Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

Summary

Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.

Abstract

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection (TAAD). However, human TAAD sometimes cannot be characterized by animal models. There is an apparent species gap between clinical human studies and animal experiments that may hinder the discovery of therapeutic drugs. In contrast, the conventional cell culture model is unable to simulate in vivo biomechanical stimuli. To this end, microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that replicate the biomechanical microenvironment. In this study, a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model was developed to simulate the pathophysiological parameters of aortic biomechanics, including the amplitude and frequency of cyclic strain experienced by human aortic smooth muscle cells (HASMCs) that play a vital role in TAAD. In this model, the morphology of HASMCs became elongated in shape, aligned perpendicularly to the strain direction, and presented a more contractile phenotype under strain conditions than under static conventional conditions. This was consistent with the cell orientation and phenotype in native human aortic walls. Additionally, using bicuspid aortic valve-related TAAD (BAV-TAAD) and tricuspid aortic valve-related TAAD (TAV-TAAD) patient-derived primary HASMCs, we established BAV-TAAD and TAV-TAAD disease models, which replicate HASMC characteristics in TAAD. The HASMC-OOC model provides a novel in vitro platform that is complementary to animal models for further exploring the pathogenesis of TAAD and discovering therapeutic targets.

Introduction

Thoracic aortic aneurysm and dissection (TAAD) is a localized dilatation or delamination of the aortic wall that is associated with high morbidity and mortality¹. Human aortic smooth muscle cells (HASMCs) play a vital role in the pathogenesis of TAAD. HASMCs are not terminally differentiated cells, and HASMCs retain high plasticity, allowing them to switch phenotypes in response to different stimuli². HASMCs are mainly subjected to rhythmic tensile strain in vivo, and this is one of the key factors regulating smooth muscle morphological changes, differentiation and physiological functions³

Protocol

Human aortic specimens were utilized for primary HASMC isolation under the approval of Zhongshan Hospital, Fudan University Ethics Committee (NO. B2020-158). Aortic specimens were collected from patients who underwent ascending aorta surgery at Zhongshan Hospital, Fudan University. Written informed consent was obtained from all patients before participation.

1. Primary human aortic smooth muscle cell isolation

1. Wash the right lateral region of the ascending aorta with sterile PBS, 1x-2x.
2. Remove the intima and adventitia layers of the tissue with two ophthalmic forceps and retain the media layer to harve....

Results

The HASMC-OOC model consists of a vacuum control system, a circulating system, and PDMS chips, and the schematic design of the HASMC-OOC model (Figure 1). The vacuum control system consists of a vacuum pump, solenoid valves, and a PLC controller. To act as the circulating system, a peristaltic pump was used to refresh the cell culture medium and add drugs. The PDMS chip was composed of two vacuum chambers and a middle chamber filled with SMCM for cell growth. According to the design of the c.......

Discussion

With the rapid development of microfluidic technology, OOC models that can replicate the biological function and structure of one or more organs in vitro have emerged in recent years for applications in biology, medicine, and pharmacology¹⁵. OOC can simulate key functions of the human physiological microenvironment, essential for exploring disease mechanisms and promoting preclinical drug translation^8,16. Although OOC is still in .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
4% paraformaldehyde	Beyotime	P0099-100ml	Used for cell immobilization
Alexa Fluor 350-labeled Goat Anti-Rabbit IgG	Beyotime	A0408	Antibodies used for immunostaining
Bovine serum albumin	Beyotime	ST025-20g
Calcium AM/PI	Invitrogen	L3224
Cell culture flask	Corning	430639
CNN1	Abcam	Ab46794
Commercial flexible PDMS membrane	Hangzhou Bald Advanced Materials	KYQ-200
F-actin	Invitrogen	R415
FBS	Sigma	M8318
Hoses	Runze Fluid	96410	1 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com
Human aortic smooth muscle cell line CRL1999	ATCC	Lot Number:70019189
Image J	Imagej.net/fiji/downloads	Free Download: https://fiji.sc	Imaging platform that is used to identify fluorescence intensity
Incubator	Thermo Fisher Scientific		Ensures that the temperature, humidity, and light exposure is exactly the same throughout experiment.
Luer	Runze Fluid	RH-M016	Official website address: https://www.runzefluidsystem.com.
Microscope	Olympus
mouse collagen	Sigma	C7661
Oxygen plasma	Changzhou Hongming Instrument	HM-Plasma5L
Pasteur pipette	Biologix	30-0138A1
PBS	Beyotime	C0221A
Pen-Strep	Sigma	P4458-100ml	Antibiodics used to prevent bacterial contamination of cells during culture.
peristaltic pump	Kamoer	F01A-STP-B046
Petri dish	Corning	430167
PLC controller	Zhejiang Jun Teng (BenT) CNC factory	BR010-11T8X2M	The detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net
polydimethylsiloxane (PDMS)	Dow Corning	Sylgard 184
SM22	Abcam	ab14106
SMCM	ScienCell	Cat 1101
solenoid valve	SMC (China)	VQZ300
Syringe	Becton,Dickinson and Company	300841
Triton-X 100	Beyotime	ST795	To penetrate cell membranes
Trizol	Invitrogen	10296010	Used for RNA extraction
trypsin	Sigma	15400054
vacuum filter	SMC (China)	ZFC5-6	Official website address: https://www.smc.com.cn
vacuum pump	Kamoer	KVP15-KL-S
vacuum regulator	AirTAC	GVR-200-06
Primers
Primer Name	Forward (5’ to 3’)	Reverse (5’ to 3’)
SM22	CCGTGGAGATCCCAACTGG	CCATCTGAAGGCCAATGACAT
CNN1	CTCCATTGACTCGAACGACTC	CAGGTCTGCGAAACTTCTTAGA