Method Article

Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

DOI:

10.3791/64122

July 6th, 2022

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection (TAAD). However, human TAAD sometimes cannot be characterized by animal models. There is an apparent species gap between clinical human studies and animal experiments that may hinder the discovery of therapeutic drugs. In contrast, the conventional cell culture model is unable to simulate in vivo biomechanical stimuli. To this end, microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that replicate the biomechanical microenvironment. In this study, a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model was developed to simulate the pathophysiological parameters of aortic biomechanics, including the amplitude and frequency of cyclic strain experienced by human aortic smooth muscle cells (HASMCs) that play a vital role in TAAD. In this model, the morphology of HASMCs became elongated in shape, aligned perpendicularly to the strain direction, and presented a more contractile phenotype under strain conditions than under static conventional conditions. This was consistent with the cell orientation and phenotype in native human aortic walls. Additionally, using bicuspid aortic valve-related TAAD (BAV-TAAD) and tricuspid aortic valve-related TAAD (TAV-TAAD) patient-derived primary HASMCs, we established BAV-TAAD and TAV-TAAD disease models, which replicate HASMC characteristics in TAAD. The HASMC-OOC model provides a novel in vitro platform that is complementary to animal models for further exploring the pathogenesis of TAAD and discovering therapeutic targets.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Thoracic aortic aneurysm and dissection (TAAD) is a localized dilatation or delamination of the aortic wall that is associated with high morbidity and mortality1. Human aortic smooth muscle cells (HASMCs) play a vital role in the pathogenesis of TAAD. HASMCs are not terminally differentiated cells, and HASMCs retain high plasticity, allowing them to switch phenotypes in response to different stimuli2. HASMCs are mainly subjected to rhythmic tensile strain in vivo, and this is one of the key factors regulating smooth muscle morphological changes, differentiation and physiological functions3

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Human aortic specimens were utilized for primary HASMC isolation under the approval of Zhongshan Hospital, Fudan University Ethics Committee (NO. B2020-158). Aortic specimens were collected from patients who underwent ascending aorta surgery at Zhongshan Hospital, Fudan University. Written informed consent was obtained from all patients before participation.

1. Primary human aortic smooth muscle cell isolation

  1. Wash the right lateral region of the ascending aorta with sterile PBS, 1x-2x.
  2. Remove the intima and adventitia layers of the tissue with two ophthalmic forceps and retain the media layer to harve....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The HASMC-OOC model consists of a vacuum control system, a circulating system, and PDMS chips, and the schematic design of the HASMC-OOC model (Figure 1). The vacuum control system consists of a vacuum pump, solenoid valves, and a PLC controller. To act as the circulating system, a peristaltic pump was used to refresh the cell culture medium and add drugs. The PDMS chip was composed of two vacuum chambers and a middle chamber filled with SMCM for cell growth. According to the design of the c.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

With the rapid development of microfluidic technology, OOC models that can replicate the biological function and structure of one or more organs in vitro have emerged in recent years for applications in biology, medicine, and pharmacology15. OOC can simulate key functions of the human physiological microenvironment, essential for exploring disease mechanisms and promoting preclinical drug translation8,16. Although OOC is still in .......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors acknowledge that this work was supported by grants from the Science and Technology Commission of Shanghai Municipality (20ZR1411700), the National Natural Science Foundation of China (81771971), and Shanghai Sailing Program (22YF1406600).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
4% paraformaldehydeBeyotimeP0099-100mlUsed for cell immobilization
Alexa Fluor 350-labeled Goat Anti-Rabbit IgGBeyotimeA0408Antibodies used for immunostaining
Bovine serum albuminBeyotimeST025-20g
Calcium AM/PIInvitrogenL3224
Cell culture flask Corning430639
CNN1Abcam Ab46794
Commercial flexible
PDMS membrane
Hangzhou Bald Advanced MaterialsKYQ-200
F-actinInvitrogenR415
FBSSigmaM8318
HosesRunze Fluid964101 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com
Human aortic smooth
muscle cell line CRL1999
ATCCLot Number:70019189
Image JImagej.net/fiji/downloadsFree Download: https://fiji.scImaging platform that is used to identify fluorescence intensity
IncubatorThermo Fisher ScientificEnsures that the temperature,
humidity, and light exposure is
exactly the same throughout
experiment.
LuerRunze FluidRH-M016Official website address: https://www.runzefluidsystem.com.
MicroscopeOlympus
mouse collagenSigmaC7661
Oxygen plasma Changzhou Hongming InstrumentHM-Plasma5L
Pasteur pipetteBiologix30-0138A1
PBSBeyotimeC0221A
Pen-StrepSigmaP4458-100mlAntibiodics used to prevent bacterial
contamination of cells during culture.
peristaltic pumpKamoerF01A-STP-B046
Petri dishCorning430167
PLC controllerZhejiang Jun Teng (BenT) CNC factoryBR010-11T8X2MThe detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net
polydimethylsiloxane (PDMS)Dow CorningSylgard 184
SM22Abcam ab14106
SMCMScienCellCat 1101
solenoid valveSMC (China)VQZ300
SyringeBecton,Dickinson and Company300841
Triton-X 100BeyotimeST795To penetrate cell membranes
TrizolInvitrogen10296010Used for RNA extraction
trypsinSigma15400054
vacuum filterSMC (China)ZFC5-6Official website address: https://www.smc.com.cn
vacuum pumpKamoerKVP15-KL-S
vacuum regulatorAirTACGVR-200-06
Primers
Primer NameForward (5’ to 3’)Reverse (5’ to 3’)
SM22CCGTGGAGATCCCAACTGGCCATCTGAAGGCCAATGACAT
CNN1CTCCATTGACTCGAACGACTCCAGGTCTGCGAAACTTCTTAGA

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Olsson, C., Thelin, S., Ståhle, E., Ekbom, A., Granath, F. Thoracic aortic aneurysm and dissection: increasing prevalence and improved outcomes reported in a nationwide population-based study of more than 14,000 cases from 1987 to 2002. Circulation. 114 (24), 2611-2618 (2006).
  2. van Varik, B. J., et al.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Organ On A ChipSmooth Muscle CellsAortic Biomechanical StrainHuman Aorta ModelMicrofluidic TechniquesPDMS ChipCyclic StrainImmunofluorescence AnalysisCell MorphologyThoracic Aortic Aneurysm

Related Articles