A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

3.2K views

DOI:

10.3791/64122

July 6th, 2022

* These authors contributed equally

In This Article

Summary

Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.

Abstract

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection (TAAD). However, human TAAD sometimes cannot be characterized by animal models. There is an apparent species gap between clinical human studies and animal experiments that may hinder the discovery of therapeutic drugs. In contrast, the conventional cell culture model is unable to simulate in vivo biomechanical stimuli. To this end, microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that replicate the biomechanical microenvironment. In this study, a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model was developed to simulate the pathophysiological parameters of aortic biomechanics, including the amplitude and frequency of cyclic strain experienced by human aortic smooth muscle cells (HASMCs) that play a vital role in TAAD. In this model, the morphology of HASMCs became elongated in shape, aligned perpendicularly to the strain direction, and presented a more contractile phenotype under strain conditions than under static conventional conditions. This was consistent with the cell orientation and phenotype in native human aortic walls. Additionally, using bicuspid aortic valve-related TAAD (BAV-TAAD) and tricuspid aortic valve-related TAAD (TAV-TAAD) patient-derived primary HASMCs, we established BAV-TAAD and TAV-TAAD disease models, which replicate HASMC characteristics in TAAD. The HASMC-OOC model provides a novel in vitro platform that is complementary to animal models for further exploring the pathogenesis of TAAD and discovering therapeutic targets.

Introduction

Thoracic aortic aneurysm and dissection (TAAD) is a localized dilatation or delamination of the aortic wall that is associated with high morbidity and mortality1. Human aortic smooth muscle cells (HASMCs) play a vital role in the pathogenesis of TAAD. HASMCs are not terminally differentiated cells, and HASMCs retain high plasticity, allowing them to switch phenotypes in response to different stimuli2. HASMCs are mainly subjected to rhythmic tensile strain in vivo, and this is one of the key factors regulating smooth muscle morphological changes, differentiation and physiological functions3,4. Therefore, the role of cyclic strain in the study of HASMCs cannot be ignored. However, conventional 2D cell cultures cannot replicate the biomechanical stimulation of cyclic strain experienced by HASMCs in vivo. Additionally, the construction of an animal TAAD model is not suitable for some types of TAAD, such as bicuspid aortic valve (BAV)-related TAAD. Moreover, the species gap between clinical human studies and animal experiments cannot be ignored. It hinders pharmaceutical translation in clinical practice. Thus, there is an urgent need for more complex and physiological systems to simulate the in vivo biomechanical environment in the research of aortic diseases.

Animal experiments used in biomedical research and drug development are costly, time-consuming, and ethically questionable. In addition, the results from animal studies frequently fail to predict the results obtained in human clinical trials5,6. The lack of human preclinical models and high failure rate in clinical trials have resulted in few effective drugs for the clinic, which has increased health care costs7. Thus, it is urgent to find other experimental models to complement animal models. Microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that remedy the drawbacks of traditional 2D cell culture techniques and establish a more realistic, low-cost, and efficient in vitro model for physiological studies and drug development. Using microfluidic devices, organs-on-chips are established to culture living cells in micrometer-sized chambers with different stimuli to replicate the key functions of a tissue or organ. The system consists of single or multiple microfluidic microchannels, with either one kind of cell cultured in a perfused chamber replicating functions of one tissue type or different cell types cultured on porous membranes to recreate interfaces between different tissues. Microfluidic-based organoids combined with patient-derived cells have the unique advantage of bridging the large species difference between mouse and human disease models and overcoming the disadvantages of traditional 2D cell culture for disease mechanism research and drug discovery. With the rapid development of microfluidics in the past few years, researchers have realized the usefulness of in vitro organ-on-a-chip (OOC) models replicating complex in vivo biological parameters8. These microfluidic organoids simulate in vitro biomechanical environments, such as cyclic strain, shear stress, and liquid pressure, providing a three-dimensional (3D) cell culture environment. To date, several OOC models have been established to simulate biomechanical stimuli in organs such as the lung9, kidney10, liver11, intestine12, and heart13, but these have not been widely applied to the study of human aortic disease.

In this study, we present a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model that can control the biomimetic mechanical forces and rhythms applied to TAAD patient-derived primary HASMCs. The chip consists of three-layered thick plates of polydimethylsiloxane (PDMS) etched with channels and two commercialized highly flexible PDMS membranes. HASMCs are cultured on the PDMS membranes. The channel in the middle of the chip is filled with a culture medium for cell culture. The top and bottom channels of the chip are connected to a vacuum pressure supply system that can control the rhythm and frequency of mechanical tensile strain of the PDMS membranes. Rhythmic strain experienced by HASMCs can be simulated in HASMC-OOC, replicating the biomechanical microenvironment of tissue or organ not functionally achievable with conventional 2D culture systems. With the advantage of high-resolution, real-time imaging, and biomechanical microenvironment, the biochemical, genetic and metabolic activities of living cells can be studied for tissue development, organ physiology, disease etiology, molecular mechanisms and biomarker identification ,cardiovascular disease and aortic disease. Combined with tissue-specific and patient cells, this system can be used for drug screening, personalized medicine, and toxicity testing. This HASMC-OOC model provides a novel in vitro platform for studying the pathogenesis of the aortic disease.

Access restricted. Please log in or start a trial to view this content.

Protocol

Human aortic specimens were utilized for primary HASMC isolation under the approval of Zhongshan Hospital, Fudan University Ethics Committee (NO. B2020-158). Aortic specimens were collected from patients who underwent ascending aorta surgery at Zhongshan Hospital, Fudan University. Written informed consent was obtained from all patients before participation.

1. Primary human aortic smooth muscle cell isolation

  1. Wash the right lateral region of the ascending aorta with sterile PBS, 1x-2x.
  2. Remove the intima and adventitia layers of the tissue with two ophthalmic forceps and retain the media layer to harvest the cells.
  3. Place the media layer onto a 10 cm culture dish and cut it into small pieces (2-3 mm) with scissors. Add 5 mL of smooth muscle cell culture medium (SMCM) containing 10% FBS and 1% penicillin-streptomycin.
  4. Move the small tissue into the culture bottle with a sterile dropper, spreading the tissue evenly. Discard the culture medium as much as possible, then invert the bottle upside down.
  5. Add 2 mL of SMCM into the inverted culture bottle and place it in the incubator (5% CO2) at 37 °C for 1-2 h, then slowly turn it right side up and add another 2 mL of SMCM.
  6. After 5-7 days of incubation, exchange the SMCM with 4 mL of fresh SMCM. Generally, sporadic smooth muscle cells climb out in approximately 2 weeks.
  7. Slowly discard the SMCM and add it slowly when changing the medium. Transport the culture bottle slowly when moving to a microscope station; otherwise, the tissues will float, and the cells will grow slowly.
  8. When the cells reach approximately 80% confluency, wash with 2 mL of PBS, digest with 2 mL of 0.25% trypsin, and divide them into two new culture bottles with 4 mL of fresh SMCM.
  9. Identify the cells through an immunofluorescence analysis of four different specific markers for smooth muscle cells (CNN1, SM22)14.

2. Preparation of PDMS chip

  1. To polymerize PDMS, add curing agent (B component) to base (A component) at a weight ratio of A: B = 10:1 w/w and mix the complex completely for 5 min; the volume depends on the need of the study.
  2. Place the prepared PDMS gel in a vacuum extraction tank for 30-60 min and maintain the pressure below -0.8 mPa.
    NOTE: High pressure will lead to insufficient extraction of small bubbles inside the PDMS gel that will affect the next step of chip fabrication.
  3. Using computer-aided design (CAD) software, design the mold with a 100 mm × 40 mm × 8 mm external frame structure and a 70 mm × 6 mm × 4 mm channel.
  4. Custom make the molds of the three layers using a high-precision computer numerical control engraving machine. Carve out the frame of the molds and the microchannels using polymethyl methacrylate (PMMA) plates, and then glue them onto another PMMA plate.
  5. Pour the prepared PDMS gel onto a mold with a 100 mm × 40 mm × 6 mm outer frame and 70 mm × 6 mm × 4 mm channel, and then cross-link at 70 °C for 1-2 h.
  6. Peel off the cross-linked PDMS slabs from the mold and cut the commercialized PDMS membranes into 100 mm × 40 mm sections.
  7. Treat the three prepared PDMS slabs and two PDMS membranes with oxygen plasma for 5 min for PDMS surface activation. Apply the following specific settings: room air as the process gas; pressure set to -100 kPa; current set to 180--200 Ma; voltage set to 200 V; process time to 5 min.
  8. Punch holes on the three PDMS slabs using a 1 mm hole puncher to make the inlet and outlet of air and medium microchannels on the PDMS chip.
  9. Bond three PDMS slabs and two PDMS membranes together in the order: air channel PDMS slab (top layer) - PDMS membrane - medium channel PDMS slab (middle layer) - PDMS membrane- air channel PDMS slab (bottom layer). Perform this step under a stereoscopic microscope at 4x to fully overlap the air microchannels with the medium microchannels.
  10. Place the assembled PDMS chip in a 70 °C incubator for 1 h.
  11. Prepare several 1 mm inner diameter and 3 cm length latex hoses. Insert a 1 mm outer diameter and 1 cm long stainless-steel needle into one end of the prepared hose, and then insert a Luer into the other end of the hose to create the tube connected to the air and medium microchannels of the PDMS chip.
  12. Insert the prepared tubes into the outlets and inlets of the air and medium microchannels on the PDMS chip.

3. PDMS chip surface treatment and sterilization

  1. Infuse 2 mL of 80 mg/mL mouse collagen into the medium microchannel of the PDMS chip using a 2 mL syringe and incubate at room temperature for 30 min.
  2. After incubation, remove the collagen from the channel and recollect with a 2 mL syringe. Place the collagen-coated PDMS chips in a 60 °C incubator overnight.
  3. Place the PDMS chips in a UV sterilizer for more than 1 h. Place the sterilized PDMS chips on an ultraclean bench in preparation for the cell experiment.

4. Cell seeding on the PDMS chip and cell stretching process

  1. Culture 4 x 105 primary human smooth muscle cells (HASMCs) from patients using smooth muscle cell medium (SMCM) containing 2% fetal bovine serum (FBS) and 1% penicillin-streptomycin in an 5% CO2 incubator at 37 °C.
  2. When the HASMC density reaches 80%, discard the SMCM and wash the cells with 2 mL of PBS.
  3. Digest the cells using 1 mL of 0.25% trypsin for 2 min and centrifuge at 100 x g for 5 min. Remove the supernatant and resuspend the cell pellet in 1 mL of fresh SMCM. Use 8 mL of SMCM to culture the cells on a 10 cm culture dish.
  4. Calculate the cell number using a cytometer and use the cells at a final concentration of 2 x 105 cells/mL.
  5. Slowly pour 2 mL of PBS into the collagen-coated and sterilized PDMS chip medium microchannel and later discard using a 2 mL syringe.
  6. Slowly pour a total of 2 mL of 2 x 105 cells/mL HASMC suspension into the medium microchannel of the PDMS chip using a 2 mL syringe. Then, close the Luer at the entrance and exit of the PDMS chip. Place the PDMS chip in an incubator (5% CO2) at 37 °C for 1 day.
  7. After the cells are attached to the PDMS membrane in the PDMS chip, nearly after 24 h, connect the outlet of the air microchannel on the PDMS chip to the vacuum controller system. When the cell is attached, an elongated, normal cellular form can be seen under the microscope, contrasting with the suspended round cells.
  8. Turn on the solenoid valve and the vacuum pump. Open the vacuum regulator and adjust the pressure level to 10 kPa for 7.18 ± 0.44% strain and 15 kPa for 17.28 ± 0.91% strain.
  9. After the parameters of the control system are set, place the PDMS chips in an incubator (5% CO2) at 37 °C and stretch for 24 h.

5. Preparation of the mechanical control system

  1. Prepare several solenoid valves, vacuum filters, vacuum regulators, a vacuum pump, a peristaltic pump, and a programmable logic controller (PLC) controlling the solenoid valve.
  2. Program the PLC controller and set the on/off time interval to 1 Hz. Connect the solenoid valves to the programmed controller.
  3. Connect the inlet of the vacuum pump to the vacuum filters, and then connect the outlet of the vacuum filters to the vacuum regulators. Connect the outlet of the vacuum regulators to solenoid valves, and finally, connect the outlet of the solenoid valves to the outlets of the air microchannels of the PDMS chips.
  4. Connect the outlet of the peristaltic pump to the inlet of the medium microchannel of the PDMS chip and the inlet of the peristaltic pump to the outlet of the medium microchannel PDMS chip for culture medium replacement and drug handling.
  5. Adjust the amplitude of the strain by the regulator and the strain frequency by the microcontroller.

Access restricted. Please log in or start a trial to view this content.

Results

The HASMC-OOC model consists of a vacuum control system, a circulating system, and PDMS chips, and the schematic design of the HASMC-OOC model (Figure 1). The vacuum control system consists of a vacuum pump, solenoid valves, and a PLC controller. To act as the circulating system, a peristaltic pump was used to refresh the cell culture medium and add drugs. The PDMS chip was composed of two vacuum chambers and a middle chamber filled with SMCM for cell growth. According to the design of the c...

Access restricted. Please log in or start a trial to view this content.

Discussion

With the rapid development of microfluidic technology, OOC models that can replicate the biological function and structure of one or more organs in vitro have emerged in recent years for applications in biology, medicine, and pharmacology15. OOC can simulate key functions of the human physiological microenvironment, essential for exploring disease mechanisms and promoting preclinical drug translation8,16. Although OOC is still in ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors acknowledge that this work was supported by grants from the Science and Technology Commission of Shanghai Municipality (20ZR1411700), the National Natural Science Foundation of China (81771971), and Shanghai Sailing Program (22YF1406600).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
4% paraformaldehydeBeyotimeP0099-100mlUsed for cell immobilization
Alexa Fluor 350-labeled Goat Anti-Rabbit IgGBeyotimeA0408Antibodies used for immunostaining
Bovine serum albuminBeyotimeST025-20g
Calcium AM/PIInvitrogenL3224
Cell culture flask Corning430639
CNN1Abcam Ab46794
Commercial flexible
PDMS membrane
Hangzhou Bald Advanced MaterialsKYQ-200
F-actinInvitrogenR415
FBSSigmaM8318
HosesRunze Fluid964101 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com
Human aortic smooth
muscle cell line CRL1999
ATCCLot Number:70019189
Image JImagej.net/fiji/downloadsFree Download: https://fiji.scImaging platform that is used to identify fluorescence intensity
IncubatorThermo Fisher ScientificEnsures that the temperature,
humidity, and light exposure is
exactly the same throughout
experiment.
LuerRunze FluidRH-M016Official website address: https://www.runzefluidsystem.com.
MicroscopeOlympus
mouse collagenSigmaC7661
Oxygen plasma Changzhou Hongming InstrumentHM-Plasma5L
Pasteur pipetteBiologix30-0138A1
PBSBeyotimeC0221A
Pen-StrepSigmaP4458-100mlAntibiodics used to prevent bacterial
contamination of cells during culture.
peristaltic pumpKamoerF01A-STP-B046
Petri dishCorning430167
PLC controllerZhejiang Jun Teng (BenT) CNC factoryBR010-11T8X2MThe detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net
polydimethylsiloxane (PDMS)Dow CorningSylgard 184
SM22Abcam ab14106
SMCMScienCellCat 1101
solenoid valveSMC (China)VQZ300
SyringeBecton,Dickinson and Company300841
Triton-X 100BeyotimeST795To penetrate cell membranes
TrizolInvitrogen10296010Used for RNA extraction
trypsinSigma15400054
vacuum filterSMC (China)ZFC5-6Official website address: https://www.smc.com.cn
vacuum pumpKamoerKVP15-KL-S
vacuum regulatorAirTACGVR-200-06
Primers
Primer NameForward (5’ to 3’)Reverse (5’ to 3’)
SM22CCGTGGAGATCCCAACTGGCCATCTGAAGGCCAATGACAT
CNN1CTCCATTGACTCGAACGACTCCAGGTCTGCGAAACTTCTTAGA

References

  1. Olsson, C., Thelin, S., Ståhle, E., Ekbom, A., Granath, F. Thoracic aortic aneurysm and dissection: increasing prevalence and improved outcomes reported in a nationwide population-based study of more than 14,000 cases from 1987 to 2002. Circulation. 114 (24), 2611-2618 (2006).
  2. van Varik, B. J., et al. Mechanisms of arterial remodeling: lessons from genetic diseases. Frontiers in Genetics. 3 (290), 1-10 (2012).
  3. Halka, A. T., et al. The effects of stretch on vascular smooth muscle cell phenotype in vitro. Cardiovascular Pathology. 17 (2), 98-102 (2008).
  4. Wang, Y., et al. Arterial wall stress induces phenotypic switching of arterial smooth muscle cells in vascular remodeling by activating the YAP/TAZ signaling pathway. Cellular Physiology and Biochemistry. 51 (2), 842-853 (2018).
  5. Fabre, K., et al. Introduction to a manuscript series on the characterization and use of microphysiological systems (MPS) in pharmaceutical safety and ADME applications. Lab on a Chip. 20, 1049-1057 (2020).
  6. Golding, H., Khurana, S., Zaitseva, M. What is the predictive value of animal models for vaccine efficacy in humans? The importance of bridging studies and species-independent correlates of protection. Cold Spring Harbor Perspectives in Biology. 10 (4), 028902(2018).
  7. Ingber, D. E. Human organs-on-chips for disease modelling, drug development and personalized medicine. Nature Reviews. Genetics. 25, 1-25 (2022).
  8. Niu, L., et al. Microfluidic chip for odontoblasts in vitro. ACS Biomaterials Science & Engineering. 5 (9), 4844-4851 (2019).
  9. Huh, D., et al. Reconstituting organ-level lung functions on a chip. Science. 328 (5986), 1662-1668 (2010).
  10. Musah, S., et al. Mature induced-pluripotent-stem-cell-derived human podocytes reconstitute kidney glomerular-capillary-wall function on a chip. Nature Biomedical Engineering. 1 (69), 1-25 (2017).
  11. Yoon No, D., Lee, K. H., Lee, J., Lee, S. H. 3D liver models on a microplatform: well-defined culture, engineering of liver tissue and liver-on-a-chip. Lab on a Chip. 15 (19), 3822-3837 (2015).
  12. Bein, A., et al. Microfluidic organ-on-a-chip models of human intestine. Cellular and Molecular Gastroenterology and Hepatology. 5 (4), 659-668 (2018).
  13. Jastrzebska, E., Tomecka, E., Jesion, I. Heart-on-a-chip based on stem cell biology. Biosensors & Bioelectronics. 75 (1), 67-81 (2016).
  14. Rensen, S. S., Doevendans, P. A., van Eys, G. J. Regulation and characteristics of vascular smooth muscle cell phenotypic diversity. Netherlands Heart Journal. 15 (3), 100-108 (2007).
  15. Perestrelo, A. R., Águas, A. C., Rainer, A., Forte, G. Microfluidic organ/body-on-a-chip devices at the convergence of biology and microengineering. Sensors. 15 (12), 31142-31170 (2015).
  16. Liu, Y., et al. Construction of cancer-on-a-chip for drug screening. Drug Discovery Today. 26 (8), 1875-1890 (2021).
  17. Yang, Q., et al. Design of organ-on-a-chip to improve cell capture efficiency. International Journal of Mechanical Sciences. 209, 106705(2021).
  18. Yang, Q., Lian, Q., Xu, F. Perspective: Fabrication of integrated organ-on-a-chip via bioprinting. Biomicrofluidics. 11 (3), 031301(2017).
  19. Mohammed, M. I., et al. Fabrication of microfluidic devices: improvement of surface quality of CO2 laser machined poly (methylmethacrylate) polymer. Journal of Micromechanics and Microengineering. 27 (1), 015021(2017).
  20. Tsao, C. W. Polymer microfluidics: Simple, low-cost fabrication process bridging academic lab research to commercialized production. Micromachines. 7 (12), 225-236 (2016).
  21. Kirschbaum, S. E., Baeumner, A. J. A review of electrochemiluminescence (ECL) in and for microfluidic analytical devices. Analytical and Bioanalytical Chemistry. 407 (14), 3911-3926 (2015).
  22. Stefanadis, C., et al. Pressure-diameter relation of the human aorta. A new method of determination by the application of a special ultrasonic dimension catheter. Circulation. 92 (8), 2210-2219 (1995).
  23. Williams, B. Mechanical influences on vascular smooth muscle cell function. Journal of Hypertension. 16 (12), 1921-1929 (1998).
  24. Abudupataer, M., et al. Aorta smooth muscle-on-a-chip reveals impaired mitochondrial dynamics as a therapeutic target for aortic aneurysm in bicuspid aortic valve disease. eLife. 10, 69310(2021).
  25. Poussin, C., et al. 3d human microvessel-on-a-chip model for studying monocyte-to-endothelium adhesion under flow - application in systems toxicology. Altex. 1, 47-63 (2020).
  26. Yasotharan, S., Pinto, S., Sled, J. G., Bolz, S., Gunther, A. Artery-on-a-chip platform for automated, multimodal assessment of cerebral blood vessel structure and function. Lab on a Chip. 15, 2660-2669 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Smooth Muscle CellsAortic Biomechanical StrainHuman Aorta ModelMicrofluidic TechniquesPDMS ChipCyclic StrainImmunofluorescence AnalysisCell MorphologyThoracic Aortic Aneurysm