דיגיטלי PCR מבוססי אינדקס תחרותי עבור ניתוח תפוקה גבוהה של כושר בסלמונלה

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

זו גישה מולקולרית מבוסס לקביעת כושר חיידקי מאפשר זיהוי מדויק ומדויק של מיקרואורגניזמים באמצעות ברקודים ייחודי DNA גנומית כי הם כימות דרך ה-PCR הדיגיטלי. הפרוטוקול מתאר חישוב המדד תחרותי עבור זני סלמונלה ; עם זאת, הטכנולוגיה ניתנת להתאמה בקלות לפרוטוקולים הדורשים קוונפיקציה מוחלטת של אורגניזם גנטית מחושל.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Shaw, J. A., Bourret, T. J. Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella. J. Vis. Exp. (147), e59630, doi:10.3791/59630 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

אינדקס תחרותי הוא שיטה נפוצה המשמשת להערכת כושר בקטריאלי ו/או התקפה אלימה. השירות של גישה זו הוא לידי ביטוי בקלות שלה לבצע את יכולתה לתקנן את הכושר של זנים רבים לאורגניזם פראי. הטכניקה מוגבלת, עם זאת, על-ידי סמנים פנוטיפי זמינים ומספר זנים שניתן להעריך בו, יצירת הצורך מספר רב של ניסויים לשכפל. במקביל עם מספר רב של ניסויים, עלויות העבודה והחומר לכימות חיידקים המבוססים על סמנים פנוטימית אינם משמעותיים. כדי להתגבר על היבטים שליליים אלה תוך שמירה על היבטים חיוביים, פיתחנו גישה מולקולרית מבוסס לכמת מיקרואורגניזמים ישירות לאחר סמנים גנטיים הנדסה על כרומוזומים חיידקיים. ייחודי, 25 ברקוד DNA צמד ברקודים נוספו בתוך לוקוס מזיק על כרומוזום של מסוג פראי ומוטציה זנים של סלמונלה. ניסויים בתחרויות חוץ-גופית בוצעו. באמצעות אינוימדוזה המורכבת מזנים במאגר בעקבות התחרות, המספרים המוחלט של כל זן היו מקוונטים באמצעות ה-PCR הדיגיטלי והמדדים התחרותיים לכל זן חושבו מערכים אלה. הנתונים שלנו עולה כי גישה זו לכמת סלמונלה הוא רגיש מאוד, מדויק, ומדויק לגילוי הן בשפע מאוד (כושר גבוה) נדיר (כושר נמוך) מיקרואורגניזמים. בנוסף, טכניקה זו ניתנת להתאמה בקלות כמעט כל אורגניזם עם כרומוזומים מסוגל לשנות, כמו גם עיצובים ניסיוניים שונים הדורשים קוונפיקציה מוחלטת של מיקרואורגניזמים.

Introduction

הערכת כושר והתקפה של אורגניזמים פתוגניים הוא היבט בסיסי של מחקר המיקרוביולוגיה. היא מאפשרת השוואות להתבצע בין זנים או בין אורגניזמים מוטציה, אשר מאפשר לחוקרים לקבוע את החשיבות של גנים מסוימים בתנאים ספציפיים. באופן מסורתי, הערכה אלימה משתמשת במודל החי של זיהום באמצעות זנים חיידקיים שונים והתבוננות בתוצאה של החיה הנגועה (למשל מינון זיהומיות50, מינון קטלני50, זמן למוות, חומרת הסימפטום, חוסר סימפטומים וכו '). הליך זה מספק תיאורים יקרי ערך של התקפה אלימה, אבל זה דורש זנים כדי לגרום הבדלים ניכרים בתוצאות כדי לזהות וריאציות מסוג פראי. יתר על כן, התוצאות הן חצי כמותית, כי בעוד התקדמות המחלה ואת חומרת הסימפטום יכול להיות סובייקטיבי לאורך זמן, פרשנות של התקפה אלימה בהשוואה לסוג פראי הוא האיכותי יותר (כלומר, יותר, פחות, או המוני באותה מידה). חלופה מקובלת לביצוע בעלי חיים הנגועים הוא ליצור מדדים תחרותיים (CIs), ערכים השווים ישירות כושר או התקפה אלימה של זן לעמיתו מסוג פראי בזיהום מעורב1. לטכניקה זו יש יתרונות רבים לעומת מודל בעלי חיים מסורתי של זיהום באמצעות סטנדרטיזציה של התקפה אלימה למתח מסוג פראי וקביעת ערך כולל כדי לשקף את מידת ההנחתה. טכניקה זו יכולה גם להיות מותאמת לניתוח אינטראקציות גנים בחיידקים על ידי קביעת אינדקס תחרותי בוטלה (COI)2. חישוב COI עבור קבוצה של אורגניזמים מוטציה מאפשר לחוקרים לקבוע אם שני גנים באופן עצמאי לתרום פתוגנזה או אם הם מעורבים מסלול התקפה אלימה ותלויים זה בזה. בנוסף, חישוב CI דורש ספירה של חיידקים אשר יכולים לספק תובנות יקרות לתוך הפתוגנזה של אורגניזמים. CIs ו COIs גם לאפשר לחוקרים הישבנים avirulent זנים שאינם גורמים למחלות קליניות אבל עדיין יש הבדלים בכושר. טכניקה זו מוגבלת על ידי שימוש של סמנים מסורתיים עמידות לאנטיביוטיקה כדי לזהות זנים, ובכך להגביל את מספר זני קלט רק אחד או שניים בכל פעם. בשל מגבלה זו, נדרשים מספר רב של קבוצות ומשכפל ניסויים, שבנוסף להוספת העבודה ועלויות החומר, מגביר גם הזדמנויות לשונות בתנאים ניסיוניים ותוצאות לא מדויקות. (לסקירה יסודית של היתרונות והיישומים של שימוש בזיהומים מעורבים לחקר התקפה אלימה, כושר ואינטראקציות גנים, ראה C.R. Beuzón ו D.W. הולדן 1)

ניסיונות נעשו כדי להתגבר על מגבלה זו, כגון שימוש בתאים fluorescently המסומנים באופן כימות דרך זרם cy,3,4,5. טכניקה זו מכמת את התאים באחד משני הצדדים המסומנים בנוגדנים לסמנים או 2) המיוצרים באופן שורש חלבונים פלורסצאריים. לשימוש בנוגדנים עם תוויות יש מגבלה של גילוי של 1,000 תאים/mL, ולכן דורש מספר גבוה של תאים כדי לנתח3. תאים המבטאים חלבונים פלורסנט יש פיזיולוגיה שונה והם רגישים לשינויי כושר וכתוצאה מביטוי חלבון גבוה6. שתי השיטות מוגבלות על ידי מספר סמני פלורסנט הנמצא באמצעות הזרימה cy, try. התקדמות בקוונפיקציה מולקולרית הושגה באמצעות פיתוח של טכניקה microarray שזיהה החליש ב 120 זנים מזיהום ראשוני מעורב של מעל 1,000 זנים במודל murine7. טכניקה זו מנוצל ניתוח microarray של RNA מ זנים מוטציה, אשר להוביל לשונות ניכרת בתוצאה.  אף על פי כן, היא הקימה כי בריכות גדולות של זיהומים מעורבים יכול להיות כלי שימושי, כי על ידי ניצול טכניקות זיהוי רגיש, הבדלים התקפה אלימה חיידקים ניתן לזהות. עם פיתוח של רצף הדור הבא, Tn-seq הרחיב את כלי השירות של טרנספסון מוטציות, המאפשר שיטה רבת עוצמה עבור חיידקים שהיו מוטציה באקראי8,9,10, . בסדר, 11 פרוטוקול חלופי פותחה לאחרונה כי מבטלת את הצורך בטרנספסונים ובמקום זאת משתמשת ברקודים DNA כדי לזהות בקלות רבה יותר ולעקוב אחר שינויים גנומית ואת השפעתם על כושר12. טכנולוגיה זו היא התקדמות גדולה, אבל החדרת ברקודים גנומית הוא עדיין תהליך אקראי. כדי להתגבר על אקראיות של ניסויים קודמים, יון ואח ' פיתחה שיטה כדי לחשב את החבר של העמים סלמונלה זנים באמצעות ברקודים DNA ייחודי מוכנס במיקומים מדויקים על הכרומוזומים של חיידקים13. זנים ברקודים ייחודיים זוהו באמצעות שיטה מבוססת qPCR עם SYBR ירוק ומיוחד התחל כל ברקוד ייחודי. הטכניקה הוגבלה על-ידי אילוצים שהוטלו על-ידי qPCR, כולל הבדלים ביעילות תחל ורגישות נמוכה, המעידים על הצורך בקינון-PCR לפני qPCR. אף על פי כן, גישה זו הוכיחה כי שינויים ממוקדות גנומית יכול להיות מנוצלת לאיתור ופוטנציאל לכמת בריכות של זנים חיידקיים מרובים.

בפרוטוקול הבא, אנו מתארים מתודולוגיה הרומן לבצע ניסויים בתחרות חיידקים עם בריכות גדולות של מעורבות מעורב ואחריו כימות מדויקת באמצעות טכניקה דיגיטלית רגישה מאוד. הפרוטוקול כרוך גנטית-תיוג זנים חיידקיים עם ברקוד DNA ייחודי מוכנס על אזור לא מזיק של הכרומוזום. שינוי זה מאפשר לזנים להיות במהירות ובאופן מדויק בקוונט באמצעות טכנולוגיה מולקולרית מודרנית במקום מדלל סדרתי מסורתי, ציפוי משוכפל, ו ספירה המושבה היוצרים יחידות המסתמכים על סמנים פנוטימית (כלומר עמידות לאנטיביוטיקה ). השינויים מאפשרים הערכה בו של זנים רבים במאגר יחיד, הפחתת באופן משמעותי את האפשרות של השתנות ניסיוני כי כל הזנים חשופים לאותם תנאים בדיוק. יתר על כן, בעוד טכניקה זו פותחה ב סלמונלה enterica Serovmuריום, זה מאוד להתאמה לכל אורגניזם מחושל גנטית כמעט כל עיצוב ניסיוני שבו ספירות חיידקים מדויקים נדרשים, מתן חדש כדי להגדיל את הדיוק והתפוקה במעבדות המיקרוביולוגיה ללא האילוצים המוטלים על-ידי שיטות קודמות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. לשלב ברקודים DNA ייחודי על פלאמיד המכיל את הרכיבים הנחוצים עבור Allelic Exchange

הערה: חדש פלמיד, בשם pSKAP, עם מספר עותק גבוה ויעילות שינוי מוגבר לעומת הקיים pKD13 allelic exchange באמצע נוצר. הדבר מתואר בשלבים 1.1-1.12 (איור 1). הפלמידים הסופיים המכילים ברקודים ורכיבי DNA ייחודיים עבור allelic exchange זמינים באמצעות מאגר פלמאני (לוח חומרים).

