Purification of a High Molecular Mass Protein in Streptococcus mutans

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Murata, T., Yamashita, M., Ishikawa, M., Shibuya, K., Hanada, N. Purification of a High Molecular Mass Protein in Streptococcus mutans. J. Vis. Exp. (151), e59804, doi:10.3791/59804 (2019).

Abstract

Elucidation of a gene's function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3′ end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Introduction

Analysis of a gene's function usually involves comparison of phenotypic traits of wild-type strains to strains in which the gene of interest has been disrupted.Once the gene-disrupted strain is produced, exogenous addition of the gene product allows functional restoration.

The most common method for obtaining purified gene products required for subsequent restoration assays is by performing heterologous expression in Escherichia coli1. However, the expression of membrane proteins or high molecular mass proteins is often difficult using this system1. In these cases, the target protein is usually isolated from the cells that natively synthesizes the protein through a complex series of steps, which may lead to loss of the gene product. To overcome these issues, a simple procedure has been developed for gene product purification following a gene disruption method2, PCR-based DNA splicing method3 (designated two-step fusion PCR), and electroporation for genetic transformation in Streptococcus mutans. Addition of a polyhistidine tag (His-tag) to the C-terminus of the gene product facilitates its purification by immobilized metal affinity chromatography (IMAC).

To isolate the His-tag-expressing strain, the entire genomic DNA of the gene of interest (in this His-tag-expressing gene-disrupted strain) is replaced with an antibiotic-resistant marker gene. The procedure for generating the His-tag-expressing strainis nearly identical to that for generating a gene-disrupted strain as described previously4,5. Therefore, the methods for gene disruption and gene product isolation should be performed as serial experiments for the functional analysis.

In the present work, a polyhistidine-coding sequence is attached to the 3′ end of the gtfC (GenBank locus tag SMU_1005) gene, encoding glucosyltransferase-SI (GTF-SI) in S. mutans6. Then, expression studies in a streptococcal species were performed. Achieving heterologous gtfC expression by E. coli is difficult, likely because of the high molecular mass of GTF-SI. This strain is named S. mutans His-gtfC. A schematic illustration depicting the organization of the gtfC and spectinomycin resistance gene cassette (spcr)7 loci in wild-type S. mutans (S. mutans WT) and its derivatives is shown in Figure 1. The GTF-SI is a secretory protein that contributes to the development of cariogenic dental biofilm6. Under the presence of sucrose, an adherent biofilm is observed on a smooth glass surface in WT S. mutans strain but not in the S. mutans gtfC-disrupted strain (S. mutans ΔgtfC)2,5. Biofilm formation is restored in S. mutans ΔgtfC upon exogenous addition of the recombinant GTF-SI. The strain, S. mutans His-gtfC, is then used to produce the recombinant GTF-SI.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTE: Generation of S. mutansgtfC, in which the entire coding region of the gtfC gene is replaced with spcr, must be completed prior to performing these protocols. Refer to the published article for details on generation5.

1. Primer design

  1. Prepare primers for the construction of S. mutans His-gtfC.
    NOTE: The primer sequences used in this protocol are shown in Table 1. Two-step fusion PCR method for the generation of S. mutans His-gtfC is schematically illustrated in Figure 2.
    1. Design primers (gtfC-reverse and spcr-forward) for the attachment of His-tag-coding sequence, intervening between the gtfC gene and spcr (Figure 2A).
      1. Include GS linker and His-tag-coding sequence into both gtfC-reverse and spcr-forward primers, in which 24 bases at the 5’ regions are complementary to each other.
        NOTE: The amino acid sequence of the GS linker and His-tag (Gly-Gly-Gly-Gly-Ser-His-His-His-His-His-His) is attached to the C-terminus of GTF-SI through gene translation.
      2. Design a gtfC-forward primer to target the gtfC gene in the S. mutans WT genome >1 kb downstream of the gene and the spcr-reverse primer to target the downstream flanking region of spcr in the S. mutans gtfC. Set the melting temperature8 (Tm) of the gtfC-forward and spcr-reverse primers to match with the melting temperatures of the gtfC-reverse and spcr-forward primers, respectively.
    2. Design nested primers (nested-forward and nested-reverse) for the second PCR (Figure 2B).
    3. Design primers (gtfC-forward and colony-reverse) specific for the genomic DNA of the transformant (Figure 2C; the primers are used for colony PCR).
      NOTE: The amplicons straddle the border between gtfC and spcr. The gtfC-forward primer can be applied as the forward primer.
    4. Design primers (up-forward and down-reverse) for final confirmation of the generation of S. mutans His-gtfC (Figure 2C; the PCR product amplified by the primers is used for DNA sequencing).

2. Genomic DNA Extraction from S. mutans

NOTE: Each S. mutans strain should be cultured in brain heart infusion (BHI) medium at 37 °C under anaerobic conditions. The mutant strains of S. mutansgtfC and S. mutans His-gtfC are cultured in BHI supplemented with 100 µg/mL spectinomycin.

  1. Streak S. mutans WT and S. mutansgtfC separately onto each of the BHI agar plates. Incubate them overnight at 37 °C.
  2. Pick single colonies of S. mutans WT or S. mutansgtfC using a sterilized toothpick and inoculate into 1.5 mL of BHI broth. Incubate them overnight at 37 °C.
    NOTE: The colonies may be used as a source of template DNA for the first PCR (step 3.1).
  3. Transfer 1 mL of each bacterial culture to a 1.5 mL microcentrifuge tube. Centrifuge the culture for 1 min at 15,000 x g.
  4. Remove the supernatant and add 1 mL of the Tris-EDTA buffer (pH 8.0) to resuspend the cell pellet.
  5. Centrifuge the suspension for 1 min at 15,000 x g. Remove the supernatant. Resuspend the cell pellet in 50 µL of Tris-EDTA buffer (pH 8.0).
  6. Heat the suspension using a block incubator for 5 min at 95 °C. Centrifuge the suspension for 5 min at 15,000 x g.
  7. Transfer the supernatant to a new 1.5 mL microcentrifuge tube (the supernatant will serve as template DNA for the first PCR).

3. PCR Amplification

NOTE: Table 1, Table 2, and Table 3 summarize the PCR primers, reagents, and amplification cycles, respectively.

  1. Perform the first PCR using the S. mutans WT and S. mutansgtfC genome as the PCR templates. Amplify the regions harboring the downstream part of the gtfC gene and those harboring spcr using the primers described in step 1.1.1.2 (Figure 2A).
  2. Electrophorese each PCR product on 1% agarose gel. Excise the desired DNA fragments of approximately 1,000 bp and 2,000 bp. Purify the fragments from the gels using silica membrane-based gel extraction method.
    NOTE: The basic procedures for PCR9, DNA gel electrophoresis10, and DNA purification11 are detailed elsewhere.
  3. Perform a second PCR using the products of the first PCR (approximately equimolar) as PCR templates with the nested-forward and nested-reverse primers (Figure 2B).
  4. Electrophorese one-tenth of the PCR mixture on the agarose gel. Confirm the generation of the appropriate amplicon of approximately 3,000 bp.
  5. Precipitate the remaining PCR product.
    NOTE:
    Purification of the PCR product is not necessary, because non-specific amplicons generated by the second PCR do not interfere with homologous recombination.
    1. Add nuclease-free water to the PCR mixture and bring the total volume to 100 µL, followed by 0.1 volume (10 µL) of 3 M sodium acetate (pH 5.2) and 2.5 volumes (250 µL) of absolute ethanol. Mix and store the mixture for 10 min at room temperature (RT).
    2. Centrifuge the sample for 20 min at 15,000 x g at 4 °C. Discard the supernatant. Add 1 mL of 70% ethanol to wash the DNA pellet.
    3. Centrifuge the sample for 5 min at 15,000 x g at 4 °C. Discard the supernatant. Air-dry and dissolve the DNA pellet with 10 µL of nuclease-free water.

4. Cell Transformation

  1. Prepare competent S. mutans WT to introduce the second PCR product by following the steps described in the previous publication5. Store the cells at -80 °C.
    NOTE: For this experiment, the competent S. mutans WT cells have already been preserved in -80 °C to generate S. mutansgtfC.
  2. Mix 5 μL of the concentrated second PCR product to the 50 μL aliquot of ice-cold competent cells frozen previously. Add the mixture into electroporation cuvettes. Give a single electric pulse (1.8 kV, 2.5 ms, 600 Ω, 10 µF) to the cells using the electroporation apparatus.
  3. Resuspend the cells in 500 μL of BHI broth. Immediately, spread 10–100 μL of the suspension onto BHI agar plates containing spectinomycin. Incubate the plates for 2–6 days at 37 °C until colonies have grown sufficiently to be picked up.

5. Verification of Genome Recombination and Storage

  1. Perform colony PCR, using gtfC-forward and colony-reverse primers to screen for the recombination. Electrophorese each colony PCR product on an agarose gel. Confirm the DNA fragment of approximately 1,500 bp.
  2. Pick one of the positive colonies using a sterilized toothpick and subculture the cells overnight in 2 mL of BHI broth containing spectinomycin.
  3. Mix 0.8 mL of bacterial culture with 0.8 mL of sterile 50% glycerol and stock at -80 °C or -20 °C.
  4. Transfer the remaining 1 mL of cell suspension to a 1.5 mL microcentrifuge tube. Repeat steps 2.3–2.7 to extract the genomic DNA from the cells.
  5. Perform PCR using the up-forward and down-reverse primers and genomic DNA as a template. Repeat step 3.2 to purify the amplified DNA product from the gels.
  6. Determine the DNA sequence of the purified amplicon by DNA sequencing.
    NOTE: Make sure to confirm the generation of S. mutans His-gtfC by DNA sequencing.

6. Purification of Polyhistidine-tagged GTF-SI

  1. Streak S. mutans His-gtfC onto a spectinomycin-containing BHI agar plate. Incubate them overnight at 37 °C.
  2. Pick up a single colony using a sterilized toothpick and subculture cells in 3 mL of BHI broth. Incubate overnight at 37 °C.
  3. Prepare two conical flasks with 1 L of BHI broth without spectinomycin. Inoculate 1 mL of the overnight culture suspension into 1 L of the BHI broth. Incubate overnight at 37 °C.
  4. Concentrate proteins from the culture supernatant by ammonium sulfate precipitation.
    NOTE:
    Extract from cell bodies if a target protein is intracellular. The basic procedures for ammonium sulfate precipitation are detailed elsewhere12.
    1. Centrifuge the bacterial culture suspension for 20 min at 10,000 x g at 4 °C. Recover the culture supernatant into a 3 L glass beaker.
    2. Add 1,122 g of ammonium sulfate to 2 L of the supernatant (80% saturation) with vigorous stirring using a magnetic stirrer. Allow the precipitate to form for 4 h or more at 4 °C with stirring.
      NOTE: The precipitate formation can be continued overnight.
    3. Centrifuge the ammonium sulfate-precipitated solution at 15,000 x g for 20 min at 4 °C. Decant the supernatant.
    4. Collect the precipitate with a spatula and transfer into a 200 mL glass beaker. Resuspend the pellets in 35 mL of binding buffer (50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, pH 8.0).
    5. Dialyze the suspension against 2,500 mL of the binding buffer using a regenerated cellulose dialysis tubing, at 4 °C, with stirring. Replace the dialysis solution after 2 h and continue dialysis overnight.
    6. Replace the dialysis solution again. Continue to dialyze for an additional 2 h.
  5. Centrifuge the dialyzed suspension at 20,000 x g for 10 min at 4 °C. Filter the supernatant through a membrane filter using suction filtration equipment. Transfer the filtrate to a 75 cm2 flask.
  6. Fractionate the polyhistidine-tagged GTF-SI from the filtrated suspension by immobilized metal affinity chromatography (IMAC).
    1. Transfer 2 mL of the Ni-charged IMAC resin slurry (approximately 1 mL of resin) to a chromatographic column whose outlet is fitted to a silicone tube. Remove the storage solution by the gravity flow.
      CAUTION: Do not allow the resin to dry out throughout the IMAC.
    2. Add 3 mL of distilled water into the column to wash the resin. Add 5 mL of the binding buffer to equilibrate the resin.
    3. Shut off the flow with a Hoffmann pinch cock. Add 5 mL of the filtered suspension from step 6.5 to make the slurry.
    4. Add all the slurry to the remaining filtered suspension. Swirl the mixture gently for 30 min at 4 °C.
    5. Load the mixture back on the column. Remove the suspension by the gravity flow. Wash the IMAC resin with 20 mL of binding buffer.
      NOTE: Adjust the flow rate to approximately 2 mL/min with a Hoffmann pinch cock throughout the subsequent IMAC.
    6. Elute the recombinant GTF-SI with 20 mL of the elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM imidazole, pH 8.0).
      NOTE: The protocol can be paused here. The eluate should be stored at 4 °C. IMAC resin can be reused. Refer to the instructions for the IMAC resin.
  7. Replace the elution buffer with the storage buffer (50 mM phosphate buffer, pH 6.5) and concentrate the recombinant GTF-SI solution to approximately 1 mL using a centrifugal ultrafiltration unit. Store the recombinant GTF-SI solution at 4 °C.
    NOTE: Confirm the polyhistidine-tagged GTF-SI purification using SDS-PAGE13 and western blotting14 by employing a horseradish peroxidase-conjugated anti-polyhistidine monoclonal antibody. Addition of CHAPS (final concentration, 0.1%) to the eluent may be required to avoid nonspecific adsorption to the unit, depending on the target protein.

7. Functional Restoration by Recombinant GTF-SI

  1. Streak each S. mutans strain onto a BHI agar plate individually. Incubate the plates overnight at 37 °C.
  2. Using a sterilized toothpick, pick up a single colony to inoculate into 2 mL of BHI broth. Incubate overnight at 37 °C.
  3. Use 20 μL of the overnight culture of S. mutansgtfC to inoculate 2 mL of BHI broth containing 1% sucrose without antibiotics in a glass test tube. Add the GTF-SI or an equivalent volume of the vehicle to the S. mutansgtfC culture, and culture the cells with the tube placed in an inclined position overnight.
    NOTE: Sterilize the GTF-SI solution with a sterile syringe filter and determine protein concentration using a bicinchoninic acid protein assay15 before use.
  4. Agitate the culture suspensions with a vortex mixer for 10 s. Decant the suspensions. Wash the test tubes with a sufficient amount of distilled water.
  5. Stain the biofilms on the tube wall with 1 mL of 0.25% Coomassie brilliant blue (CBB).
  6. Decant the staining solution after 1 min. Wash the test tubes with a sufficient amount of distilled water. Air-dry the test tubes.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figure 3 shows the size of each amplicon from the first PCR (Figure 3A) and second PCR (Figure 3B). The size of each amplicon corresponded with the predicted size, as described in Table 1. Figure 4A shows S. mutans colonies transformed with the second PCR product and plated on the BHI agar plates containing spectinomycin. Colony PCR products were then run on the agarose gel (Figure 4B). Each amplicon was of the predicted size, as described in Table 1. Figure 5 shows images of SDS-PAGE and western blot. Protein purified with IMAC was observed as a single band by SDS-PAGE (Figure 5A). Western blot was performed using the anti-polyhistidine antibody to confirm that the observed band was the expected polyhistidine-tagged protein (Figure 5B) of 160 kDa. Figure 6 shows the sucrose-derived biofilm-forming ability of each S. mutans strain. Only S. mutans WT and S. mutans His-gtfC could form an adherent biofilm on the tube wall in the presence of 1% sucrose. This was not observed in S. mutans ΔgtfC (Figure 6A). However, the addition of the recombinant GTF-SI restored the adherent biofilm formation ability in S. mutans ΔgtfC (Figure 6B).

Figure 1
Figure 1: Organization of gtfC and spcr loci in the S. mutans UA159 genome and its derivatives. A schematic illustration of the His-tag between gtfC and spcr. The lengths of the genes and gaps are not to scale. Shaded pentagon: SMU_1004; solid pentagon: SMU_1006. This figure has been modified from a previous publication2. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Strategy for two-step fusion PCR. A schematic illustration of S. mutans His-gtfC construction. The lengths of the genes and gaps are not to scale. The primer-binding sites in the template are indicated by patterns. (A) The regions harboring part of the gtfC gene in the S. mutans WT genome and harboring spcr in the S. mutans ΔgtfC genome were amplified using the first PCR. (B) The second PCR was performed with nested primers using the two fragments that were amplified by the first PCR as templates, and a DNA construct for homologous recombination was obtained. (C) The mutant strain was generated upon homologous recombination in the bacteria. This figure has been modified from a previous publication2. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Agarose gel electrophoresis of first and second PCR products. (A) Products of the first PCR of a part of gtfC (gtfC; left image) and the region harboring spcr (spcr; right image) are shown. The single electrophoretic image is divided to label the marker bands. (B) The second PCR products amplified with the nested primers are shown. Each arrowhead indicates the predicted size of each PCR product. M = molecular marker. Please click here to view a larger version of this figure.

Figure 4
Figure 4: Colony PCR to screen generation of S. mutans His-gtfC. (A) S. mutans colonies transformed by the second PCR product are shown. Colony ID is indicated by circled numbers. (B) Agarose gel electrophoresis of the colony PCR products is shown. Circled lane number corresponds to the colony ID in Figure 4A. M = molecular marker. Please click here to view a larger version of this figure.

Figure 5
Figure 5: Confirmation of polyhistidine-tagged GTF-SI purification. (A) Representative SDS-PAGE image is shown. (B) Representative western blot image is shown. A nitrocellulose membrane on which GTF-SI was transferred was probed with a horseradish peroxidase-conjugated anti-polyhistidine monoclonal antibody. Immunoreactive bands were visualized using a chemiluminescence reaction. The arrowheads indicate the predicted size of the recombinant GTF-SI. M: molecular marker; 1 = sample prior to IMAC; 2 = sample obtained by IMAC. Please click here to view a larger version of this figure.

Figure 6
Figure 6: Functional restoration by addition of the recombinant GTF-SI. (A) The ability of sucrose-derived adherent biofilm formation is shown for each S. mutans strain. (B) The ability of forming adherent biofilms was restored in S. mutans ΔgtfC by addition of recombinant GTF-SI (25 µg). WT = S. mutans WT; ΔgtfC = S. mutans ΔgtfC; His-gtfC = S. mutans His-gtfC. Please click here to view a larger version of this figure.

Primer pairs Sequence (5′ to 3′) Expected band size (bp)
1st PCR
gtfC-forward
gtfC-reverse A,B
TAAAGGTTATGTTTATTATTCAACGAGTGGTAACC
ATGATGATGATGATGACTACCACCACCTCCAAATCTAAAGAAATTGTCAA
1,090
spcr-forward A,C

spcr-reverse
GGTGGTAGTCATCATCATCATCATCATTAAATCGATTTTCGTTCGTGAAT
TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC
2,232
2nd PCR
Nested-forward
Nested-reverse
TGGTATTATTTCGATAATAACGGTTATATGGTCAC
GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG
3,179
Verification of recombination
Colony PCR
gtfC-forward
Colony-reverse
TAAAGGTTATGTTTATTATTCAACGAGTGGTAACC
CCACTCTCAACTCCTGATCCAAACATGTAAGTACC
1,482
Final verification
Up-forward
Down-reverse
TACGGCCGTATCAGTTATTACGATGCTAACTCTGG
TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG
6,173

Table 1: Primers used in the protocol. AThe underlined sequences of 'gtfC-reverse and spcr-forward' are complementary, and the bold-typed sequencescode for the His-tag (gtfC-reverse; ATGATGATGATGATG, spcr-forward; CATCATCATCATCATCAT) and GS linker (gtfC-reverse; ACTACCACCACCTCC, spcr-forward; GGTGGTAGT). BThe DNA stop codon of gtfC has been removed. CA DNA stop codon (TAA) has been added immediately after the polyhistidine-coding sequences.

Reagent Concentration of stock solution Volume Final concentration
DNA polymerase premix 2x 25 μL 1x
Forward primer 5 µM 2 μL 0.2 µM
Reverse primer 5 µM 2 μL 0.2 µM
Template DNA Variable Variable Variable
Deionized water - Up to 50 μL -

Table 2: PCR reagents: For the first PCR, 2 µL of the DNA template was added. For the second PCR, 0.5-2 µL of first PCR amplicon was added to the reaction mixture. For colony PCR, bacterial cells were directly added to the reaction mixture.

Step Temperature Time Number of cycles
Initial denaturation 98 °C 2 min 1
Denaturation
Annealing
Extension
98 °C
50 °C
72 °C
10 s
5 s
Amplicon-dependent
(1 min/1 kbp)
35
Final extension 72 °C Amplicon-dependent
(1 min/1 kbp)
1

Table 3: PCR amplification cycles.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

The design of primers is the most critical step in the protocol. The sequences of the gtfC-reverse and spcr-forward primers were automatically determined based on the sequences of both the 3′ end region of gtfC and the 5′ end region of spcr. Each primer includes 24 complementary bases that encode a GS linker and a His-tag-coding sequence at their 5' regions. Disruption of the native regulatory sequences located in the upstream flanking regions can be avoided by the addition of His-tag-coding sequences to the 3′ end. The DNA stop codon must be removed from the gtfC-reverse primer and added to the spcr-forward primer. Moreover, the gtfC-forward and spcr-reverse should be designed to amplify flanking regions of approximately 1 kb upstream and downstream of the target region of homologous recombination in the S. mutans WT genome, respectively. Addition of long flanking sequences improves the efficiency of homologous recombination. The nested primers were designed to be used instead of the outermost primer pair (gtfC-forward and spcr-reverse) in this protocol. Inclusion of nested primers is required for the second PCR, as detailed elsewhere5.

Transformation by electroporation is efficient1 and procedures for competent cell preparation preceding electroporation are also much simpler compared to the alternative methods16,17,18, although an electroporation apparatus is required. It is strongly recommended to prepare competent S. mutans WT anew in case of missing colonies on the plate after electroporation. Although incubation for a couple of hours after electroporation may improve transformation efficiency, the extra incubation does not affect success of the transformation. Cells in the log growth phase should be used for the competent cell preparation, as described previously5.

Since the amount of recombinant protein depends on the native expression of the gene, scale-up culture may be required in cases of proteins with lower expression.The method presented here is limited by the application of the functional restoration assay. The addition of gene of interest cannot be applied to intracellular proteins exogenously. However, the developed method presents considerable advantages in terms of facility, efficiency, and cost (e.g., no enzymatic reactions other than PCR) when working with the extracellular target protein. Additionally, the purification of the recombinant protein and confirmation of actual gene expression can be performed simply using common His-tag applications, as shown in Figure 5.

The present method, including gene disruption and gene product isolation, may be adapted for future use in other species as serial experiments for the functional analysis of a gene of interest.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors have nothing to disclose.

Acknowledgments

This work was supported by the Japan Society for the Promotion of Science (JSPS) (grant numbers 16K15860 and 19K10471 to T. M., 17K12032 to M. I., and 18K09926 to N. H.) and the SECOM Science and Technology Foundation (SECOM) (grant number 2018.09.10 No. 1).

Materials

Name Company Catalog Number Comments
Agarose Nippon Genetics NE-AG02 For agarose gel electrophoresis
Anaeropack Mitsubishi Gas Chemical A-03 Anaerobic culture system
Anti-His-Tag monoclonal antibody MBL D291-7 HRP-conjugated
BCA protein assay kit Thermo Fisher Scientific 23227 Measurement of protein concentration
Brain heart infusion broth Becton, Dickinson 237500 Bacterial culture medium
CBB R-250 Wako 031-17922 For biofilm staining
Centrifugal ultrafiltration unit Sartorius VS2032 Buffer replacement and protein concentration
Centrifuge Kubota 7780II
Chromatographic column Bio-Rad 7321010 For IMAC
Dialysis membrane clamp Fisher brand 21-153-100
Dialysis tubing As One 2-316-06
DNA polymerase Takara R045A High-fidelity DNA polymerase
DNA sequencing Eurofins Genomics
ECL substrate Bio-Rad 170-5060 For western blotting
EDTA (0.5 M pH 8.0) Wako 311-90075 Tris-EDTA buffer preparation
Electroporation cuvette Bio-Rad 1652086 0.2 cm gap
Electroporator Bio-Rad 1652100
EtBr solution Nippon Gene 315-90051 For agarose gel electrophoresis
Gel band cutter Nippon Genetics FG-830
Gel extraction kit Nippon Genetics FG-91202 DNA extraction from agarose gel
Imager GE Healthcare 29083461 For SDS-PAGE and western blotting
Imidazole Wako 095-00015 Binding buffer and elution buffer preparation
Incubator Nippon Medical & Chemical Instruments EZ-022 Temperature setting: 4 °C
Incubator Nippon Medical & Chemical Instruments LH-100-RDS Temperature setting: 37 °C
Membrane filter Merck Millipore JGWP04700 0.2 µm diameter
Microcentrifuge Kubota 3740
NaCl Wako 191-01665 Preparation of binding buffer and elution buffer
NaH2PO4·2H2O Wako 192-02815 Preparation of binding buffer and elution buffer
NaOH Wako 198-13765 Preparation of binding buffer and elution buffer
(NH4)2SO4 Wako 015-06737 Ammonium sulfate precipitation
Ni-charged resin Bio-Rad 1560133 For IMAC
PCR primers Eurofins Genomics Custom-ordered
Protein standard Bio-Rad 161-0381 For SDS-PAGE and western blotting
Solvent filtration apparatus As One FH-1G
Spectinomycin Wako 195-11531 Antibiotics; use at 100 μg/mL
Sterile syringe filter Merckmillipore SLGV004SL 0.22 µm diameter
Streptococus mutans ΔgtfC Stock strain in the lab. gtfC replaced with spcr
Streptococus mutans UA159 Stock strain in the lab. S. mutans ATCC 700610, Wild-type strain
Sucrose Wako 196-00015 For biofilm development
TAE (50 × ) Nippon Gene 313-90035 For agarose gel electrophoresis
Thermal cycler Bio-Rad PTC-200
Tris-HCl (1 M, pH 8.0) Wako 314-90065 Tris-EDTA buffer preparation

DOWNLOAD MATERIALS LIST

References

  1. Sambrook, J., Russell, D. W. Molecular Cloning: A Laboratory Manual 3rd Edition. Cold Spring Harbor Laboratory Press. New York. (2001).
  2. Murata, T., Ishikawa, M., Shibuya, K., Hanada, N. Method for functional analysis of a gene of interest in Streptococcus mutans: gene disruption followed by purification of a polyhistidine-tagged gene product. Journal of Microbiological Methods. 155, 49-54 (2018).
  3. Horton, R. M., Cai, Z., Ho, S. M., Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques. 54, (3), 129-133 (2013).
  4. Murata, T., Hanada, N. Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans. FEMS Microbiology Letters. 363, (11), 101 (2016).
  5. Murata, T., Okada, A., Matin, K., Hanada, N. Generation of a gene-disrupted Streptococcus mutans strain without gene cloning. Journal of Visualized Experiments. (128), (2017).
  6. Hanada, N., Kuramitsu, H. K. Isolation and characterization of the Streptococcus mutansgtfC gene, coding for synthesis of both soluble and insoluble glucans. Infection and Immunity. 56, (8), 1999-2005 (1988).
  7. LeBlanc, D. J., Lee, L. N., Inamine, J. M. Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis. Antimicrobial Agents and Chemotherapy. 35, (9), 1804-1810 (1991).
  8. Lorenz, T. C. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. Journal of Visualized Experiments. (63), e3998 (2012).
  9. Database, J. S. E. PCR: The Polymerase Chain Reaction. Journal of Visualized Experiments. (2019).
  10. Database, J. S. E. DNA Gel Electrophoresis. Journal of Visualized Experiments. (2019).
  11. Database, J. S. E. Gel Purification. Journal of Visualized Experiments. (2019).
  12. Wingfield, P. T. Protein precipitation using ammonium sulfate. Current Protocols in Protein Science. 84, (1), (2016).
  13. Database, J. S. E. Separating Protein with SDS-PAGE. Journal of Visualized Experiments. (2019).
  14. Database, J. S. E. The Western Blot. Journal of Visualized Experiments. (2019).
  15. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  16. Perry, D., Wondrack, L. M., Kuramitsu, H. K. Genetic transformation of putative cariogenic properties in Streptococcus mutans. Infection and Immunology. 41, (2), 722-727 (1983).
  17. Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., Cvitkovitch, D. G. PCR ligation mutagenesis in transformable streptococci: application and efficiency. Journal of Microbiological Methods. 49, (2), 193-205 (2002).
  18. Ge, X., Xu, P. Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR. Journal of Visualized Experiments. (69), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics