A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

8.8K views

DOI:

10.3791/56421

January 31st, 2018

In This Article

Summary

A novel technique for rapid antigen display on a bacterial surface is presented, which involves surface biotinylation followed by exposure to proteins of interest in fusion with monomeric avidin. Loading BCG with selected antigens successfully improves its immunogenicity, suggesting that surface decoration can replace traditional genetic approaches.

Abstract

Tuberculosis (TB) is a serious infectious disease and the only available vaccine M. bovis bacillus Calmette-Guérin (BCG) is safe and effective for protection against children's severe TB meningitis and some forms of disseminated TB, but fails to protect against pulmonary TB, which is the most prevalent form of the disease. Promising strategies to improve BCG currently rely either on its transformation with genes encoding immunodominant M. tuberculosis (Mtb)-specific antigens and/or complementation with genes encoding co-factors that would stimulate antigen presenting cells. Major limitations to these approaches include low efficiency, low stability, and the uncertain level of safety of expression vectors. In this study, we present an alternative approach to vaccine improvement, which consists of BCG complementation with exogenous proteins of interest on the surface of bacteria, rather than transformation with plasmids encoding corresponding genes. First, proteins of interest are expressed in fusion with monomeric avidin in standard E. coli expression systems and then used to decorate the surface of biotinylated BCG. Animal experiments using BCG surface decorated with surrogate ovalbumin antigen demonstrate that the modified bacterium is fully immunogenic and capable of inducing specific T cell responses. Altogether, the data presented here strongly support a novel and efficient method for reshaping the current BCG vaccine that replaces the laborious conventional approach of complementation with exogenous nucleic acids.

Introduction

Various strategies have been proposed to replace the current TB vaccine BCG, including protein adjuvant systems, viral vectored technologies, attenuated live M.tb strains, and genetically modified BCG strains, either to introduce genes over-expressing BCG antigens that are not sufficiently expressed during infection1 or Mtb-specific antigens not present in BCG2. Genetic engineering, however, faces many barriers including the uncertain level of safety, the time-consuming process, and the low efficiency of expression vectors4,5. With regards to improving BCG, an alternate approach is needed to improve immunogenicity without the need for uncertain genetic alternations.

In this study, we introduce a novel strategy for display of recombinant proteins of interest on the BCG cell surface that is based on the well-known high-affinity avidin interaction with biotin. This approach allows rapid and reproducible attachment of recombinant avidin fusion proteins on the surface of biotinylated BCG, which facilitates broad manipulations of BCG to achieve maximal improvement of its efficacy while maintaining its excellent safety record, observed over decades of use.

Avidin affinity for biotin is extremely high (Kd = 10−15 M) and once formed, the biotin-avidin complex is very stable and can only be disrupted under denaturing conditions6. However, for this type of interaction to serve as a gene transfer method alternative, long-term but reversible display of recombinant proteins is required. Thus, we introduced here a low affinity monomeric avidin (Kd = 10−7 M) that leads to the reversible release of protein from the surface decorated BCG once ingested inside antigen presenting cells. In order to provide a proof of concept, we tested this method using a monomeric avidin chimeric protein corresponding to a surrogate antigen derived from ovalbumin (OVA)7,8. The results showed that the BCG cell surface can be easily and rapidly decorated with monomeric avidin fusion proteins and that this binding to the BCG surface is stable and reproducible without detectable changes in bacterial growth and survival. Also, we found that BCG decorated with monomeric avidin fused with OVA (AviOVA) can induce an immune response similar to that induced by BCG genetically expressing the same antigen both in vitro and in vivo. This technology of reversible display of proteins of interest on the bacterial surface is therefore an effective replacement of traditional gene transfer approaches and can provide a platform for broad manipulations of BCG and further applications in vaccine development.

Access restricted. Please log in or start a trial to view this content.

Protocol

All animals were maintained in accordance with protocols approved by the Animal Care and Use Committees at the University of British Columbia. Experiments were approved by the Animal Care and Use Committees and performed according to the Canadian Council on Animal Care Guidelines. The animal assurance welfare number is A11-0247.

1. Generation of Monomeric Avidin Fusion Proteins Expressing Plasmids

  1. Sub-clone monomeric avidin sequence12 into pDEST17 plasmid between the "CTC" and "GAA" sites which corresponds to 133-134bp. (i.e., between the 6-histag and the pDEST17 Attr1 recombination site) to obtain p17-Avi.
    NOTE: The monomeric avidin DNA sequence is shown below. The three mutations introduced in wild-type Avidin to obtain monomeric avidin are shown in bolded characters.
    gccagaaagtgctcg ctgactggga aatggaccaa cgatctgggc tccATCatga ccatcggggc tgtgaacagc
    agaggtgaat tcacaggcac ctacatcaca gccgtaacag ccacatcaaa tgagatcaaa gagtcaccac tgcatgggac
    acaaGCTacc atcaacaaga ggacccagcc cacctttggc ttcaccgtca attggaagtt ttcagagtcc accactgtct
    tcacgggcca gtgcttcata gacaggaatg ggaaggaggt cctgaagacc atgtggctgc tgcggtcaag tgttaatgac
    attggtgatg acAAAaaagc taccagggtc ggcatcaaca tcttcactcg cctgcgcaca cagaaggagt ga
  2. Design primers flanked with AttB1 and AttB2 sites corresponding to OVA polypeptide757-1035 (I-Ab- and H-2Kb-restricted epitopes) DNA sequence. Primer sequences are: Attb1-OVA
    GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTTGAGCAGCTTGAGAGTAT and Attb2-OVA
    GGGGACCACTTTGTACAAGAAAGCTGGGTGTTACCCTACCACCTCTCTGC. (Attb1 and Attb2 sequences are bolded).
    1. PCR-amplify OVA polypeptide757-1035 DNA sequence with the primers above using the pUC57-OVA plasmid as a template.
    2. Clone the PCR products into pDONR-221 through a site-specific in vitro recombination reaction (e.g., BP Clonase) to obtain pDONR-OVA.
  3. Transfer the gene of interest into p17-Avi using the LR Clonase reaction to obtain p17-Avi-OVA.
    NOTE: For details of BP and LR recombination cloning, see the manufacturer's manual.

2. Monomeric Avidin Fusion Protein Expression, Purification, and Refolding

  1. Transform p17-Avi-OVA plasmid into E. coli BL21 and induce 250 mL of E. coli BL21 culture with IPTG (0.1 M) for 3 h at 37 °C.
  2. Lysis of Bacteria and Inclusion Bodies Solubilization
    1. Pellet the 250 mL of induced BL21 culture by 30 min of centrifugation at 4,000 x g and at 4 °C.
    2. Collect pellets in 10 mL of lysis buffer (50 mM Tris-HCL, 150 mM NaCl, 6 M Guanidine-HCL, pH 1.5-2.5) and incubate for 15 min at 95 °C. Incubate overnight at room temperature on a rotator.
    3. Centrifuge 30 min at 15,000 x g and 4 °C and collect supernatant.
  3. Purify Avi-OVA from Supernatant (Solubilized Inclusion Bodies Fraction) Using Ni-NTA Columns.
    1. Dilute inclusion bodies 1:2 with lysis buffer.
    2. Use 4 mL of Ni-NTA resin per 250 mL of culture-derived inclusion bodies.
    3. Wash 3x with 10 mL of lysis buffer (pH 7.0).
    4. Elute with 10 mL of elution buffer (lysis buffer pH 7.0 with 250 mM imidazole).
  4. Refold eluted protein by gradual dilution (1:10) and rapid vortexing in Tris buffer (pH 7.5) containing 1 mM DTT, 200 mM NDSB256 (3-(Benzyldimethylammonio)propanesulfonate), 0.5 mM Tween 80, 500 mM arginine, and 200 mM NaCl for 30 min at room temperature.
  5. De-salt and buffer exchange refolded protein from Tris buffer into PBS with protein concentrators according to the manufacturer's protocols.
  6. Remove aggregates by centrifugation for 30 min at 3,500 x g and at 4 °C, and store aliquots of soluble protein at -20 °C.

3. Biotinylation of BCG Cell Surface

  1. Grow BCG in Middlebrook 7H9 broth with 10% OADC (oleic acid, albumin and dextrose solution) and 0.05% Tween 80 at 37 °C on a shaker platform at 50 rpm until OD = 0.5-1.
    NOTE: BCG is a biosafety level 2 pathogen and all experiments concerning BCG should be done in a biosafety cabinet with proper personal protective equipment.
  2. Wash 109 BCG 3 times with 500 µL of ice-cold endotoxin free PBS plus 0.1% Tween80 (PBST) (pH 8.0). Suspend BCG pellet in sterile endotoxin free PBS.
  3. Immediately before use, prepare 1 mL of 10 mM Sulfo-NHS SS biotin in sterile filtered water.
    1. Incubate bacteria with 1 mL of 0.5 mM of Sulfo-NHS SS biotin at room temperature for 30 min.
  4. Wash labeled bacteria 3 times with 500 µL of iced cold PBST to remove non-reacted biotinylation reagent.
    1. Re-suspend pellet in 1 mL of PBST.
  5. To evaluate biotinylation efficiency, stain 108 biotinylated BCG with Streptavidin-FITC (1:100, 25 µL) at room temperature for 20 min.
    1. Incubate stained bacteria in 1 mL of 2% PFA for 20 min at room temperature and then examine levels of biotinylation by flow cytometry analysis.

4. Phenotype of Biotinylated Mycobacteria: Growth and Survival

  1. Grow BCG strains in Middlebrook 7H9 broth with 10% OADC (oleic acid, albumin and dextrose solution) and 0.05% Tween 80 at 37 °C on a shaker platform at 50 rpm.
    1. Record the optical density (OD600) of the bacterial culture over an 8-day period.
  2. Use BCG-Luc (previously described9) to detect survival of bacteria in macrophages.
    1. Infect RAW264.7 cells with biotinylated BCG-Luc (MOI 10:1) or untreated BCG-Luc (control) and incubated at 37 °C over a 48 h time period.
    2. Wash cell monolayers and then lyse with 0.025% SDS to release ingested bacteria.
    3. Measure bioluminescence production with Luciferase assay system and luminometer.
      NOTE: Luminescence signal is indicative of bacterial viability. Please refer to the manufacturer's manual for details of luciferase assay.

5. Binding of Monomeric Avidin-Fusion Protein to Biotinylated BCG Surface

  1. Mix 5 x 108 biotinylated BCG with Avi-protein (10 μg/mL final in PBS-T) for 1 h at room temperature on shaker platform.
  2. Wash bacteria 3 times with 500 µL of iced cold PBST and stain with rabbit anti-avidin antibody (Ab) (1:100 dilution, previously described10) for 20 min at room temperature and then with FITC conjugated goat anti-rabbit IgG Ab in the same conditions.
  3. Wash bacteria 3 times with 500 µL of PBST and analyze by flow cytometry to evaluate the extent of surface decoration.

6. Lyophilization of Mycobacteria

  1. Biotinylate bacteria according to step 3.1-3.4 and coat biotinylated bacteria with Avi-OVA according to step 5.1.
  2. Aliquot biotinylated and coated bacteria (108), wash with PBS and re-suspend in 0.5 mL lyophilization media (25% Sauton medium, 75% H2O, and 1.5% Na-glutamate).
  3. Transfer bacteria to glass vials and freeze in a -80 °C freezer overnight.
  4. Lyophilize filled and frozen glass vials for 24 h using a freeze dryer.
  5. Store dried samples at room temperature and reconstitute in PBS when needed.
  6. Repeat step 3.5 to evaluate biotinylation and surface coating stability.

7. Phagocytosis Assay

  1. Grow RAW 264.7 macrophage cells in 10 cm diameter culture dishes in DMEM medium containing 5% FCS, 1% each of L-glutamine, HEPES, non-essential amino acids, and penicillin and streptomycin until 70-80% confluency.
  2. Seed 2 x 106 RAW 264.7 macrophage cells in a 6-well plate. Allow cells to adhere overnight at 37 °C and 5% CO2.
  3. Generate DsRed BCG (previously described9) decorated with Avi-OVA (DsRed BCG-Avi-OVA) according to steps 3.1-3.4 and 5.1.
  4. Infect RAW cells with DsRed BCG-Avi-OVA or untreated DsRed BCG at MOI 20:1 for 24 h at 37 °C.
  5. Wash cells three times and trypsinize using 1 mL of 0.25% trypsin at 37 °C for 10 min to remove partially detached bacteria.
  6. Fix in 2.5% PFA in PBS for 20 min at room temperature.
  7. Wash 3x with PBS and analyze by flow cytometry.

8. Intracellular Trafficking of OVA Decorated Biotinylated BCG in Macrophages

  1. Fluorescence microscopy
    1. Seed 3 x 105 RAW 264.7 macrophage cells on coverslips in a 24-well plate. Allow cells to adhere overnight at 37 °C and 5% CO2.
    2. Infect macrophage cells with mycobacteria (MOI 10:1) in maintenance media without antibiotics at 37 °C and 5% CO2 for 4 to 24 h.
    3. Wash cells and trypsinize to remove surface attached, non-ingested bacteria as in step 7.5.
    4. Fix infected cells in 2.5% PFA in PBS for 20 min at room temperature followed by 3 washes with PBS.
    5. Permeabilize cells in blocking/permeabilization buffer (0.1% Triton X-100, 3% BSA in PBS) for 20 min at room temperature.
      1. Use specific antibody of interest (e.g., rabbit anti-avidin Ab) at 10 μg/mL in permeabilization buffer for 20 min at room temperature followed by secondary antibody (e.g., FITC-goat anti-rabbit IgG) for 20 min.
    6. Wash cells 3x with PBS, once with water, and mount on slides in 10 μL of aqueous mounting medium to minimize fluorescence photobleaching.
    7. Examine slides by digital confocal microscopy using an epifluorescence microscope equipped with 63x/1.4 Plan-Apochromat objective. Record images using a digital camera coupled to the microscope software.
  2. Immunogold Staining and Electron Microscopy
    1. Seed 2 x 106 RAW 264.7 macrophage cells in 6-well plates.
    2. Fix BCG infected macrophages with 4% PFA for 4 h in room temperature.
    3. Wash samples twice with PBS.
    4. Embed samples in 4% low melting point agarose, and dehydrate in 70% ethanol.
    5. Transfer samples to acrylic resin and polymerize at 50 °C.
    6. Cut out 60 nm sections with a microtome and collect sections on nickel grids.
    7. Label samples with 10 μg/mL avidin antibody for 1 h at room temperature or 4 °C overnight in incubation solution (PBS and 0.1% BSA) and then wash with incubation solution gold-conjugated F(ab')2 of ultra-small goat-anti-rabbit IgG (1/20) for 1 h at room temperature in incubation solution.
    8. Wash sections in distilled water, stain in 2% glutaraldehyde, wash again, air dry, and examine with electron microscope.

9. Animal Immunization and Organ Processing

NOTE: All steps should be done in a biosafety cabinet.

  1. Pass biotinylated and protein coated bacteria through 271/2G needle 10 times to make single cell suspension.
  2. Take 1 x 106 bacteria in 100 μL of endotoxin-free PBS and immunize a female C57BL/6 mice (I-Ab, H-2Kb, 5-6 week old) subcutaneously in the scruff of the neck.
    1. Inject control mice with 100 μL of PBS alone.
  3. Euthanize immunized mice 20 days post-immunization by CO2 inhalation followed by cervical dislocation.
    1. Isolate the spleen and transfer it into RPMI media.
  4. Mash spleen through a 70 µm cell strainer with a 5 mL syringe plunger.
    1. Wash with 5 mL of RPMI. Centrifuge (800 x g, 3 min) to isolate a single cell suspension.
    2. Deplete RBC with mouse biotin positive selection kit with biotin-Ter119/Erythroid cells Ab.
    3. Centrifuge and re-suspend cells in 10 mL of complete RPMI (10% FCS, 1% L-glutamine, 1% penicillin, 1% streptomycin, and 50 μM 2-ME).

10. I-Ab tetramer Staining to Determine the Frequencies of Antigen-Specific CD4+ T Cells and Intracellular Cytokine Staining to Determine Frequencies of Antigen-Specific T Cells Releasing Cytokines in Immunized Animals

  1. Tetramer Staining
    1. Stain splenocytes from control and immunized mice (~20 x 106 cells) with PE-conjugated I-Ab-OVA323-339 tetramers (1/12.5 dilution) for 1 h at 37 °C in binding buffer (PBS with 2% FCS and 0.1% NaN3).
    2. Add AF647 CD4 Ab (1:25) and 7-AAD (to detect dead cells) to splenocytes for 20 min at room temperature.
    3. Analyze samples by flow cytometry.
    4. Acquire 500,000 events in the CD4 positive region to determine the frequency of tetramer positive events.
      NOTE: Total splenocytes are defined by the SSC/FSC dot blot, live cells by exclusion of the 7-AAD positive events, and CD4 subsets by gating AF647 positive events.
  2. Frequency of Antigen Specific Intracellular Cytokine Releasing T Cells
    1. Transfer approximately 1 × 107 splenocytes into 4 mL of complete RPMI medium in six-well plates with or without recombinant OVA (10 µg/mL) and incubate for 16 h.
    2. Treat cells with Brefeldin A (1:1,000) for an additional 5 h.
    3. Wash with PBS and subject to intracellular cytokine staining as follows:
      1. Stain cell samples with PE-CD8 or PE-Cy7-CD4 Ab (1:50 in binding buffer) in room temperature for 30 min.
      2. Fix in 4% PFA at room temperature for 20 min.
      3. Permeabilize using permeabilization solution, according to the manufacturer's instructions.
      4. Wash cells and label with AF647-conjugated IFN-γ Ab (1:50) for 20 min at room temperature.
      5. Wash cells and subject to flow cytometry analysis as described above.

Access restricted. Please log in or start a trial to view this content.

Results

With the general procedures described above, the feasibility of BCG surface biotinylation and decoration with surrogate antigen OVA was examined. The immunogenicity of the modified BCG was then tested in vivo. The bacterial surface was easily labeled with biotin for rapid display of avidin chimeric antigens without any detectable changes in bacterial phenotypes. The resulting modified BCG is efficiently ingested by antigen presentation cells and can induce an OVA-specific immune ...

Access restricted. Please log in or start a trial to view this content.

Discussion

We reported in this study a non-genetic approach for rapid and effective display of exogenous proteins on BCG surface to add either specific antigens or specific functional properties expected to efficiently improve the bacterium's immunogenicity. We demonstrated that the BCG cell surface could be easily biotinylated for instantaneous surface decoration with avidin fusion proteins. The total procedure can be performed within 2 h, while genetic transformation and selection of positive clones requires 2 to 3 months of ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank Dr. R Stokes for the BCG Pasteur strain and A. Talal for technical support. We also thank GenScript for help with gene synthesis.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Endotoxin-free RPMI 1640StemCell Technologies 36750
Sulfo-NHS SS biotinThermo Fisher 21328
FITC-conjugated streptavidinSigma-AldrichS3762
Phycoerythrin (PE)-conjugated I-Ab-OVA323-339 tetramer MBL International TS-M710-1
7-AADBD Pharmingen559925
TALON polyhistidine-Tag purification resin Clontech635501
Alexa Fluor (AF) 647 conjugated rat anti-mouse CD4BD Bioscience 557681
AF647 rat anti-mouse IFN-gBD Bioscience 557735
AF647 rat anti-mouse I-A/I-EBD Bioscience 562367
PeCy7 rat anti-mouse CD4BD Bioscience 552775
PE rat anti-mouse CD8 AbBD Bioscience 561095
AF 647 rat anti-mouse H-2kbBD Bioscience562832
FITC-conjugated goat anti rabbit antibodyThermo Fisher31635
AF 647 rat anti-mouse CD4BD Bioscience 557681
Ultra-small gold-conjugated goat anti-rabbit IgGElectron Microscopy Sciences25100
Middlebrook 7H9 brothBD Diagnostic Systems271310
OADCBD Diagnostic SystemsB11886
Tween 80Sigma-AldrichP1379
RAW 264.7 murine macrophage cell linesAmerican Type Culture Collection
pDEST17 plasmid Invitrogen11803012
pUC57-OVA plasmid GenScriptSD1176
BP clonase Invitrogen11789020
LR clonase Invitrogen11791043
pDONR221 plasmidInvitrogen12536017
Ni-NTA columns Qiagen31014
Pierce protein concentrators Thermo Fisher 88527
FlurosaveCalbiochem-Novabiochem345789
Axioplan II epifluorescence microscopeCarl Zeiss Inc
CCD digital camera Retiga EX, QImaging
Tecnai G2 200kV electron microscope FEI CompanyG2 200Kv 
70μm Falcon cell strainer Thermo Fisher 87712
EasyStep mouse biotin positive selection kit StemCell18556
biotin-Ter119/Ertyroid cells antibodyBioLegend116203
Brefeldin ABD Pharmingen555029
Cytofix/Cytoperm kit BD Pharmingen554714
Bright-Glo Luciferase assay systemPromegae2620
Turner Biosystem luminometer PromegaTD-20/20
Leica EM UC6 microtome Leica MicrosystemsUC6
Novalyphe NL 500 freeze dryerSavant Instruments NL 50
Wheaton boroscilicate glass vialsWheaton VWR 66011-675

References

  1. Horwitz, M. A., Harth, G. A new vaccine against tuberculosis affords greater survival after challenge than the current vaccine in the guinea pig model of pulmonary tuberculosis. Infect. Immun. 71 (4), 1672-1679 (2003).
  2. Pym, A. S., et al. Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis. Nat Med. 9 (5), 548-553 (2003).
  3. Grode, L., et al. Increased vaccine efficacy against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin mutants that secrete listeriolysin. The J Clin Invest. 115 (9), 2472-2479 (2005).
  4. Bastos, R. G., Borsuk, S., Seixas, F. K., Dellagostin, O. A. Recombinant Mycobacterium bovis BCG. Vaccine. 27 (47), 6495-6503 (2009).
  5. Mederle, I., et al. Plasmidic versus insertional cloning of heterologous genes in Mycobacterium bovis BCG: impact on in vivo antigen persistence and immune responses. Infect Immun. 70 (1), 303-314 (2002).
  6. Singh, N. P., et al. A Novel Approach to Cancer Immunotherapy Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity A Novel Approach to Cancer Immunotherapy Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity. Cancer Res. 63 (14), 4067-4073 (2003).
  7. Oizumi, S., Strbo, N., Pahwa, S., Deyev, V., Podack, E. R. Molecular and cellular requirements for enhanced antigen cross-presentation to CD8 cytotoxic T lymphocytes. J Immunol. 179 (4), 2310-2317 (2007).
  8. Sharif-Paghaleh, E., et al. Monitoring the efficacy of dendritic cell vaccination by early detection of (99m) Tc-HMPAO-labelled CD4(+) T cells. Eur J Immunol. 44 (7), 2188-2191 (2014).
  9. Sun, J., et al. A broad-range of recombination cloning vectors in mycobacteria. Plasmid. 62 (3), 158-165 (2009).
  10. Laitinen, O. H., et al. Rational design of an active avidin monomer. J. Biol. Chem. 278 (6), 4010-4014 (2003).
  11. Flynn, J. L., Chan, J., Triebold, K. J., Dalton, D. K., Stewart, T. A., Bloom, B. R. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J Exp Med. 178 (6), 2249-2254 (1993).
  12. Liao, T. Y. A., Lau, A., Joseph, S., Hytonen, V., Hmama, Z. Improving the immunogenicity of the Mycobacterium bovis BCG vaccine by non-genetic bacterial surface decoration using the avidin-biotin system. PLoS ONE. 10 (12), e0145833(2015).
  13. Green, N. M. Avidin and streptavidin. Methods Enzymol. 184, 51-67 (1990).
  14. Howarth, M., Takao, K., Hayashi, Y., Ting, A. Y. Targeting quantum dots to surface proteins in living cells with biotin ligase. PNAS. 102 (21), 7583-7588 (2005).
  15. Lesch, H. P., Kaikkonen, M. U., Pikkarainen, J. T., Yla-Herttuala, S. Avidin-biotin technology in targeted therapy. Expert Opin Drug Deliv. 7 (5), 551-564 (2010).
  16. Paganelli, G., Bartolomei, M., Grana, C., Ferrari, M., Rocca, P., Chinol, M. Radioimmunotherapy of brain tumor. Neurol Res. 28 (5), 518-522 (2006).
  17. Cummings, J. F., et al. Safety and immunogenicity of a plant-produced recombinant monomer hemagglutinin-based influenza vaccine derived from influenza A (H1N1)pdm09 virus: a Phase 1 dose-escalation study in healthy adults. Vaccine. 32 (19), 2251-2259 (2014).
  18. Kolotilin, I., et al. Plant-based solutions for veterinary immunotherapeutics and prophylactics. Vet Res. 45, 114-117 (2014).
  19. Demonte, D., Drake, E. J., Lim, K. H., Gulick, A. M., Park, S. Structure-based engineering of streptavidin monomer with a reduced biotin dissociation rate. Proteins. 81 (9), 1621-1633 (2013).
  20. Deghmane, A. E., et al. Lipoamide dehydrogenase mediates retention of coronin-1 on BCG vacuoles, leading to arrest in phagosome maturation. J Cell Sci. 120 (19), 3489-3489 (2007).
  21. Soualhine, H., et al. Mycobacterium bovis bacillus Calmette-Guerin secreting active cathepsin S stimulates expression of mature MHC class II molecules and antigen presentation in human macrophages. J Immunol. 179 (8), 5137-5145 (2007).
  22. Bubb, M. O., Green, F., Conradie, J. D., Tchernyshev, B., Bayer, E. A., Wilchek, M. Natural antibodies to avidin in human serum. ImmunolLett. 35 (3), 277-280 (1993).
  23. Petronzelli, F., et al. Therapeutic use of avidin is not hampered by antiavidin antibodies in humans. Cancer Biother Radiopharm. 25 (5), 563-570 (2010).
  24. Bigini, P., et al. In vivo fate of avidin-nucleic acid nanoassemblies as multifunctional diagnostic tools. ACS Nano. 8 (1), 175-187 (2014).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Protein ExpressionFlow CytometryImmunogenicityT Cell ResponseAntigen PresentationMHC MoleculesPhagocytosis Assay