  1. באמצעות מסחרי הפלסטיק בערכה מסחרית ערכת, לטהר את pKD1314 ו Ppcr סקריפט Cam SK+ מתוך תרבויות חיידקי לילה גדל ב לוריא-ברגאני (LB) ציר שיושלם עם 50 μg/ml kanamycin או 25 μg/ml כלוראמאנקול (עבור PKD13 ו-ppcr סקריפט Cam SK +, בהתאמה) (טבלה 1).
  2. ביצוע מעכל הגבלה על שני פלסטלינה באמצעות אנזימים הגבלה מסחרית HindIII ו-BamHI בהתאם למפרט של היצרן.
  3. הסרת אנזימים הגבלה ו-DNA מגורש מן pPCR סקריפט מצלמת SK+ התגובה ולטהר את 3,370-בסיס זוג (bp) השדרה פלזמה באמצעות ערכת ניקוי מסחרית זמין DNA על פי מפרטים של היצרן.
  4. הפרד בין השברים מעיכול ההגבלה pKD13 על 1% ג'ל שנוצר באמצעות תא אלקטרופורזה.
  5. להמחיש להקות באמצעות האור בצבע כחול ממאיר והבלו את הרסיס 1,333 bp מן הג (איור 1C).
    הערה: קטע זה מכיל את הגן המחתרת של FRT-מקיפים הדרושים להחלפת allelic כרומוזומלית.
  6. לטהר את ה-DNA מתוך שלב 1.5 באמצעות ערכת הפקת ג'ל מסחרי.
  7. כדי ליצור pskap, להאריך את השבר מטוהרים מ pKD13 (משלב 1.6) לתוך ppcr סקריפט מצלמת SK+ (משלב 1.3) באמצעות מסחרי T4 DNA ליגאז על פי מפרטים של היצרן.
  8. הפוך תאים DH5α מוכשרים כימיים באמצעות הדגם pSKAP התואם לפרוטוקול היצרן (טבלה 1).
  9. התפשטות transformants על ליברות אגר לוחות שיושלם עם 50 μg/mL kanamycin ו-דגירה ב 37 ° c לילה.
  10. בחר מושבה מן הצלחת ו פס אותו על צלחת החדש LB אגר בתוספת עם 50 μg/mL kanamycin ו מודב 37 ° c לילה. בחר מושבה מצלחת זו ולהשתמש למרק ליברות בתוספת עם 50 μg/mL kanamycin. מודיית את התרבות לילה ב 37 ° c עם עצבנות מתמדת.
  11. כדי לטהר את pSKAP. מהתרבות החיידקית לילה
  12. בצע עיכול הגבלת אבחון של הפלסמיד משלב 1.11 באמצעות הינד III ו-Bam HI לפי מפרטי היצרן. שברי הדמיה של 1% צמח ג'ל כמו בשלבים 1.4-1.5.
    הערה: הגודל הכולל של pSKAP צריך להיות 4,703 bp. קטעים לאחר שלב 1.12 צריך להיות 3,370 ו-1,333 bp.
  13. עיצוב ה-PCR התחל לinsertional מוטזיס (SDM) (טבלה 2 ו-S1) באופן כזה להוספת רצף דנ א ייחודי בן 25 בסיס במיקום 725 של pSKAP (איור 2).
    הערה: ה-DNA ברקוד מוכנס לתוך הפלבאמצע ממש מחוץ לבית המחתרת של FRT-מקיפים את גן ההתנגדות, כך הברקוד לא יאבד במהלך ההסרה הבאה של הקלטת ההתנגדות kanamycin. אם יצירת רצפי ברקוד חדשים, השתמש בכלים מקוונים כדי להבטיח את השימוש במכונות ה-PCR בעלי התווית הספציפית של היעד (להלן מתייחסים פשוט כ-"בדיקה") באופן יעיל לאגד את הרצף החדש. רצפי ההכנסה שתוכננו עד היום, יחד עם התחל הדרוש כדי ליצור אותם, מסופקים בטבלאות 2 ו- S1.
  14. להכין תגובות SDM באמצעות DNA מסחרי באיכות גבוהה פולימראז, הזוגות הרצוי פריימר (שולחן 2), ו pSKAP תבנית. הגדר את הציקלנית כדי לבצע את הפעולות הבאות: 1) 98 ° צ' עבור 30 s, 2) 98 ° צ' עבור 10, 56 ° צ' עבור 15 s, 72 ° c עבור 2 דקות, 3) לחזור על שלבים 2, 24 פעמים, 4) 72 ° צלזיוס עבור 5 דקות, 5) להמתין 4 ° c.
  15. לאחר השלמת ה-PCR, לרוקן את התבנית pSKAP על ידי הוספת האנזים ההגבלה Dpn I לתגובה. מודקון ב 37 ° c עבור 20 דקות.
    הערה: מוצרים מ-PCR צריך להיות מדמיינו על ג'ל agarose כדי לאמת את הגודל והטוהר של המוצר. שליטה Dpn I העיכול המורכב של התבנית pSKAP לא שונה ניתן לבצע ולהשתמש בשלבים הבאים כדי להבטיח DNA התבנית הוא מתעכל לחלוטין.
  16. השתמש 5 μL של המוצר משלב 1.15 כדי להפוך 100 μL של תאים מסחריים כימית DH5α המוסמכת בהתאם להמלצות של היצרן.
  17. התפשטות transformants אל LB אגר צלחות בתוספת עם 25 μg/mL כלוראמנול ו-דגירה ב 37 ° c לילה.
  18. בחר מושבה (או מושבות) מלוחות לילה על פס על לוחות ליברות אגר בודדים שיושלם עם 25 μg/mL כלוראמאנרול ו דגירה ב 37 ° c בלילה. בחר מושבה מלוחות לילה ולהשתמש לאיחסן 5 מ ל של ציר LB בתוספת עם 25 μg/mL כלוראמאניול. תרבית התרבות (s) לילה ב 37 ° c עם עצבנות מתמדת.
  19. השתמשו בערכה מסחרית של ציוד מסחרי, כדי לטהר את הפלאמידים מהתרבות הלילה (ים).
  20. רצף סאנגר מטוהר בעזרת הרצף הM13 קדימה (שולחן 2). השוואת אזור מוטציה לפלסמיד המקורי ולהעריך את דיוק insertional SDM.
  21. לאחר אישור הכניסה ברקוד ודיוק, להקצות כל ברקוד פלאמיד שם.
    הערה: ברקודים שנוצרו עד התאריך הוקצו ייעוד של שתי אותיות: AA, AB, AC,..., BA, BB, לפנה ס, וכו '. פלמידים ברמיונים מסומנים כ-pSKAP_AA, pSKAP_AB, pSKAP_AC,..., pSKAP_BA, pSKAP_BB, pSKAP_BC, וכו '.
  22. חזור על שלבים 1.14-, כדי להפיק את המספר הרצוי של ברקודים DNA.

2. להציג ברקוד DNA על כרומוזום של S. Typhimurium

הערה: החדרת ברקודים DNA אל S. כרומוזום typhimurium מושגת באמצעות שיטה allelic exchange שתוארו על ידי Datsenko ו-Wanner14 כי כבר שונה לשימוש S. . סוג של מוטיום

  1. לקבוע את הלוקוס ב -S. הגנום typhimurium שבו להוסיף את ברקוד ה-DNA (איור 3).
    הערה: בחר באזור גדול ומלא-מגניים של הכרומוזום. להימנע אזורים המייצרים RNA שאינו קידוד. מחקר זה ניצל מקום במורד הזרם של לשים P בין שאריות 1,213,840 ו 1,213,861 (נקבע מהרכבת הגנום GCA_ 000022165.1). האזור הזה מטופל בעבר גנטית עבור השלמת טרנס של גנים15. לחילופין, ברקוד DNA יכול להיות הציג במקביל לשבש גן של עניין. פעולה זו דורשת שינויים מינימליים בפרוטוקול זה ומייעל את יצירת המוטציות.
  2. עיצוב PCR התחל כדי להגביר את הברקוד הייחודי FRT-מקיפים את גן ההתנגדות של pSKAP ברקוד המכיל את הג משלב 1.21 (שולחן 2). הוסף 40-הרחבות נוקלאוטיד הומוולוגי לאזור שנבחר בשלב 2.1 לסוף של 5 כל פריימר (שולחן 2).
  3. לבצע את הגברה באמצעות מסחרי באיכות גבוהה פולימראז, התחל משלב 2.2, ואת pSKAP הרצוי ברקוד המכיל פלסמיד כתבנית. הגדר את הציקלנית לבצע את הפעולות הבאות: 1) 98 ° צ' עבור 30 s, 2) 98 ° צ' עבור 10, 3) 56 ° צ' עבור 15 s, 4) 72 ° צ' עבור 60 s, חזור על שלבים 2-4 29 פעמים, 5) 72 ° צלזיוס עבור 5 דקות, 6) להחזיק ב 4 ° c.
  4. לאחר השלמת ה-PCR, לרוקן את ה-DNA של תבנית באמצעות DpnI כפי שמתואר בשלב 1.15. לטהר ולמקד את ה-DNA באמצעות ערכת ניקוי DNA מסחרי על פי מפרט היצרן.
  5. עיין בפרוטוקול שפורסם בעבר ליצירת מוטציות ב- S. מאמץ typhimurium 14028s מ-PCR מוצרים14,16,17,18.
    הערה: זה לא הכרחי שהגן של הקנאמיצין. מגורש מהכרומוזום עם זאת, כריתה של הגן הוא מינימלית לשבש את הכרומוזום החיידקי כפי שהוא התוצאה של צלקת 129 bp שישאיר פוטנציאל במורד הגנים במסגרת. מומלץ כי המתח המכיל את הגן ההתנגדות kanamycin נשמר כפי שהוא יכול לשמש כדי להעביר ברקודים בין זנים באמצעות התמרה P22-בתיווך.
  6. חזור על שלבים 2.3 – 2.5 כדי ליצור את הזנים הרצויים עם ברקודים המתאים.
    הערה: ברקודים ניתן להציג לתוך סוג של פראי. Typhimurium כי אז יכול להיות נתון מניפולציה גנטית נוספת, או ברקודים ניתן להציג לתוך זנים כי כבר שונה גנטית בעבר.

3. מצבי גדילה בקטריאליים ובתחרות חוץ גופית

  1. מ בקטריה במלאי, הרצוי שלפס. זנים typhimurium כי כל הנמל ברקוד DNA ייחודי על לוחות LB אגר. לוחיות הרישוי של הלילה. ב-37 ° c
  2. בחרו מושבה אחת מכל מאמץ ומחסן 5 מ ל של ציר LB. מודטה עבור 20 h ב 37 ° צ' עם עצבנות תמידית.
    הערה: באמצעות התרבות לילה, המשך לשלב 3.5 לאסוף דנ א טהור של גנומית (gDNA) מכל זן ברקוד. זה הכרחי לניסויים הבאים בנוגע לאימות ושליטה בסעיף 6.
  3. עבור כל שיטת תחרות, העבר כמות שווה של כל תרבות לילה לתוך צינור סטרילי בגודל כראוי. ביסודיות לערבב זנים יחד על ידי vortexing במרץ עבור לפחות 5 s.
    הערה: הנפח של כל תרבות לילה להעביר צריך להספיק לכל תנאי ולשכפל, כמו גם לבידוד gDNA כדי לכמת קלט. אמנם זה לא לגמרי הכרחי כדי למדוד צפיפויות אופטיות של תרבויות, כי המספר המוחלט של מיקרואורגניזמים קלט יהיה כימות באמצעות ה-PCR הדיגיטלי, מספר חיידקים קלט עבור כל זן צריך להיות שווה בערך כדי למנוע צווארי בקבוק או תחרות לא שוויונית מוקדם בניסוי. התחרות הייצוגית הוסר בפרוטוקול זה בהשוואה לשיעורי הצמיחה של 8 זנים בו זמנית. זנים נוספים או פחות עשויים להיות נחוצים עבור עיצובים ניסיוניים בודדים.
  4. העברת 100 μL של מעורבות מעורבת לתוך 4.9 mL מרק ליברות סטרילי. מודטה ב 37 ° c לזמן הרצוי או לדחיסות אופטית רצויה.
  5. הקציר 500 μL של האינוצנטריפוגה על ידי ב> 12000 x g עבור 1 דקות. הסר ולמחוק את הסופרנטאנט. המשך מיד לסעיף 4 עם התאים.
  6. בנקודות הזמן הרצויות, להסיר 500 μL האליבטים של התרבות ותאי הקציר על-ידי צנטריפוגה ב > 12000 x g עבור 1 דקות. הסר ולמחוק supernatant.
    הערה: אם האיסוף ממשיך בנקודות זמן מרובות, הקפא כדורי ב-20 ° צ' או מייד לשלב 4.1 לאחר כל אוסף.

4. איסוף וככמת של gDNA מ S. Typhimurium (מתוך שלבים 3.5 ו 3.6)

  1. לקצור gDNA מתאים באמצעות ערכת טיהור gDNA מסחרי. אם הוא זמין, בצע את הצעד האופציונלי של מחסור ב-RNA.
    הערה: מחסור ב-RNA אינו הכרחי; עם זאת, הנוכחות של RNA יהיה להגדיל באופן מלאכותי את ריכוז ה-DNA, המוביל חישובים חריגה בשלבים הבאים. אם באמצעות ערכת טיהור gDNA מסחרי, בצע את ההמלצות של היצרן כדי להבטיח כי העמודה אינה עמוסה עם ה-DNA. אין ריכוז מינימלי של דנ א נדרש אם המדגם הוא ככמת בשלבים הבאים.
  2. השתמש בספקטרוסקופיה כדי לכמת דנ א בכל מדגם.
    הערה: DNA ניתן לכמת באמצעות כל שיטה אמינה.
  3. חישוב gDNA מספר עותק מבוסס על גודל הגנום חיידקי באמצעות המשוואה הבאה שבה: X הוא כמות של ה-DNA ב ng ו-N הוא אורך של מולקולת DNA כפול תקועים (גודל הגנום).
    Equation 1
    הערה: 660 g/השומה משמש כמסה הממוצעת של ה-DNA bp. וריאציות קטנות עשויות להתקיים בהתאם להרכב הנוקלאוטיד של האורגניזם. מחשבונים רבים זמינים באינטרנט כדי לבצע את החישוב.

5. עיצוב תחל וזונדים לזיהוי כמותי של ברקודים DNA באמצעות ה-dDigital PCR

  1. עיצוב התחל כדי להגביר את האזור מקודד של S. כרומוזום typhimurium במורד הזרם של putp (איור 3C ושולחן 2).
    הערה: פריימר ועיצובים בדיקה ניתן להקל על ידי תוכניות מקוונות רבות (טבלת חומרים). אם ברקודים מוכנסים כולם לאותו הבית, מערכת אחת של כללי הגברה היא אוניברסלית עבור כל ברקודים.
  2. עיצוב 6-carboxyfluorescein (משפחתי)-מבוסס ו/או הקסאכלואותעין (הקסדצימאלי) מבוססי רגשים ספציפיים לכל ברקוד (שולחן 2 ו S1).
    הערה: הקורא ה-droplet המשמש בניסוי זה מסוגל לזהות גם בדים מבוססי-משפחה ו-HEX במקביל בתגובת מולטיפלקס. עיצוב 1/2 של הגששים לנצל משפחה ו 1/2 להשתמש HEX. זה לא צעד הכרחי, אך תפחית את השימוש האגייתי והעלויות הנסיוניות אם תיושם.
  3. הפוך 20x פריימר-בדיקה הורים מתערבב המכיל 1) 20 מ"מ של כל אחד קדימה לאחור הגברה פריימר, 2) 10 מ"מ של משפחה אחת בדיקה, ו 3) 10 מ"מ של בדיקה HEX אחת (אם ריבוב).

6. לאמת את הרגישות ואת הספציפיות של כל Pprimer-בדיקה להגדיר עבור כל ברקוד גנומית באמצעות PCR דיגיטלי

הערה: פרוטוקול זה משתמש באימות שמונה ברקודים ייחודיים עם שמונה בדים ייחודיים כדוגמה. מספר ברקודים מנוצל ניתן להגדיל או להקטין כדי להכיל עיצובים ניסיוניים שונים.

  1. צור מאגר של gDNA המכיל כל ברקוד מלבד אחד. השתמש במאגר זה כמו הדילול לבצע סדרת דילול עם gDNA המכיל את הברקוד הנותר היחיד (לדוגמה ערכת דילול מסופק באיור 4).
    הערה: שימוש במאגר gDNA כמו דילול מבטיח רקע עקבי תוך ברור רגישות לגבי. באמצעות מספרי ההעתקה נקבע בשלב 4.3, לדלל gDNA למספר עותק בתוך טווח ה-PCR הדיגיטלי המומלץ (1-100,000 עותקים לכל 20 μL התגובה). יש לזכור כי הטווח מוגדר עבור כל יעד ייחודי (ברקוד), לא הכולל gDNA.
  2. הכינו תגובות ל-PCR הדיגיטלי בשכפול בהתאם להמלצות היצרן לשימוש ב-PCR דיגיטלי מיועד לכימיה מבוססת-בדיקה. השתמש בתערובות משלב 6.1 כדוגמת דנ א של תבנית. השימוש 20x פריימר-בדיקה מאסטר ערבוב משלב 5.3 המכיל את הגשוש עבור ברקוד מדולל בשלב 6.1.
  3. הכינו שכפול תגובות לבקרת ה-PCR הדיגיטלי בהתאם להמלצות של היצרן לשימוש ב-PCR דיגיטלי מיועד לכימיה המבוססת על המחקר. תגובות שליטה עבור כל תמהיל בדיקה חייב להיות מורכב 1) אין פקדי תבנית (NTCs), 2) פקדים חיוביים ו 3) בקרות חיוביות.
    הערה: המספר המינימלי של תגובות בקרה לשכפול הוא שניים. פרוטוקול דוגמה זה משתמש בארבעה NTCs, שישה פקדים שליליים ושישה פקדים חיוביים עבור כל ברקוד. פקדים שליליים צריכים להכיל gDNA עם כל ברקוד למעט הברקוד המתאים לבדיקה נבדק. זה יהיה לאמת את הספציפיות של כל לווין.
  4. חזור על שלבים 6.1-6.3 כדי ליצור תגובות PCR דיגיטליות עבור כל דגימת gDNA בעלת מקודד. באיור 5מוצג סידור לוחית דגימה.
    הערה: השלבים הבאים מתוארים בהתאם לפלטפורמת ה-PCR הדיגיטלית הספציפית העושה שהיא משתמשת בטיפות ובטכנולוגיה מבוססת-זרימה. החלופה הדיגיטלית PCR פלטפורמות המשתמשים בטכנולוגיה מבוססת שבב יכול בקלות להיות להחליף עם שינויים קלים בפרוטוקול זה. שלב 6.4 עשוי לדרוש יותר מ 1 96-באר צלחת לאמת את כל ערכות פריימר. בניגוד qPCR, לוחיות נפרדות שנותחו על ידי PCR דיגיטלי ניתן להשוות ללא צורך בארות התייחסות סטנדרטית בין לוחות.
  5. ליצור טיפות עבור כל מצב תגובה באמצעות מחולל droplet בהתאם להוראות של היצרן.
  6. להעביר טיפות החדש שנוצר לתוך צלחת 96-הטוב המתאים. השתמש ב-200 μL לקבלת עצות בנוגע לצנרת רב-ערוצית ב5-50 μL.
    הערה: כאשר מלטף טיפות, פיפטה לאט וחלק! יצרנית הציוד הדיגיטלי של ה-PCR ממליצה להשתמש רק בעזרת פיפטות ושוט מיצרן מסוים (למשל, Ranin). טיפים אלה צינורות יש פתיחה חלקה ללא שברי פלסטיק מיקרוסקופיים שיכולים להרוס טיפות או נזק מיקרופלואידיקה מיקרופלואידיקה של הקורא droplet. מותגים רבים של טיפים נבדקו ונצפו יש ספקטרום של איכות הייצור. תוצאות שוות ערך הושגו באמצעות חלופות עצה הצנרת; עם זאת, יש להשתמש בזהירות בעת הסטות מהמלצות היצרן.
  7. לאחר כל טיפות נוצרו והועברו, לאטום את הצלחת עם חותם לוחית נייר.
  8. השתמש ביצרן-מומלץ לבצע את תנאי הרכיבה התרמיים הבאים: 1) 94 ° צ' למשך 10 דקות; 2) 94 ° צ' במשך 1 דקות, שיעור השיפוע נקבע ב-1 ° צ'/s; 3) 55 ° צ' למשך 2 דקות, שיעור השיפוע נקבע ב -1 ° צ'/ים; 4) חזור על שלבים 2 ו 3 49 פעמים; 5) 98 ° c במשך 10 דקות; 6) החזיקו ב -4 ° c עד 24 שעות.
    הערה: העברה תרמית בתגובת droplet אינה זהה ל-PCR הרגיל. תנאי תגובה עשויים לדרוש שינוי.
  9. בעוד ביצוע התרמותרמיים מבוצע, לתכנת את תוכנת ניתוח הנתונים עם מידע הגדרת לוחית כגון שם לדוגמה, סוג ניסוי (כימות מוחלטת), supermix בשימוש, יעד 1 שם (שם ברקוד משפחה), מטרה 1 סוג (NTC, בקרה חיובית, שליטה שלילית, או לא ידוע), היעד 2 שם (שם ברקוד HEX), היעד 2 סוג (ריק, בקרה חיובית, בקרה שלילית, או לא ידוע). מידע הכיוונון הסופי מוצג באיור 5.
  10. לאחר השלמת התרמותרמיים, העבר את התגובות שהושלמו לקורא ה-droplet והתחל את תהליך הקריאה בהתאם להוראות היצרן.

7. לכמת את מספר החיידקים בניסוי המדד התחרותי

  1. לדלל gDNA מבודדים וככמת מסעיף 4 לריכוז מתאים כמתואר לעיל.
  2. הכינו תגובות ל-PCR הדיגיטלי בהתאם להמלצות היצרן לשימוש בתמהיל העילי המתאים. השתמש ב-DNA משלב 7.1 כתבנית. השתמש באחד 20x פריימר-בדיקה לערבב מאסטר המכיל את הגשוש (או רגשים אם זיהוי הן משפחה ו HEX) עבור ברקודים אפשרי נוכח בניסוי.
  3. להכין תגובות PCR נוסף דיגיטלי כמו בשלב 7.2 באמצעות שונים 20x פריימר-בדיקה בסיס מתערבב עד כל ברקודים מנוצל בעיצוב ניסיוני ניתן לזהות.
  4. כלול פקדים עבור כל תנאי כמתואר ב-6.3. כולל 1) אין פקדי תבנית (NTCs), 2) פקדים חיוביים ו-3).
  5. המשך בפרוטוקול כמתואר בשלבים 6.5-6.10.

