oC.

4. Amplification et purification des gènes mitochondriaux

  1. Préparer le mélange de PCR à l'aide d'une pipette de 10 l. Ajouter 0,25 L (1,25 U) de polymérase d'ADN haute fidélité, 2 l de solution dNTP (2,5 ml de chaque dNTP), 0,5 l de l'amorce avant COX1 ou ND (100 M), 0,5 l de l'amorce inverse COX1 ou ND correspondante (100 M), 1 l de la bibliothèque de l'ADNC , 5 L de solution tampon 5x et 16 oL de H2O distillé dans un tube PCR de 300 l.
  2. Effectuer l'amplification du PCR en utilisant les paramètres suivants : Après une première étape de dénaturation à 95 oC (durée 5 min), 35 cycles de réaction PCR consistant en une étape d'annealing à 55 oC (30 s), une étape d'allongement à 72 oC (2 min) et une étape de dénaturation à 95 oC (30 s) , effectuer une étape d'allongement finalisant pendant 5 min à 72 oC.
  3. Utilisez 5 L du produit PCR pour vérifier par électrophoresis gel d'agarose la qualité du produit PCR obtenu. Observez le gène amplifié COX1 ou ND en une seule bande à 759 ou 748 paires de base, respectivement.
  4. Purifie le reste du produit PCR avec un kit de nettoyage PCR.
    1. Ajouter 100 l de solution 'PCR-A' (tampon de liaison d'ADN qui contient des concentrations élevées de sels chaotropes11) à l'échantillon. Vortex brièvement pour mélanger le contenu.
    2. Placer la colonne de purification dans un tube centrifugeur de 2 ml. Pipette le mélange de réaction de 4.4.1. dans la colonne. Centrifugeuse à 14 000 x g pendant 1 min à température ambiante.
    3. Jeter le filtrate du tube de centrifugeuse. Remettre la colonne dans le tube de centrifugeuse de 2 ml, ajouter 700 l de solution ' W2' dans la colonne et centrifugeuse à 14 000 x g pendant 1 min à température ambiante (« W2 » est une solution de lavage qui contient de fortes concentrations d'éthanol pour l'élimination des chaotropes résiduelles sels de la colonne de purification).
    4. Jeter le filtrate et remettre la colonne dans le tube de centrifugeuse de 2 ml. Ajouter 400 oL de solution ' W2' à la colonne et à la centrifugeuse à 14 000 x g pendant 1 min à température ambiante.
    5. Préchauffer 1 ml d'eau déionisée à 65 oC dans un chauffe-blocs métalliques. Transférer la colonne dans un nouveau tube centrifugeur de 1,5 mL. Pipette 25 'L de l'eau désionisée préchauffée à la chaleur de 65 oC au centre de la membrane de la colonne blanche. Laisser tremper la membrane pendant 1 min à température ambiante.
    6. Centrifugeuse à 14 000 x g pendant 1 min à température ambiante et jetez la colonne.
  5. Entreposez le produit PCR purifié jusqu'à 12 mois à -20 oC.

5. Séquençage et comparaison de gènes mitochondriaux

  1. Envoyez les échantillons de PCR purifiés de l'étape 4.5 pour le séquençage De Sanger à l'aide des amorces avant COX1 ou ND pertinentes comme amorces de séquençage. En option, les amorces inverses COX1 ou ND peuvent également être utilisées pour le séquençage bidirectionnel.
  2. Après avoir récupéré les résultats du séquençage, comparez les séquences avec la séquence génomique de la souche de référence des huîtres du Pacifique (ID de taxonomie NCBI : 29159) à l'aide de l'outil en ligne NCBI Nucleotide BLAST (blast.ncbi.nlm.nih.gov) (figure2 et figure 3 ).

6. Application de la bibliothèque d'ADNc pour le clonage des gènes MgUGD et MgUXS

  1. Amplifiez et purifionz les gènes MgUGD et MgUXS à l'aide des amorces avant et inverses respectives de MgUGD et MgUXS par PCR suivant les étapes 4.1. à 4,4.
  2. Transférer 2 ll de tampon de digestion (10x concentré) et 6 l d'eau déionisée dans un tube de centrifugeuse de 1,5 mL. Ajoutez 10 L des produits purifiés MgUGD ou MgUXS PCR ainsi que la restriction endonucleases Nde I et Xho I (1 l chacun, 20 U). Incuber à 37 oC pendant 3 h.
  3. Préparer le vecteur pET-30a prédigéré : Transférer 500 ng du vecteur pET-30a dans un nouveau tube de centrifugeuse de 1,5 mL et recharger le volume à 16 L à l'aide d'eau désionisée. Ajouter 2 ll de tampon de digestion (10x concentré) avec la restriction endonucleases Nde I et Xho I (1 L chacun, 20 U).
    1. Après avoir incubé le mélange à 37 oC pendant 3 h, ajouter 1 l de phosphatase alcaline (1 U) et couver à 37 oC pendant une heure supplémentaire. Inactiver la phosphatase alcaline en chauffant à 75 oC pendant 10 min dans un chauffe-blocs métalliques préchauffé.
  4. Transférer 4 ll des produits d'ADN MgUGD ou MgUXS digérés dans des tubes frais de centrifugeuse de 1,5 ml et ajouter 4 l l du vecteur pET-30a digéré. Ajouter 1 l de tampon de ligation (10x), 1 l de ligase T4 (3 U) et incuber le mélange de réaction à 22 oC pendant 3 h.
  5. Transformez les cellules electrocompétentes E. coli Mach1 Competent Cells par électroporation à l'aide des produits de ligature. Étendre les cellules transformées sur des plaques d'agar LB contenant 50 og/mL de kanamycine. Incuber les cellules à 37 oC pendant 16 h.
  6. Vérifier les colonies pour l'insertion souhaitée par le séquençage Sanger à l'aide du plasmide spécifique T7 promoteur et amorces terminator. Préparer les plasmides à partir des clones bactériens validés.

7. Tests d'expression et d'activité de MgUGD et MgUXS

  1. Transformez E. coli BL21 (DE3) Cellules compétentes avec des plasmides portant les gènes MgUGD et MgUXS et propagez les cellules transformées sur des plaques d'agar LB contenant 50 g/mL de kanamycine. Incuber les cellules à 37 oC pendant 16 h.
  2. Cultiver une seule colonie dans un milieu lb de 5 ml avec 50 g/mL de kanamycine pendant la nuit. Transférer la culture dans un milieu LB de 400 ml et secouer continuellement à 200 tr/min à une température de 37 oC jusqu'à ce que la densité optique à une longueur d'onde de 600 nm (OD600) atteigne une absorption d'environ 0,5.
    1. Réduire la température d'incubation à 20 oC et ajouter 400 oL d'isopropyl-D-thiogalactopyranoside (concentration de 1 M). Induire l'expression des protéines recombinantes pendant 3 h.
  3. Récolter les cellules par centrifugation à 4 500 x g pendant 15 min à 4 oC. Suspendre les granulés dans 10 ml de tampon de lyse (100 mM NaCl, 50 mM Tris/HCl, 1 % Triton X-100, 1 mM de phénylmethylsulfonyl- fluorure (PMSF), pH 8,0).
  4. Perturber les cellules par sonication pendant 20 min (40 cycles d'on/off avec une amplitude de 20 m pour 15 s à 4 oC). Centrifugeuse à 14 000 x g à 4 oC pendant 20 min et collecte le supernatant pour le test d'activité.
  5. Effectuer l'exemple d'activité de MgUGD en couvant 2 l de lysate cellulaire avec 2 l d'UDP-glucose (10 mM), 4 L de NAD (10 mM), 4 oL de MgCl2 (10 mM), 2 l de tampon Tris/HCl (500 mM, pH 7,5), et 6 l de H2Deionized tube de centrifugeuse mL et incuber à 37 oC pendant 30 min.
  6. Effectuer l'essai d'activité de MgUXS en couvant 2 l l de lysate cellulaire avec 2 L d'acide UDP-glucuronique (10 mM), 2 l de tampon Tris/HCl (500 mM, pH 7,5), et 14 l de H2O déionisé dans une nouvelle tube de centrifugeuse de 1,5 mL et incubée à 37 m.
  7. Étancher les réactions à l'étape 7.5 et 7.6 en ajoutant 20 l de méthanol et 40 l de chloroforme à chaque mélange. Après le vortex des mélanges d'échantillon, centrifugeuse à 14.000 x g pendant 6 min à 4 oC et de recueillir la couche supérieure aqueuse de chaque tube.
  8. Analyser les produits de réaction à l'aide de la spectrométrie de masse MALDI-TOF en mode ionisation négative dans la gamme m/z de 500 à 700. Mélanger 1 ll de mélange d'échantillon avec 1 'L de matrice d'échantillon d'acide dihydroxybenzoïque de 2,5 -dihydroxybenzoic (1% w/V dans 50% acetonitrile aqueuse). Observez les valeurs m/z attendues à 579 et 535 pour l'acide UDP-glucuronique et l'UDP-xylose, respectivement (figure 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figure 1 montre un aperçu schématique de la méthode de préparation décrite de la bibliothèque convergente de l'ADNc dérivée d'individus d'huîtres du Pacifique. La figure 2 montre les séquences des gènes COX1 et ND d'un spécimen d'huîtres apparenté éloigné avec une forte divergence des séquences de gènes COX1 et ND du matériau de référence. La figure 3 montre les séquences des gènes COX1 et ND d'un spécimen d'huître étroitement apparenté avec une faible divergence par rapport aux séquences de gènes COX1 et ND du matériau de référence. La figure 4 montre l'application réussie de la bibliothèque d'ADNc pour cloner les gènes industriellement pertinents MgUGD et MgUXS.

Figure 1
Figure 1 : Aperçu schématique de la méthode d'analyse décrite pour l'identification moléculaire des Spécimen d'huître du Pacifique cox1 et ND comme gènes de référence. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Alignement de séquence des séquences de gènes COX1 et ND d'un spécimen très divergent par rapport aux séquences de gènes COX1 et ND de la référence Huître du Pacifique souche. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Alignement de séquence des séquences de gènes COX1 et ND d'un spécimen étroitement apparenté par rapport aux séquences de gènes COX1 et ND de la référence Huître du Pacifique souche. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Aperçu schématique de clonage moléculaire, expression recombinante et détection des produits de réaction de MgUGD et MgUXS. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le protocole présenté permet l'identification génétique de spécimens d'huîtres non référencés avec un phénotype similaire provenant des marchés régionaux des fruits de mer en comparant les gènes COX1 et ND avec une base de données du génome de l'ADN des huîtres accessible au public. L'importance de cette méthode réside dans sa simplicité, car une seule réaction PCR est nécessaire pour l'évaluation de la bibliothèque d'ADNc virtuelle. Les deux gènes mitochondriaux conservés de COX1 et de ND ont été amplifiés à partir d'une bibliothèque d'ADNc qui a été générée par la transcription inversée des extraits d'ARN de chaque huître. La méthode d'isolement de l'ARN (étape 2.1) a été simplifiée en broyant directement le tissu d'huîtres dans de l'azote liquide. Après le séquençage des gènes COX1 et ND de chaque spécimen, les alignements de séquence ont révélé que certains échantillons montrent une forte similitude avec la souche de référence. Le parent le plus proche a montré l'identité complète des séquences de gène COX1 et ND.

Les étapes les plus critiques de cette procédure sont l'étape d'extraction d'ARN ; afin de minimiser la dégradation de l'ARN, il est essentiel de réduire le temps entre la récolte du tissu ostréicole et l'extraction de l'ARN.

Le clonage réussi a été récemment illustré par le clonage du gène uge d'huître12 et ici en clonant les gènes mgUGD et MgUXS13, qui ont validé la praticité de la bibliothèque générée de cDNA, permettant le clonage d'un certain nombre de gènes d'intérêt sans avoir besoin de stratégies de clonage encombrantes à l'aide d'amorces dégénérées. Cette méthode d'identification moléculaire par amplification des gènes COX1 et ND pour générer des bibliothèques d'ADNc pratiquement séquencées peut également être utilisée dans des applications futures pour d'autres matériaux biologiques qui n'ont pas d'échantillons physiques de génomes référencés. disponible.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Ce travail a été soutenu en partie par la Fondation des sciences naturelles de Chine (numéros de subvention 31471703, A0201300537 et 31671854 à J.V. et L.L., numéro de subvention 31470435 à G.Y.), et le plan 100 talents étrangers (numéro de subvention JSB2014012 à J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics