Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
* These authors contributed equally
Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.
Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection (TAAD). However, human TAAD sometimes cannot be characterized by animal models. There is an apparent species gap between clinical human studies and animal experiments that may hinder the discovery of therapeutic drugs. In contrast, the conventional cell culture model is unable to simulate in vivo biomechanical stimuli. To this end, microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that replicate the biomechanical microenvironment. In this study, a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model was developed to simulate the pathophysiological parameters of aortic biomechanics, including the amplitude and frequency of cyclic strain experienced by human aortic smooth muscle cells (HASMCs) that play a vital role in TAAD. In this model, the morphology of HASMCs became elongated in shape, aligned perpendicularly to the strain direction, and presented a more contractile phenotype under strain conditions than under static conventional conditions. This was consistent with the cell orientation and phenotype in native human aortic walls. Additionally, using bicuspid aortic valve-related TAAD (BAV-TAAD) and tricuspid aortic valve-related TAAD (TAV-TAAD) patient-derived primary HASMCs, we established BAV-TAAD and TAV-TAAD disease models, which replicate HASMC characteristics in TAAD. The HASMC-OOC model provides a novel in vitro platform that is complementary to animal models for further exploring the pathogenesis of TAAD and discovering therapeutic targets.
Thoracic aortic aneurysm and dissection (TAAD) is a localized dilatation or delamination of the aortic wall that is associated with high morbidity and mortality1. Human aortic smooth muscle cells (HASMCs) play a vital role in the pathogenesis of TAAD. HASMCs are not terminally differentiated cells, and HASMCs retain high plasticity, allowing them to switch phenotypes in response to different stimuli2. HASMCs are mainly subjected to rhythmic tensile strain in vivo, and this is one of the key factors regulating smooth muscle morphological changes, differentiation and physiological functions3,4. Therefore, the role of cyclic strain in the study of HASMCs cannot be ignored. However, conventional 2D cell cultures cannot replicate the biomechanical stimulation of cyclic strain experienced by HASMCs in vivo. Additionally, the construction of an animal TAAD model is not suitable for some types of TAAD, such as bicuspid aortic valve (BAV)-related TAAD. Moreover, the species gap between clinical human studies and animal experiments cannot be ignored. It hinders pharmaceutical translation in clinical practice. Thus, there is an urgent need for more complex and physiological systems to simulate the in vivo biomechanical environment in the research of aortic diseases.
Animal experiments used in biomedical research and drug development are costly, time-consuming, and ethically questionable. In addition, the results from animal studies frequently fail to predict the results obtained in human clinical trials5,6. The lack of human preclinical models and high failure rate in clinical trials have resulted in few effective drugs for the clinic, which has increased health care costs7. Thus, it is urgent to find other experimental models to complement animal models. Microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that remedy the drawbacks of traditional 2D cell culture techniques and establish a more realistic, low-cost, and efficient in vitro model for physiological studies and drug development. Using microfluidic devices, organs-on-chips are established to culture living cells in micrometer-sized chambers with different stimuli to replicate the key functions of a tissue or organ. The system consists of single or multiple microfluidic microchannels, with either one kind of cell cultured in a perfused chamber replicating functions of one tissue type or different cell types cultured on porous membranes to recreate interfaces between different tissues. Microfluidic-based organoids combined with patient-derived cells have the unique advantage of bridging the large species difference between mouse and human disease models and overcoming the disadvantages of traditional 2D cell culture for disease mechanism research and drug discovery. With the rapid development of microfluidics in the past few years, researchers have realized the usefulness of in vitro organ-on-a-chip (OOC) models replicating complex in vivo biological parameters8. These microfluidic organoids simulate in vitro biomechanical environments, such as cyclic strain, shear stress, and liquid pressure, providing a three-dimensional (3D) cell culture environment. To date, several OOC models have been established to simulate biomechanical stimuli in organs such as the lung9, kidney10, liver11, intestine12, and heart13, but these have not been widely applied to the study of human aortic disease.
In this study, we present a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model that can control the biomimetic mechanical forces and rhythms applied to TAAD patient-derived primary HASMCs. The chip consists of three-layered thick plates of polydimethylsiloxane (PDMS) etched with channels and two commercialized highly flexible PDMS membranes. HASMCs are cultured on the PDMS membranes. The channel in the middle of the chip is filled with a culture medium for cell culture. The top and bottom channels of the chip are connected to a vacuum pressure supply system that can control the rhythm and frequency of mechanical tensile strain of the PDMS membranes. Rhythmic strain experienced by HASMCs can be simulated in HASMC-OOC, replicating the biomechanical microenvironment of tissue or organ not functionally achievable with conventional 2D culture systems. With the advantage of high-resolution, real-time imaging, and biomechanical microenvironment, the biochemical, genetic and metabolic activities of living cells can be studied for tissue development, organ physiology, disease etiology, molecular mechanisms and biomarker identification ,cardiovascular disease and aortic disease. Combined with tissue-specific and patient cells, this system can be used for drug screening, personalized medicine, and toxicity testing. This HASMC-OOC model provides a novel in vitro platform for studying the pathogenesis of the aortic disease.
Access restricted. Please log in or start a trial to view this content.
Human aortic specimens were utilized for primary HASMC isolation under the approval of Zhongshan Hospital, Fudan University Ethics Committee (NO. B2020-158). Aortic specimens were collected from patients who underwent ascending aorta surgery at Zhongshan Hospital, Fudan University. Written informed consent was obtained from all patients before participation.
1. Primary human aortic smooth muscle cell isolation
2. Preparation of PDMS chip
3. PDMS chip surface treatment and sterilization
4. Cell seeding on the PDMS chip and cell stretching process
5. Preparation of the mechanical control system
Access restricted. Please log in or start a trial to view this content.
The HASMC-OOC model consists of a vacuum control system, a circulating system, and PDMS chips, and the schematic design of the HASMC-OOC model (Figure 1). The vacuum control system consists of a vacuum pump, solenoid valves, and a PLC controller. To act as the circulating system, a peristaltic pump was used to refresh the cell culture medium and add drugs. The PDMS chip was composed of two vacuum chambers and a middle chamber filled with SMCM for cell growth. According to the design of the c...
Access restricted. Please log in or start a trial to view this content.
With the rapid development of microfluidic technology, OOC models that can replicate the biological function and structure of one or more organs in vitro have emerged in recent years for applications in biology, medicine, and pharmacology15. OOC can simulate key functions of the human physiological microenvironment, essential for exploring disease mechanisms and promoting preclinical drug translation8,16. Although OOC is still in ...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
The authors acknowledge that this work was supported by grants from the Science and Technology Commission of Shanghai Municipality (20ZR1411700), the National Natural Science Foundation of China (81771971), and Shanghai Sailing Program (22YF1406600).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 4% paraformaldehyde | Beyotime | P0099-100ml | Used for cell immobilization |
| Alexa Fluor 350-labeled Goat Anti-Rabbit IgG | Beyotime | A0408 | Antibodies used for immunostaining |
| Bovine serum albumin | Beyotime | ST025-20g | |
| Calcium AM/PI | Invitrogen | L3224 | |
| Cell culture flask | Corning | 430639 | |
| CNN1 | Abcam | Ab46794 | |
| Commercial flexible PDMS membrane | Hangzhou Bald Advanced Materials | KYQ-200 | |
| F-actin | Invitrogen | R415 | |
| FBS | Sigma | M8318 | |
| Hoses | Runze Fluid | 96410 | 1 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com |
| Human aortic smooth muscle cell line CRL1999 | ATCC | Lot Number:70019189 | |
| Image J | Imagej.net/fiji/downloads | Free Download: https://fiji.sc | Imaging platform that is used to identify fluorescence intensity |
| Incubator | Thermo Fisher Scientific | Ensures that the temperature, humidity, and light exposure is exactly the same throughout experiment. | |
| Luer | Runze Fluid | RH-M016 | Official website address: https://www.runzefluidsystem.com. |
| Microscope | Olympus | ||
| mouse collagen | Sigma | C7661 | |
| Oxygen plasma | Changzhou Hongming Instrument | HM-Plasma5L | |
| Pasteur pipette | Biologix | 30-0138A1 | |
| PBS | Beyotime | C0221A | |
| Pen-Strep | Sigma | P4458-100ml | Antibiodics used to prevent bacterial contamination of cells during culture. |
| peristaltic pump | Kamoer | F01A-STP-B046 | |
| Petri dish | Corning | 430167 | |
| PLC controller | Zhejiang Jun Teng (BenT) CNC factory | BR010-11T8X2M | The detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net |
| polydimethylsiloxane (PDMS) | Dow Corning | Sylgard 184 | |
| SM22 | Abcam | ab14106 | |
| SMCM | ScienCell | Cat 1101 | |
| solenoid valve | SMC (China) | VQZ300 | |
| Syringe | Becton,Dickinson and Company | 300841 | |
| Triton-X 100 | Beyotime | ST795 | To penetrate cell membranes |
| Trizol | Invitrogen | 10296010 | Used for RNA extraction |
| trypsin | Sigma | 15400054 | |
| vacuum filter | SMC (China) | ZFC5-6 | Official website address: https://www.smc.com.cn |
| vacuum pump | Kamoer | KVP15-KL-S | |
| vacuum regulator | AirTAC | GVR-200-06 | |
| Primers | |||
| Primer Name | Forward (5’ to 3’) | Reverse (5’ to 3’) | |
| SM22 | CCGTGGAGATCCCAACTGG | CCATCTGAAGGCCAATGACAT | |
| CNN1 | CTCCATTGACTCGAACGACTC | CAGGTCTGCGAAACTTCTTAGA |
Access restricted. Please log in or start a trial to view this content.