8. ניתוח נתוני PCR דיגיטלי וחישוב מספרי עותקים מוחלטים

  1. כאשר כל הבארות נקראו וההפעלה הושלמה, פתח את קובץ הנתונים. qlp באמצעות תוכנת ניתוח הנתונים.
    הערה: סוגי הקבצים והליכי ניתוח הנתונים המתוארים כאן הם ספציפיים ליצרן PCR דיגיטלי אחד. אם נעשה שימוש בפלטפורמות PCR דיגיטליות, סוגי קבצים ופרוצדורות ניתוח נתונים יהיו ספציפיות לפלטפורמה שבשימוש ויש לבצעו בהתאם למפרט המומלץ של היצרן.
  2. בחר את כל הבארות לנצל את התמהיל באותו פריימר-בדיקה הורים.
  3. בכרטיסיה טיפות , בדוק את מספר הטיפות שנותחו בכל באר (הן טיפות חיוביות ושליליות). להוציא מהניתוח כל טוב שיש פחות מ 10,000 טיפות הכולל.
  4. מעבר ללשונית משרעת 1 d ובוחן את המרחק של טיפות חיוביות ושליליות. ודא שהם מהווים שתי אוכלוסיות נפרדות.
  5. בתוך התוכנה, השתמש בתכונה סף כדי לבצע ניתוק בין טיפות חיוביות ושליליות עבור כל לווין זה היה מנוצל (איור 6).
    הערה: כל הבארות להשתמש באותו תחל-בדיקה מאסטר לערבב משלב 5.3 צריך להיות אותו סף.
  6. לאחר ספי המתאים הוחלו על כל הבארות, התוכנה יחשב את מספר עותקי ה-DNA בכל תגובה. יצא נתונים לגיליון אלקטרוני כדי להקל על הניתוח.
    הערה: תוכנת ניתוח הנתונים משתמשת במספר הטיפות החיוביות והשליליות המתאימות להתפלגות פואסון כדי לקבוע את מספר ההעתקה.
  7. באמצעות הערכים משלב 8.6, לחשב את מספר העותק הראשוני של כל ברקוד גנומית ייחודי במדגם. קבע את שיעור המשמעות השלילית הממוצע מתגובות הבקרה השליליות והפחת ערך זה מהערכים המתקבלים בתגובות נסיוניות. הכפל ערכים לפי הצורך בהתבסס על הדילול שבוצעו בעת הגדרת כל ניסוי (טבלה 3).

9. קבע כושר יחסי של האורגניזם על ידי חישוב CI או COI מ-PCR דיגיטלי מבוססי הקוונפיקציה של זנים ברמקוליים

  1. לחשב את CI של זן מקודד באמצעות הנוסחאות הבאות שבו:פלט הוא הקוונפיקציה מוחלטת של זן ברקוד בנקודת זמן נתונה,הפלט WT הוא הקוונפיקציה מוחלטת של חיידקים מסוג פראי ברקודים באותו timepoint,קלט הוא כימות מוחלטת של הקלט הנתונים של המתח בקידוד, הקלט WT הוא הקוונפיקציה המוחלטת של הקלט הנתונים של חיידקים מסוג פראי מקודד, Xפלט הוא הסיכום של כל הזנים ב באותה נקודת זמן,קלט X הוא סיכום של הקלט הכולל של כל הזנים מקודדים.

Equation 2
Equation 3
הערה: עיין בדיון לגבי יתרונות, חסרונות והשימוש המתאים ביותר בכל נוסחה.

  1. חזור על שלב 9.1 עבור כל זן מקודד באמצעות כל נקודות הזמן.
  2. אם הדבר ישים, חשב את ה-COI באמצעות הנוסחאות הבאות כאשר:פלט הוא הקוונפיקציה המוחלטת של זן מקודד עם גן מוטציה a בנקודת זמן נתונה,פלט AB הוא כימות מוחלטת של זן ברקוד עם גנים מוטציה a ו- B באותה תקופה,קלט הוא קוונפיקציה מוחלטת של הקלט הנתונים של המתח מקודד עם גן מוטציה A,קלט AB הוא הקוונפיקציה המוחלטת של הקלט הנתונים של זן מקודד עם גנים מוטציה A ו- b, bפלט הוא קוונפיקציה מוחלטת של זן ברקוד עם גן מוטציה B ב timepoint נתון, ו Bקלט הוא קוונפיקציה מוחלטת של הקלט של המתח המסומן בעזרת. גן מוטציה ב'

Equation 4
ו/או
Equation 5

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

השימוש במתודולוגיה זו דורש שתגובות הבקרה המתאימות מבוצעות כדי לאמת את הרגישות והספציפיות של כל בדיקה המשמשת לזיהוי הדנ א של היעד. בניסוי מייצג זה, הצלחנו לוודא שמונה ברקודים ייחודיים DNA עם שמונת הבדיקות המתאימות לזיהוי. כל שמונת הבדיקות היו שיעור נמוך של תוצאות חיוביות שווא הן ב-NTC והן בתגובות בקרה שליליות (שולחן 3), סימון ספציפיות שלהם גם בין רצפי DNA דומים מאוד. כדי להעריך את הרגישות של כל תנאי, gDNA המכיל ברקוד ייחודי היה מדולל ברקע קבוע של gDNA המכיל כל אחד משבעת רצפי הברקוד הנותרים. עם הגישה המתוארים לעיל, ה-PCR הדיגיטלי יכול להבחין כמו כמה 2 עותקים של gDNA ברקע של כמעט 2,000,000 רצפי DNA דומים (שולחן 3).

בנוסף לקביעת רגישות וספציפיות של הבדיקה כל רצף DNA ברקוד, את הדילול שבוצעו במחקר אימות איפשר לנו לחשב אינדקס תחרותי מדומה מהנתונים שהתקבל. אמנם לא היה קלט או פלט אמיתי עבור ניסוי זה, ניתן לנתח את הנתונים כאילו ניסוי בתחרות בוצעה. כדי לעשות זאת, אנו מחשיבים כל תערובת בדילול סדרתי כפלט (פלט) עבור ברקוד מדולל, בעוד הפלט הכולל (xפלט), קלט (קלט), ואת הקלט הכולל (xקלט) של כל זן מחושב מ כימות בפקדים החיוביים שבהם נכללים כל הברקודים. באמצעות פקטור הדילול של כל תערובת, המודיע התיאורטי נקבע ומדווח בשולחן 3. בכל אחת מסדרות הדילול שבוצעה עבור כל ברקוד, מדווחת הממוצע של CI ביחד עם הסטיות הסטנדרטיות עבור כל סדרת דילול כפולה. בכל המקרים, מחשב ה-CI הדומה שחושב דומה למודיע התיאורטי. רוב המדינות המחושבות מסטות מהציס התיאורטי בפחות מ -25%. במקרים של ציס התיאורטי נמוך, הסטייה של הערך המחושב היתה למעלה מ-2 קיפול. לדוגמה, הדבר ייצג שינוי מתוך מודיע תיאורטי של 0.000625 עד CI מחושב של 0.001220. מידע זה מדגיש כי השיטה המתוארת מדויקת מאוד ומדויקת מאוד. שילוב של רגישות גבוהה, ספציפיות, דיוק, ודיוק לאפשר למערכת זו לזהות באופן אמין הבדלים בכושר כי ייתכן אחרת ללכת מבלי שיבחינו.

לאחר אימות כי ברקודים גנומית יכול להיות מזוהה באופן מדויק וכימות, אנו ביצעו ניסויים בתחרות מבחנה (שולחן 4). ניסוי התחרות הראשון ניצל שמונה סוגים שלפראי. זנים typhimurium שכל אחד הכיל ברקוד DNA ייחודי. כל מאמץ גדל בלילה, ושמונה התרבויות התערבבו יחד בכמויות שוות. 100 μL של מעורבות מעורבת זו שימש לאיחסן 4.9 mL של מרק ליברות סטרילי והתרבות שתיווצר ב-37 ° c עם עצבנות תמידית. בכדי לחשב את הקלט. המדויק של כל זן צמיחת התרבות הייתה מפוקחת על ידי מדידת ספיגת הספיגה ב600 ננומטר (OD600). ב-OD600 = 0.5 (שלב לוגריתמי), מדגם נאסף מכל תרבות gdna נקצרו. התרבות הנותרת הוחזרה ל 37 ° c עם עצבנות מתמדת עד 8 שעות לאחר מכן כאשר המדגם הסופי נאסף gDNA שנקטפו (נייח). תוצאות חושבו באמצעות הנוסחה CI שונה עבור זיהומים במאגר. כצפוי, כל זנים פראי היו ערכי CI כמעט שווה 1 (טבלה 4). ניסוי תחרות דומה נעשה באמצעות שמונה מוטציות. זנים typhimurium כי כל אחד מהם היה ברקודים ייחודי בנוסף לחסר בודד, כפול, או משולשת transketolase18. כפי שמוצג קודם לכן, הזנים גדלו באופן דומה במרק LB, עם רק השהיה קלה נצפתה במתח משולשת transketolase-לקוי. עם זאת, כאשר הצמיחה של כל זן הוערך על ידי ניתוח CI, פגם מעמיק הרבה יותר נצפתה עבור הזנים החסרים transketolase (CI הושווה לעקומות גדילה שאו ואח '18). יתרה מזאת, ניסוי זה איפשר לנו להקצות ערך כימות למאפייני הגדילה של כל זן במקום לתאר את דפוסי הגדילה בלבד. CIs עבור כל זן חושבו באמצעות הנוסחה המסורתית שבה כל זן היה רק לעומת פראי סוג ואת הנוסחה שונה שבו כל זני קלט נחשבו. בעוד השינויים היו קטנים, CI של המתח משולשת transketolase לקוי היה נמוך באופן מלאכותי בנוסחה המסורתית כי זה לא מסביר את ששת הזנים המתחרים שכולם הציגו בקרבת מסוג כושר פראי.

זנים גנוטיפ מקור או הפניה
S. typhimurium atcc 14028S מסוג פראי קרת
TT22236 סלמונלה LT2 נושא pTP2223 27
DH5α F φ 80lacZΔM15 Δ (lac zya-argF) U169 reca1 בסוףa1 hsdR17 (r k,m K+) פוA בE44 λthi-1 gyrA96 relA1  28
JAS18077 Putp::AA:: frt מחקר זה
JAS18080 Putp::AD:: frt מחקר זה
JAS18083 Putp::AG:: frt מחקר זה
JAS18088 Putp::AL:: frt מחקר זה
JAS18091 Putp::AO:: frt מחקר זה
JAS18096 Putp::ב:: frt מחקר זה
JAS18099 Putp::AW:: frt מחקר זה
JAS18100 Putp::AX:: frt מחקר זה
JAS18122 ΔTkta:: Frt putp::מודעה:: frt מחקר זה
JAS18130 ΔTktb:: Frt Putp::אל:: frt מחקר זה
JAS18138 ΔTktc::באמצעות:: frt מחקר זה
JAS18125 ΔTkta:: Frt Δtkta:: frt putp::AG:: frt מחקר זה
JAS18133 ΔTkta:: Frt Δtkta:: frt putp::AO:: frt מחקר זה
JAS18141 ΔTktb:: Frt Δtktb:: frt putp::מ ':: frt מחקר זה
JAS18142 ΔTkta:: Frt Δtkta:: Frt ΔTkta:: Frt Putp::AX:: frt מחקר זה
פלסמידים הן
pKD13 bla הPS1 PS4 oriR6K 14
pPCR סקריפט מצלמת SK + ColE1 אורי; CmR סטראגנלי/מתנינים
pTP2223 פנקייק לם בבית התערוכה 16
pCP20 בלה חתול cI857 PRflp pSC101 orits 29
מיכל השאפ ColE1 אורי; סמר; bla האחים מוטי מחקר זה
pSKAP_AA ColE1 אורי; סמר; bla מאוד מהנה; AA מחקר זה
pSKAP_AD ColE1 אורי; סמר; bla מאוד מהנה; AD מחקר זה
pSKAP_AG ColE1 אורי; סמר; bla מאוד מהנה; AG מחקר זה
pSKAP_AL ColE1 אורי; סמר; bla מאוד מהנה; אל מחקר זה
pSKAP_AO ColE1 אורי; סמר; bla מאוד מהנה; אאו מחקר זה
pSKAP_AT ColE1 אורי; סמר; bla מאוד מהנה; בבית מחקר זה
pSKAP_AW ColE1 אורי; סמר; bla מאוד מהנה; או מחקר זה
pSKAP_AX ColE1 אורי; סמר; bla מאוד מהנה; AX מחקר זה

שולחן 1: זנים ופלמידים המשמשים במחקר זה.

שם רצף (5 '-3 ')1, 2, 3
pSKAP SDM AA-F מוטי ב, כמוסות CGATTGTGTAGGCTGGAGC
מדיום-אר מיכל שגיא מיכל מאגי
pSKAP SDM לספירה-F ליאת שלמה CGATTGTGTAGGCTGGAGC
pSKAP SDM AD-R כיצד לעשות זאת מיכל מאגי
pSKAP SDM AG-F מיכל שונוב CGATTGTGTAGGCTGGAGC
pSKAP SDM AG-R TCACATGCTCCTCCAGGACACTACT מיכל מאגי
pSKAP SDM אל-F בדיקת מגנציה מיכל מאגי
מיכל א-ע מוטי ברקת CGATTGTGTAGGCTGGAGC
pSKAP SDM אאו-F מיכל שגיא מיכל מאגי
מדור לדור אלי מלכה CGATTGTGTAGGCTGGAGC
pSKAP AT-F מיכל ברקת CGATTGTGTAGGCTGGAGC
pSKAP SDM ב-R GTCTAGCCATGTCACGGACACTGGT מיכל מאגי
pSKAP SDM או-F מיכל שגיא CGATTGTGTAGGCTGGAGC
מיכל האור היכל העצמאות מיכל מאגי
pSKAP SDM AX-F מיכל ב, מאגי CGATTGTGTAGGCTGGAGC
pSKAP SDM AX-R CAGCCTGTCGTTACACCACGATAGT מיכל מאגי
M13-F מיכל הלוי
Putp שילוב מחדש-F TAGCGATGGGAGAGAGGACACGTTAATTATTCCATTTTAA
TGCAGCATTACACGTC
Putp שילוב מחדש-R מתקני המלון הינם בעלי משחק.
כמוסות מגנט
qPCR האזור ברקוד להגביר-F1 TGCAGCATTACACGTCTTG
qPCR ברקוד המשך ההגביר-R2 מיכאל לנדר
ברקוד AA-משפחה 6-משפחה/מAGAAGTCTC/זן/כמוסות
ברקוד-בדיקת AD-משפחה 6-משפחה/זן/מג
ברקוד ג ' ל בדיקה-משפחה 6-משפחה/כפיר/שאלות
ברקוד אל בדיקה-משפחתי 6-משפחה/זן/שאלות
ברקוד AO בדיקה-HEX HEX/AGTATCACT/זן/הגנה
ברקוד AT בדיקה-HEX הקסדצימאלי/בעלי/זן/שאלות
ברקוד או בדיקה-HEX הקסדצימאלי/מחסום/זן/שאלות
ברקוד אקס בדיקה-HEX הקסדצימאלי/שאלות/זן/משחק מחלקה
מיכל בן נוקלאוטידים מסומנים בקו תחתון מציינים רצפים משלימים עבור כל ברקוד DNA המוכנס אל pSKAP לאחר SDM.
מיכל השני נוקלאוטידים כפולים עם קו תחתי מציינים אזור משלים ב- S. כרומוזום typhimurium המשמש להחלפת allelic.
מיכל שלוש בזמן השיא qPCR בדיקה הם היברידיגוס oligos מתויג עם 5 ' צבע פלורסנט, או 6-carboxyfluorescein (6-משפחה) או hexachlorofluorescein (הקסדצימאלי), קונצ'ר פנימי (זן), ו 3 ' quencer איווה שחור® FQ (IBFQ).

שולחן 2: התחל והגששים המשמשים במחקר זה.

קוונפיקציה (עותקים/תגובת 20μL)
תיאור/ AA AD AG אל אאו ב או גרזן
NTC N/A 0.000 0.000 3.510 N/A 0.000 0.000 0.000
NTC 3.600 0.000 0.000 0.000 0.000 0.000 0.000 0.000
NTC 3.510 0.000 1.280 1.180 2.340 0.000 0.000 0.000
NTC 2.290 0.000 0.000 1.200 1.150 1.160 0.000 0.000
תכוון 3.133 0.000 0.320 1.473 1.163 0.290 0.000 0.000
שלילי 5.130 1.156 0.000 1.124 3.745 1.281 7.354 7.142
שלילי 5.270 0.000 0.000 1.087 1.666 1.643 7.746 2.269
שלילי 2.660 0.000 1.361 1.451 8.974 0.000 N/A 0.000
שלילי 6.090 0.000 0.000 2.251 0.000 2.531 8.700 3.495
שלילי 1.740 0.000 1.086 2.130 4.171 0.000 7.113 5.522
שלילי 6.220 3.581 0.000 4.022 1.175 1.341 N/A 5.950
תכוון 4.518 0.789 0.408 2.011 3.288 1.133 7.728 4.063
חיובי 22281.540 42673.039 46442.242 45359.180 47885.625 15708.027 45325.906 20810.559
חיובי 23989.676 44625.523 47356.438 45790.660 47456.973 15096.601 47929.840 22455.234
חיובי 17846.824 38980.133 45633.809 44174.820 33875.039 15156.063 42536.270 21467.840
חיובי 21047.588 40140.848 41672.648 46028.496 47426.527 16718.000 46978.664 19876.473
חיובי 20218.238 44660.602 41718.707 45799.375 46495.602 14590.264 54741.023 22011.938
חיובי 18531.740 41620.801 N/A 48082.313 35645.199 15341.382 48950.992 21117.559
תכוון 20652.601 42116.824 44564.769 45872.474 43130.827 15435.056 47743.783 21289.934
ריק חיסור 20648.083 42116.035 44564.361 45870.463 43127.539 15433.923 47736.054 21285.871
ללא מדולל 23024.961 44448.875 58897.510 51120.948 55450.191 18155.305 62844.068 27567.828
בלתי מדולל 18278.174 35252.586 54409.510 66022.396 43101.148 15732.609 60761.328 26581.979
1/50 א 521.670 755.035 1066.898 1287.187 1053.339 181.324 1278.336 580.961
1/50 B 435.326 634.215 1168.087 1383.537 991.040 165.443 1180.445 596.461
1/100 א 228.028 598.848 603.911 631.116 507.956 258.405 665.647 331.590
1/100 B 256.330 585.834 583.325 670.875 459.325 289.207 638.916 307.948
1/200 א 121.283 305.293 258.247 346.965 234.774 114.163 169.055 172.553
1/200 B 114.638 313.040 253.685 297.216 191.637 179.895 280.989 147.297
1/400 א 42.829 141.343 127.337 163.605 N/A 71.241 157.697 85.976
1/400 B 59.544 180.543 162.080 162.108 115.508 104.682 151.141 87.804
1/800 א 34.304 67.934 65.939 83.857 66.134 31.784 82.722 45.616
1/800 B 20.390 80.222 81.453 85.325 53.102 38.034 55.460 29.660
1/1600 א 15.405 44.505 47.672 39.613 33.027 18.006 37.655 20.988
1/1600 B 22.091 48.828 46.781 37.388 30.245 30.138 34.553 19.795
1/3200 א 12.333 22.104 16.850 18.403 11.460 10.535 21.245 9.218
1/3200 B 6.796 32.555 15.742 26.249 15.111 9.908 23.393 10.175
ריק חיסור
ללא מדולל 23020.443 44448.086 58897.103 51118.937 55446.903 18154.172 62836.339 27563.765
בלתי מדולל 18273.655 35251.797 54409.103 66020.385 43097.860 15731.477 60753.600 26577.916
1/50 א 517.152 754.246 1066.490 1285.176 1050.051 180.192 1270.607 576.898
1/50 B 430.808 633.426 1167.679 1381.526 987.751 164.311 1172.717 592.398
1/100 א 223.509 598.059 603.503 629.105 504.668 257.272 657.918 327.527
1/100 B 251.812 585.044 582.918 668.864 456.036 288.074 631.187 303.885
1/200 א 116.765 304.503 257.840 344.954 231.486 113.030 161.327 168.490
1/200 B 110.120 312.251 253.277 295.205 188.348 178.762 273.261 143.234
1/400 א 38.310 140.554 126.929 161.594 N/A 70.108 149.968 81.913
1/400 B 55.026 179.753 161.672 160.097 112.219 103.549 143.413 83.741
1/800 א 29.786 67.145 65.531 81.847 62.846 30.651 74.994 41.553
1/800 B 15.872 79.433 81.045 83.314 49.813 36.901 47.732 25.596
1/1600 א 10.886 43.716 47.264 37.602 29.739 16.874 29.927 16.925
1/1600 B 17.573 48.039 46.373 35.377 26.957 29.005 26.825 15.732
1/3200 א 7.815 21.314 16.442 16.392 8.172 9.402 13.517 5.155
1/3200 B 2.278 31.765 15.334 24.238 11.822 8.776 15.664 6.112
מדומה CI
ללא מדולל 1.114895 1.055372 1.321619 1.114419 1.285650 1.176251 1.316329 1.294932
בלתי מדולל 0.885005 0.837016 1.220911 1.439279 0.999312 1.019279 1.272698 1.248618
1/50 א 0.025046 0.017909 0.023931 0.028018 0.024348 0.011675 0.026617 0.027102
1/50 B 0.020864 0.015040 0.026202 0.030118 0.022903 0.010646 0.024567 0.027831
1/100 א 0.010825 0.014200 0.013542 0.013715 0.011702 0.016669 0.013782 0.015387
1/100 B 0.012195 0.013891 0.013080 0.014582 0.010574 0.018665 0.013222 0.014276
1/200 א 0.005655 0.007230 0.005786 0.007520 0.005367 0.007323 0.003380 0.007916
1/200 B 0.005333 0.007414 0.005683 0.006436 0.004367 0.011582 0.005724 0.006729
1/400 א 0.001855 0.003337 0.002848 0.003523 N/A 0.004542 0.003142 0.003848
1/400 B 0.002665 0.004268 0.003628 0.003490 0.002602 0.006709 0.003004 0.003934
1/800 א 0.001443 0.001594 0.001470 0.001784 0.001457 0.001986 0.001571 0.001952
1/800 B 0.000769 0.001886 0.001819 0.001816 0.001155 0.002391 0.001000 0.001203
1/1600 A 0.000527 0.001038 0.001061 0.000820 0.000690 0.001093 0.000627 0.000795
1/1600 B 0.000851 0.001141 0.001041 0.000771 0.000625 0.001879 0.000562 0.000739
1/3200 א 0.000378 0.000506 0.000369 0.000357 0.000189 0.000609 0.000283 0.000242
1/3200 ב' 0.000110 0.000754 0.000344 0.000528 0.000274 0.000569 0.000328 0.000287
ממוצע CI (תיאורטי)
בלתי מדולל (1) 0.999950 0.946194 1.271265 1.276849 1.142481 1.097765 1.294514 1.271775
1/50 (0.02) 0.022955 0.016474 0.025067 0.029068 0.023625 0.011161 0.025592 0.027466
1/100 (0.01) 0.011510 0.014046 0.013311 0.014148 0.011138 0.017667 0.013502 0.014832
1/200 (0.005) 0.005494 0.007322 0.005735 0.006978 0.004867 0.009453 0.004552 0.007322
1/400 (0.0025) 0.002260 0.003803 0.003238 0.003507 0.00260 * 0.005626 0.003073 0.003891
1/800 (0.00125) 0.001106 0.001740 0.001645 0.001800 0.001306 0.002188 0.001285 0.001577
1/1600 (0.000625) 0.000689 0.001089 0.001051 0.000795 0.000657 0.001486 0.000594 0.000767
1/3200 (0.000313) 0.000244 0.000630 0.000357 0.000443 0.000232 0.000589 0.000306 0.000265
סטיית תקן
הולות 0.11494 0.10918 0.05035 0.16243 0.14317 0.07849 0.02182 0.02316
1/50 0.00209 0.00143 0.00114 0.00105 0.00072 0.00051 0.00103 0.00036
1/100 0.00069 0.00015 0.00023 0.00043 0.00056 0.00100 0.00028 0.00056
1/200 0.00016 0.00009 0.00005 0.00054 0.00050 0.00213 0.00117 0.00059
1/400 0.00040 0.00047 0.00039 0.00002 0 0.00108 0.00007 0.00004
1/800 0.00034 0.00015 0.00017 0.00002 0.00015 0.00020 0.00029 0.00037
1/1600 0.00016 0.00005 0.00001 0.00002 0.00003 0.00039 0.00003 0.00003
1/3200 0.00013 0.00012 0.00001 0.00009 0.00004 0.00002 0.00002 0.00002
* מייצגת תוצאות מניסוי אחד.

שולחן 3: קוונפיקציה מוחלטת וחישוב מדומה של CI.

מצב אינדקס תחרותי1
ניסוי 1
WTAA WTלספירה WTAG WTאל WTאו WTב WT WTאקס
לוגריתמי 0.927 ± 0.033 0.992 ± 0.031 1.068 ± 0.025 0.921 ± 0.02 1.044 ± 0.03 1.051 ± 0.057 1.094 ± 0.027 0.929 ± 0.005
נייח 1.1 ± 0.021 1.071 ± 0.053 1.079 ± 0.065 0.948 ± 0.02 0.98 ± 0.02 0.873 ± 0.044 0.97 ± 0.056 1.021 ± 0.007
הניסוי השני
CI (מסורתית) WTAA ΔAAD ΔBאל ΔCAT ΔABAG ΔACAO ΔBCאו ΔABCAX
לוגריתמי 1 ± 0 0.802 ± 0.084 0.957 ± 0.02 0.989 ± 0.073 0.581 ± 0.153 0.86 ± 0.053 0.995 ± 0.011 0.695 ± 0.061
נייח 1 ± 0 0.97 ± 0.063 1.043 ± 0.058 0.99 ± 0.036 1.625 ± 0.589 0.835 ± 0.051 0.912 ± 0.047 0.477 ± 0.049
CI (במאגר)
לוגריתמי 1.114 ± 0.039 0.864 ± 0.074 1.073 ± 0.032 1.1 ± 0.068 0.633 ± 0.152 0.938 ± 0.056 1.111 ± 0.043 0.746 ± 0.06
נייח 1.078 ± 0.039 1.039 ± 0.049 1.166 ± 0.093 1.066 ± 0.01 1.735 ± 0.613 0.876 ± 0.035 0.97 ± 0.045 0.49 ± 0.047
מיכל בן ערכים מייצגים סטיית תקן של CI ± עבור שלושה או ארבעה ניסיונות לשכפול.

שולחן 4: הנציג מגיע מתחרות חוץ-גופית. . זנים של הימופריום

טבלת S1. התחל אופציונלי ליצירת רצפי ברקוד נוספים ובדיקות פלורסנט המקביל לאיתור שלהם. אנא לחץ כאן כדי להוריד קובץ זה.

Figure 1
איור 1. דור של pSKAP. (א) מטוהרים pKD13 היה נתון לצמצום העיכול עם האינדישני ו באמהי. (ב, ג) קטע הריבית 1,333 bp המכיל את גן ההתנגדות של FRT-מוקף-מקיפים היה טוהר. (D) Ppcr סקריפט Cam SK + היה גם מתעכל עם HindIII ו bamhi ואת הקטע מ PKD13 (ב) היה ליגולי כדי ליצור (E) pskap. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: הInsertional מוטסיס מונחה אתרים ל-pSKAP. (א) החדרת 25 ברקודים DNA bp במיקום 725 בוצעה באמצעות ה-PCR. הצבע הקדמי והאחורי הינו ספציפי למיקום זה עוצבו עם הרחבות משלימות של 25-נוקלאוטיד 5 (מסומנים בתחל כאותיות קטנות "a"). (ב) הגנרית pSKAP_Barcode באמצע הנובע sdm מוצג עם המיקום של ברקוד ה-DNA שנוספו מודגש כתום. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: סידור מחדש כרומוזום במורד של Putp. (א) לאחר λ-Red בתיווך מחדש, את הגן ההתנגדות הניתן לבחירה (סגול כהה) מוקף באתרי frt (אפור) מוכנס על הכרומוזום בין המקום המצוין (אתר שילוב כרומוזום מחדש, אדום). ברקוד ה-DNA הייחודי (כתום) מוכנס ממש מחוץ לאתר FRT. (ב) גן ההתנגדות kanamycin מוסר על ידי frt-תיווך כריתה, השארת שריד של ה-dna הוסיף על הכרומוזום (סה כ ה-Dna שנוספו, כחול) המורכב של ברקוד ה-dna ו צלקת frt. (ג) רצף ה-dna כרומוזום שונה המקיף את ה-dna שהוכנס מוצג, יחד עם אתרי הגברה (סגול בהיר) המשמש ל-PCR דיגיטלי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: שיטת דילול לאימות רגישות בדיקה פלואורסצנטית וספציפיות. (A) מטוהרים gdna משבעה זנים ברקוד מעורב יחד בכמויות שוות כדי ליצור את הדילול לדלל את gdna מושמט מסומן (AX בדוגמה לעיל). (ב) לבצע דילול סדרתי של gdna מושמט מסומן (AX בדוגמה לעיל) באמצעות דילול מוכן תיאר בעבר. לערבב ביסודיות את התוכן של כל צינור לפני המעבר לצינור הבא. . איור 4 נוצר עם ביוריאנדר אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: פריסת הצלחת לניתוח רגישות וספציפיות של תחל-הבדיקה קובע 1 ו 2. ניסוי ה-PCR הדיגיטלי כולל NTCs, פקדים חיוביים, פקדים שליליים וערכות הדילול עבור כל אחד מהברקודים שנבדקו. הצלחת עבור אימות פריימר-בדיקה קובע 3 ו 4 הוא הניח באותו דפוס באמצעות gDNA מתאים מקודד. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 6
איור 6: הנציגה ה-PCR הדיגיטלי של הנציג מדולל בקוד AA-dna. gDNA המכיל את ברקוד AA היה מדולל ברקע של כל gDNA אחרים בעלי ברקודים כפי שמתואר באיור 4. ערוץ 1 מייצג את המחקר משפחתי עבור ברקוד AA (לוחות העליון) בעוד ערוץ 2 מייצג את החללית HEX עבור ברקוד AO (לוחות התחתון). תוצאות של כל בדיקה מוצגים כמו משרעת הפלורסנט בודדים droplet (לוחות שמאל) והיסטוגרמה המייצג את התדירות של עוצמת פלורסנט של כל טיפות בבארות שנבחרו (לוחות מימין). עבור כל תנאי, חיובי (זריחה גבוהה) ו שלילית (זריחה נמוכה) טיפות צריך ליצור שתי אוכלוסיות נפרדות. במקרה של AA שהיה מדולל, ורוב הטיפות היו שליליות, ההיסטוגרמה (הפאנל הימני העליון) נראה רק לתאר אוכלוסיה אחת. זאת משום שטיפות חיוביות הן במיעוט משמעותי על ידי טיפות שליליות; עם זאת, שתי אוכלוסיות נפרדות עדיין נראות על ידי בחינת משרעת פלורסנט droplet בלוחות השמאלי.  האוכלוסיות צריכות להיות מופרדות באמצעות התכונה הסף להגדיר טיפות חיוביות ושליליות (דמיינו על ידי הקו הוורוד). ערכי הסף ישתנו בהתאם לבדיקות שהיו בשימוש, אך כל הבארות המשתמשים באותו שילוב של המקדח צריכות להיות בעלי סף זהה. כמו הקוד AA-ברקו gDNA היה מדולל, יש ירידה חיובית (פלורסנט גבוהה) טיפות בעוד מספר טיפות AO חיובי נשאר קבוע ברקע. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

היכולת לכמת מיקרואורגניזמים במדויק היא בעלת חשיבות עליונה למחקר מיקרוביולוגיה, והיכולת לספור זנים ייחודיים מאוכלוסיה מעורבת ראשונית הוכיחה להיות כלי רב-ערך להערכת תכונות כושר והתקפה אלימה ב חיידקים. עם זאת, הטכניקות לביצוע זה לא התקדמו בקצב עם פיתוחים מודרניים בביולוגיה מולקולרית. הטכנולוגיה כדי לשנות בקלות את הכרומוזומים של חיידקים רבים, כולל S. Typhimurium, כבר זמין כמעט שני עשורים14, אבל היכולת הזאת כבר מנוצל לעתים נדירות עבור התיוג זנים עם רצפי DNA ייחודי. על ידי ניצול היכולת ליצור זנים הניתנים לזיהוי בקלות מבוסס על ייחודי, מינימלית ברקודים DNA מוכנס על כרומוזום החיידקי, ביחד עם המדינה-של-הטכנולוגיה ביותר לזהות ולכמת מזהים מולקולריים אלה ( i.e. דיגיטלי PCR), יצרנו מערכת המספקת רגישות מעולה, ספציפיות, דיוק, ודיוק לכמת בקלות זנים בודדים בתוך אוכלוסיה מגוונת של חיידקים.

חישוב CIs ו-COIs כפי שמתואר לעיל מסתמך על היכולת לבצע במדויק את השינויים המתאימים כרומוזומים חיידקיים. כל השינויים צריך להיות מאומת על ידי רצף Sanger כדי להבטיח כי לא התרחשו מוטציות אקראיות. השימוש של פולימראז איכותי יצמצם שגיאות אלה, אבל כל מוטציות כאלה שיתרחשו יפגע ביכולת לזהות את המתח, שהוא היבט קריטי נוסף של פרוטוקול זה. למרות שאנחנו הוכיחו כי ה-PCR דיגיטלי יכול לזהות כמו שני עותקים gDNA ברקע של כמעט 2,000,000, זנים מחוץ לטווח זה עשויים לדרוש דיעות נוספות עבור כימות מדויקות שלהם. יתר על כן, רצפים ברקוד DNA חייב להיות מתוכנן כדי להקל על השימוש של רצפי בדיקה באיכות גבוהה. רצפי בדיקה צריך להיות מנותח עבור נטיות עצמית dimerize פינים השיער טופס, או לאגד ביעילות מטרות שלהם. החשיבות של שימוש רצפי איכות וזונדים לא ניתן למזער, עובדה כי הוא המעידים על ידי ניסויים אימות זהיר כי יש לבצע עם כל לווין. המאמצים ליצור ברקודים מיטביים DNA תיצור תוצאות הקוונפיקציה דיגיטלי אופטימלי.

בעוד תגים מולקולריים שתוכננו בקפידה חשובים להשגת תוצאות איכותיות, פענוח התוצאות הוא היבט קריטי נוסף של פרוטוקול זה. CI מוגדר היחס בין זן מוטציה לבין זן פראי בפלט מחולק על ידי היחס של שני זנים בקלט1,19,20. מודיע מסורתי זה הציג בסעיף 9 הוא שימושי כאשר זיהום מעורב מורכב רק מאמץ אחד לעומת פראי סוג. עם זאת, בעת שימוש בבריכות גדולות של זנים כדי לחסן מדיה או בעלי חיים, זנים הם לא רק מתחרה נגד סוג פראי, אלא גם נגד כל זן אחר נוכח האינוונים. מחקרים קודמים שביצעו ניסויים התחרות באמצעות זנים מרובים הדבקה לא הצליחו לקחת את זה בחשבון בחישובים שלהם7,13. כדי להסביר תכונה זו של זיהומים מעורבים, הצגנו נוסחה כדי לחשב CIs כי כבר שונה עבור זיהומים במאגר. לא סביר כי כל הזנים תספק את אותה רמה של תחרות זן פראי יהיה. עם זאת, מכיוון שרוב הגנים החיידקיים יש השפעה קטנה על התקפה אלימה, כמו מספר זנים המשמשים הניסוי התחרותי המדד עולה, הסבירות כי התקפה אלימה הכוללת יהיה לטפל לכיוון פראי סוג המתח גדל. זה אולי לא בהכרח להיות במקרה של עיצובים ניסיוניים מסוימים באמצעות בריכות של זנים רבים כל עם פגמים ידועים התקפה אלימה. עם זאת, זה בהתייחס במשוואה שונה כי זנים שופע פחות (פחות בכושר) בתוצאה תהיה השפעה קטנה יותר על Xפלט. בהתאם לעיצוב הניסיוני הספציפי, ייתכנו מקרים שבהם אחת או יותר מהנוסחה המועדפת. ברוב המקרים מעורבים זיהומים במאגר, עם זאת, חשוב לשקול כי זיהום מעורב, כל הזנים להתחרות זה בזה, לא רק נגד פראי סוג. בעת ניתוח תוצאות, חשוב כי הרציונל מאחורי כל נוסחה מובן היטב כדי להפוך את הפרשנויות המדויקות ביותר של הכושר המאמץ. כאשר מדווחים על תוצאות, חשוב באותה מידה לגלות במדויק כיצד נותחו נתונים.

סעיף 9 של הפרוטוקול כולל גם נוסחאות שיסייעו לך לקבוע אינטראקציות גנים באמצעות COI. באמצעות ניתוח זה, ניתן לבצע תחזיות כדי לקבוע אם שתי גנים התקפה אלימה לפעול באופן עצמאי או ביחד. COI מוגדר כיחס של המוטציה הכפולה כדי זן מוטציה בודד בפלט מחולק על ידי היחס של שני זנים בקלט1. הנוסחה מיועדת לגילוי פנוקטיביות של הפרעות בגנים. אם הגנים פועלים באופן עצמאי כדי לשפר את התקפה אלימה, הפרעה של שני הגנים צריך לגרום לירידה גדולה יותר בכושר בהשוואה להפרעה אחת של גן אחד בלבד. אם גנים לתפקד יחד כדי לשפר את התקפה אלימה (כגון גנים הקידוד שתי אנזימים במסלול), שיבוש של כל אחד הגן צריך להיות באותה השפעה על התקפה אלימה כמו שיבוש שני הגנים. גילוי הפנוקטיביות יכול להיות קשה במקרים שבהם רמת החלשה הנגרמת על ידי גן יחיד הוא גבוה מאוד או נמוך מאוד. עם זאת, השוואה ישירה של זנים בתוך אותה מערכת בעלי חיים מספק פחות שינויים וחשבון אמין יותר של הקשר הפונקציונלי בין הגנים, חישוב זה ניתן לבצע משני זנים בתוך אוכלוסיה גדולה מעורבת.

ההיבט הקריטי הסופי לתוצאות הפענוח הוא לשקול את ההשפעות של דינמיקת האוכלוסיה. בכמה זיהומים מעורבים שיש להם זנים מרובים, זן אחד עשוי לצוץ כדומיננטי או פחות מתאים בגלל סחף האוכלוסייה אקראי. ניתן להעלה תופעה זו כאשר מתרחשות אירועי צוואר בקבוק. זה יכול להיגרם מתוך שימוש במספר גדול מאוד של זני קלט, מספר קטן מאוד של חיידקים מוחלטים באירשת, או שילוב של שניהם. עוד היבט מפריע שנובע מזיהומים מעורבים הוא האפשרות של טרנס משלימה. זה מתרחש כאשר זן התאמה, כגון סוג פראי, מגביר באופן מלאכותי את התקפה אלימה של זן פחות מתאים. דוגמה היפותטית לכך תהיה להשוות את הכושר של S. הtyphimurium האי הפתוגניות 2 (SPI2)-מאמץ הנוקאאוט שיתוף נגועים עם זן פראי. SPI2 מאפשר S. Typhimurium לשרוד intracellularly על ידי הפרשה מפעריקים לתוך ציטוסול מארח כי לשנות את phagosome בתוך מקרופאג. השיבוש של המערכת הזאת. עושה את זה Typhimurium רגיש להרג תאיים. עם זאת, משום מקרופאגים מסוגלים שתבלע שניים או יותר חיידקים בבת אחת, SPI2-הנוקאאוט יכול לקבל עלייה ניכרת בכושר אם הוא מתגורר באותו מקרופאג כמו Sסוג פראי.  שהוא הפרשה מעריקים. לתוך התא הפונדקאי דינמיקה של אוכלוסייה אקראית והאפשרות של השלמת טרנס היא הגבלה של כל ניסוי בתחרות. אם בטרנס קומפלמנטציה הוא חשוד, פנוטיפים יש לאשר באמצעות שיטות משלימות אחרות כדי להעריך את הכושר. כדי להתגבר על דינמיקה של אוכלוסיה אקראית, הגדלת מספר הניסויים בשכפול מגבירה את הסבירות לזיהוי הערים בתוצאות. למרבה המזל, הפרוטוקול המתואר לעיל מקל על מספר רב יותר של ניסויים שכפול זהים, משום שמספר התנאים הניסיוניים מצטמצם באופן דרסטי.

רכיב מפתח לטכניקת CI שתוארה לעיל הוא יכולתה להיות מותאם כמעט כל אורגניזם כל עיצוב ניסיוני הדורש כימות מדויקות של מיקרואורגניזמים. זה עושה, עם זאת, דורש מניפולציה גנטית של אורגניזם לשלב רצף DNA ייחודי על הכרומוזום. הסתגלות של הטכניקה מחייבת את המינים להיות מחושל גנטית ויהיה להסתמך על הדור של פרוטוקולים חלופיים לשינוי הגנום (שלבים 1 ו 2). ברקודים DNA המפורטים בטבלאות 2 ו S1 צריך להיות מספיק עבור רוב החיידקים; עם זאת, כמו בכל הניסויים PCR כמותי, זה רלוונטי לנתח את הגנום החיידקי כדי להבטיח פוטנציאל מינימלי עבור מחוץ ליעד איגוד של התחל והבדיקות על ידי ניתוח הפיצוץ פשוט. רצפים ברקוד ה-DNA בשימוש במחקר זה שונים על-ידי רק 3-4 בסיסים במקרים מסוימים, הדגשת ספציפיות מעולה של הגששים המקזער את הפוטנציאל עבור איגוד לא ספציפי. ללא קשר של בדיקה פלורסנט ' ספציפיות, כל רצפי ברקוד חדש חייב להיות מאומת כראוי רגישות וספציפיות כמתואר בשלב 6. לאחר יצירת זנים מקודדים, ניתן להתאים את הפרוטוקול לסוגים רבים של ניסויים, מלבד בתחרות החוץ-גופית, כפי שמתואר לעיל. הזנים מתאימים בתחרות vivo בעכברים או במערכות מודל אחרות של בעלי חיים. רק שינויים מינימליים נדרשים כדי לחלץ gDNA מאברי בעלי חיים ורקמות, ושינויים אלה מתוארים היטב על ידי יצרנים של ערכות למטרות כאלה. עוד, בריכות גדולות של זיהומים מעורבים עבור בתחרות vivo מנוצל בהצלחה בעבר7, המציע את הפוטנציאל להפחית את מספר בעלי החיים הנחוצים לניסוי אחד, אשר לא רק מפחית את העלויות של ניסויים אלה אלא גם מקטינה את הפוטנציאל להבדלים בעלי חיים לבעלי חיים. באופן דומה, זנים מקודדים ניתן להשתמש אחרים בתוך מבחנה מחוץ לספר כי לבחון את הרגישות של זנים לתנאי טיפול שונים (למשל אנטיביוטיקה, חומצה הרגישות, הריגת על ידי חמצן תגובתי או מינים חנקן, וכו '). עבור ניסויים אלה, הערכת עיכוב גדילה יכול להיות מושגת על ידי הוספת הכימיקל הרצוי בינוני הצמיחה בשלב 3.4 והליך כמתואר. כדי להעריך את המוות החיידקי, בריכה גדולה של זנים יכול להיות מעורב, ואת הקלט בכמת כמתואר לעיל. לאחר החשיפה לטיפול הרצוי, תאים חיים יכולים להיות בעלי כימות באופן סלקטיבי על-ידי צימוד הנוהל הדיגיטלי של ה-pcr עם הכדאיות להבדיל בין תאים חיים ומתים21,22,23 , בת 24 , מיכל בן 25 , 26. תפוקה עבור ניסויים כאלה יהיה מוגבר באופן דרמטי כי דילול ולוחיות עותק משוכפל עבור כל זן מוחלפים על ידי טכניקות מולקולריות יותר יעיל. לבסוף, למרות ניתוח הביולוגיה האבולוציונית והגנטיקה של האוכלוסייה הוא מעבר להיקף של הנייר הזה, אורגניזמים מסומנים מאוד הסתגלות למחקרים כאלה.  בסופו של דבר, המטרה של פרוטוקול זה היתה לפתח טכניקה רבת עוצמה לכמת חיידקים כי הוא מאוד הסתגלות לשימוש שלה במינים מגוונים רבים ובסוגים רבים של ניסויים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

המחקר שדווח בפרסום זה נתמך על ידי קרן הפקולטה למשפטים של הנשיא ג'ורג ' האדדיקס והמכון הלאומי למדעי הרפואה הכללית של המכונים הלאומיים לבריאות (NIH) תחת מספר הפרסים GM103427. התוכן הינו באחריות המחברים בלבד ואינו מייצג בהכרח את ההשקפות הרשמיות של המכון הלאומי לבריאות.

Materials

Name Company Catalog Number Comments
1.5 mL microcentrifuge tubes Eppendorf 22600028 Procure from any manufacturer
16 mL culture tubes MidSci 8599 Procure from any manufacturer
5-200 μL pipette tips RAININ 30389241 Procure alternative tip brands with caution based on manufacturing quality
5-50 μL multichannel pipette RAININ 17013804 Use alternative multichannel pipettes with caution
Agarose ThermoFisher Scientific BP160-500 Procure from any manufacturer
BLAST Analysis NCBI N/A https://blast.ncbi.nlm.nih.gov/Blast.cgi
C1000 Touch Thermocycler with 96-Deep Well Reaction Module Bio Rad 1851197 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Chemically competent DH5α Invitrogen 18258012 Procure from any manufacturer or prepare yourself
Chloramphenicol ThermoFisher Scientific BP904-100 Procure from any manufacturer
Cytation5 Microplate reader BioTek CYT5MF Procure from any manufacturer, use any system capable of accurately quantifying DNA
Data Analysis Software (QuantaSoft and QuantaSoft Data Analysis Pro) Bio Rad N/A Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
ddPCR 96-Well Plates Bio Rad 12001925 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
ddPCR Droplet Reader Oil Bio Rad 1863004 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
ddPCR Supermix for Probes (No dUTP) Bio Rad 1863024 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
DG8 Cartridges for QX200/QX100 Droplet Generator Bio Rad 1864008 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
DG8 Gaskets for QX200/QX100 Droplet Generator Bio Rad 1863009 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Droplet Generation Oil for Probes Bio Rad 1863005 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Kanamycin ThermoFisher Scientific BP906-5 Procure from any manufacturer
Luria-Bertani agar ThermoFisher Scientific BP1425-2 Procure from any manufacturer or make it yourself from agar, tryptone, yeast digest, and NaCl
Luria-Bertani broth ThermoFisher Scientific BP1426-2 Procure from any manufacturer or make it yourself from tryptone, yeast digest, and NaCl
PCR Plate Heat Seal, foil, pierceable Bio Rad 1814040 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
PCR Tubes Eppendorf 951010022 Procure from any manufacturer
Petri dishes ThermoFisher Scientific FB0875712 Procure from any manufacturer
pPCR Script Cam SK+ Stratagene/Agilent 211192 No longer available commercially
Primer/Probe Design IDT N/A https://www.idtdna.com/Primerquest/Home/Index
pSKAP and pSKAP_Barcodes Addgene Plasmid numbers 122702-122726 www.addgene.org
PX1 PCR Plate Sealer Bio Rad 1814000 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
QX200 Droplet Generator Bio Rad 1864002 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
QX200 Droplet Reader Bio Rad 1864003 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Salmonella typhimurium strain ATCC 14028s ATCC ATCC 14028s www.atcc.org
Take3 Micro-Volume Plate BioTek TAKE3 Procure from any manufacturer, use any system capable of accurately quantifying DNA
Thermo Scientific FastDigest BamHI ThermoFisher Scientific FERFD0054 Procure from any manufacturer
Thermo Scientific FastDigest DpnI ThermoFisher Scientific FERFD1704 Procure from any manufacturer
Thermo Scientific FastDigest HindIII ThermoFisher Scientific FERFD0504 Procure from any manufacturer
Thermo Scientific GeneJet Gel Extraction and DNA Cleanup Micro Kit ThermoFisher Scientific FERK0832 Procure from any manufacturer
Thermo Scientific GeneJet Miniprep Kit ThermoFisher Scientific FERK0503 Procure from any manufacturer
Thermo Scientific Phusion High-Fidelity DNA Polymerase ThermoFisher Scientific F534L Procure from any manufacturer
Thermo Scientific T4 DNA Ligase ThermoFisher Scientific FEREL0011 Procure from any manufacturer
Thermocycler Bio Rad 1861096 Procure from any manufacturer
UVP Visi-Blue Transilluminator ThermoFisher Scientific UV95043301 Or other transiluminator that allows visualization of DNA
Water, Molecular Biology Grade ThermoFisher Scientific BP28191 Procure from any manufacturer

DOWNLOAD MATERIALS LIST

References

  1. Beuzón, C. R., Holden, D. W. Use of mixed infections with Salmonella strains to study virulence genes and their interactions in vivo. Microbes and Infection. 3, (14-15), 1345-1352 (2001).
  2. Bäumler, A. J., Tsolis, R. M., Valentine, P. J., Ficht, T. A., Heffron, F. Synergistic effect of mutations in invA and lpfC on the ability of Salmonella typhimurium to cause murine typhoid. Infection and Immunity. 65, (6), 2254-2259 (1997).
  3. Vital, M., Hammes, F., Egli, T. Competition of Escherichia coli O157 with a drinking water bacterial community at low nutrient concentrations. Water Research. 46, (19), 6279-6290 (2012).
  4. Schellenberg, J., Smoragiewicz, W., Karska-Wysocki, B. A rapid method combining immunofluorescence and flow cytometry for improved understanding of competitive interactions between lactic acid bacteria (LAB) and methicillin-resistant S. aureus (MRSA) in mixed culture. Journal of Microbiological Methods. 65, (1), 1-9 (2006).
  5. Becker, D., et al. Robust Salmonella metabolism limits possibilities for new antimicrobials. Nature. 440, (7082), 303 (2006).
  6. Rang, C., Galen, J. E., Kaper, J. B., Chao, L. Fitness cost of the green fluorescent protein in gastrointestinal bacteria. Canadian Journal of Microbiology. 49, (9), 531-537 (2003).
  7. Santiviago, C. A., et al. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice. PLoS Pathogens. 5, (7), e1000477 (2009).
  8. Ahmer, B. M., Gunn, J. S. Interaction of Salmonella spp. with the intestinal microbiota. Frontiers in Microbiology. 2, 101 (2011).
  9. Gallagher, L. A., Shendure, J., Manoil, C. Genome-scale identification of resistance functions in Pseudomonas aeruginosa using Tn-seq. MBio. 2, (1), (2011).
  10. Van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nature Methods. 6, (10), 767 (2009).
  11. van Opijnen, T., Lazinski, D. W., Camilli, A. Genome‐wide fitness and genetic interactions determined by Tn‐seq, a high‐throughput massively parallel sequencing method for microorganisms. Current Protocols in Microbiology. 36, (1), (2017).
  12. Mutalik, V. K., et al. Dual-barcoded shotgun expression library sequencing for high-throughput characterization of functional traits in bacteria. Nature Communications. 10, (1), 308 (2019).
  13. Yoon, H., Gros, P., Heffron, F. Quantitative PCR-based competitive index for high-throughput screening of Salmonella virulence factors. Infection and Immunity. 79, (1), 360-368 (2011).
  14. Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences. 97, (12), 6640-6645 (2000).
  15. Henard, C. A., Bourret, T. J., Song, M., Vázquez-Torres, A. Control of redox balance by the stringent response regulatory protein promotes antioxidant defenses of Salmonella. Journal of Biological Chemistry. 285, (47), 36785-36793 (2010).
  16. Poteete, A. R., Fenton, A. C. λ red-dependent growth and recombination of phage P22. Virology. 134, (1), 161-167 (1984).
  17. McCollister, B. D., Bourret, T. J., Gill, R., Jones-Carson, J., Vázquez-Torres, A. Repression of SPI2 transcription by nitric oxide-producing, IFNγ-activated macrophages promotes maturation of Salmonella phagosomes. Journal of Experimental Medicine. 202, (5), 625-635 (2005).
  18. Shaw, J. A., et al. Salmonella enterica serovar Typhimurium has three transketolase enzymes contributing to the pentose phosphate pathway. Journal of Biological Chemistry. 293, (29), 11271-11282 (2018).
  19. Freter, R., O'Brien, P., Macsai, M. S. Role of chemotaxis in the association of motile bacteria with intestinal mucosa: in vivo studies. Infection and immunity. 34, (1), 234-240 (1981).
  20. Taylor, R. K., Miller, V. L., Furlong, D. B., Mekalanos, J. J. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proceedings of the National Academy of Sciences. 84, (9), 2833-2837 (1987).
  21. Nogva, H. K., Dromtorp, S., Nissen, H., Rudi, K. Ethidium monoazide for DNA-based differentiation of viable and dead bacteria by 5'-nuclease PCR. Biotechniques. 34, (4), 804-813 (2003).
  22. Nocker, A., Camper, A. K. Novel approaches toward preferential detection of viable cells using nucleic acid amplification techniques. FEMS Microbiology Letters. 291, (2), 137-142 (2009).
  23. Nocker, A., Cheung, C. -Y., Camper, A. K. Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. Journal of Microbiological Methods. 67, (2), 310-320 (2006).
  24. Nocker, A., Mazza, A., Masson, L., Camper, A. K., Brousseau, R. Selective detection of live bacteria combining propidium monoazide sample treatment with microarray technology. Journal of Microbiological Methods. 76, (3), 253-261 (2009).
  25. Nocker, A., Sossa, K. E., Camper, A. K. Molecular monitoring of disinfection efficacy using propidium monoazide in combination with quantitative PCR. Journal of Microbiological Methods. 70, (2), 252-260 (2007).
  26. Nocker, A., Sossa-Fernandez, P., Burr, M. D., Camper, A. K. Use of propidium monoazide for live/dead distinction in microbial ecology. Applied and Environmental Microbiology. 73, (16), 5111-5117 (2007).
  27. Price-Carter, M., Tingey, J., Bobik, T. A., Roth, J. R. The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth ofSalmonella enterica Serovar Typhimurium on Ethanolamine or 1, 2-Propanediol. Journal of Bacteriology. 183, (8), 2463-2475 (2001).
  28. Taylor, R. G., Walker, D. C., McInnes, R. E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing. Nucleic Acids Research. 21, (7), 1677 (1993).
  29. Cherepanov, P. P., Wackernagel, W. Gene disruption in Escherichia coli: Tc R and Km R cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene. 158, (1), 9-14 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics