यहां, एकल-अणु कुल आंतरिक प्रतिबिंब प्रतिदीप्ति (एसएमटीआईआरएफ) माइक्रोस्कोपी का उपयोग करके कृत्रिम भीड़ वाले लिपिड झिल्ली पर एकल अणुओं के बंधन, गतिशीलता और असेंबली का प्रदर्शन और विश्लेषण करने के लिए एक प्रोटोकॉल प्रस्तुत किया गया है।
सेलुलर झिल्ली बायोमोलेक्यूलर प्रतिक्रियाओं और सिग्नलिंग के लिए अत्यधिक भीड़ वाले वातावरण हैं। फिर भी, लिपिड के साथ प्रोटीन इंटरैक्शन की जांच करने वाले अधिकांश इन विट्रो प्रयोग नग्न बाइलेयर झिल्ली को नियोजित करते हैं। ऐसी प्रणालियों में झिल्ली-एम्बेडेड प्रोटीन और ग्लाइकेन द्वारा भीड़ की जटिलताओं की कमी होती है और सेलुलर झिल्ली सतहों पर आने वाले संबंधित मात्रा प्रभावों को बाहर रखा जाता है। इसके अलावा, नकारात्मक रूप से चार्ज की गई कांच की सतह जिस पर लिपिड बाइलेयर बनते हैं, ट्रांसमेम्ब्रेन बायोमोलेक्यूल्स के मुक्त प्रसार को रोकता है। यहां, हम भीड़ भरे लिपिड झिल्ली के लिए एक मिमिक के रूप में एक अच्छी तरह से विशेषता बहुलक-लिपिड झिल्ली प्रस्तुत करते हैं। यह प्रोटोकॉल समर्थित लिपिड बाइलेयर (एसएलबी) में क्राउडर्स को शामिल करने के लिए एक सामान्यीकृत दृष्टिकोण के रूप में पॉलीथीन ग्लाइकोल (पीईजी) -संयुग्मित लिपिड का उपयोग करता है। सबसे पहले, एकल-अणु प्रयोगों के प्रदर्शन के लिए सूक्ष्म स्लाइड और कवरलिप की एक सफाई प्रक्रिया प्रस्तुत की जाती है। इसके बाद, पीईजी-एसएलबी को चिह्नित करने और एकल-अणु ट्रैकिंग और फोटोब्लीचिंग का उपयोग करके बायोमोलेक्यूल्स के बंधन, प्रसार और असेंबली के एकल-अणु प्रयोगों को करने के तरीकों पर चर्चा की जाती है। अंत में, यह प्रोटोकॉल दर्शाता है कि एकल-अणु फोटोब्लीचिंग विश्लेषण के साथ भीड़ वाले लिपिड झिल्ली पर बैक्टीरियल पोर बनाने वाले विष साइटोलिसिन ए (सीएलवाईए) के नैनोपोर असेंबली की निगरानी कैसे करें। उदाहरण डेटासेट के साथ MATLAB कोड भी कुछ सामान्य विश्लेषण करने के लिए शामिल हैं जैसे कण ट्रैकिंग, यांत्रिक व्यवहार निकालना और सबयूनिट गिनती।
सेलुलर झिल्ली अत्यधिक भीड़ और जटिल सिस्टम हैं। आणविक भीड़ प्रोटीन और लिपिड 2,3,4 जैसे झिल्ली-बाध्य संस्थाओं के प्रसार पर काफी प्रभाव डाल सकती है। इसी तरह, लिपिड झिल्ली पर द्वि-आणविक प्रतिक्रियाएं जैसे रिसेप्टर डिमराइजेशन या झिल्ली परिसरों के ऑलिगोमेराइजेशनभीड़ 5,6,7 से प्रभावित होती हैं। क्राउडर्स की प्रकृति, विन्यास और एकाग्रता झिल्ली बंधन, प्रसार और प्रोटीन-प्रोटीन इंटरैक्शन को कई तरीकों से नियंत्रित कर सकती है। चूंकि सेलुलर झिल्ली पर झिल्ली भीड़ को नियंत्रित करना और एम्बेडेड बायोमोलेक्यूल्स पर इसके प्रभाव की व्याख्या करना चुनौतीपूर्ण है, इसलिए शोधकर्ताओं ने वैकल्पिक इन विट्रो सिस्टम10 स्थापित करने की कोशिश की है।
कृत्रिम भीड़ वाले झिल्ली के लिए एक लोकप्रिय दृष्टिकोण बहुलक (जैसे पॉलीथीन ग्लाइकोल, पीईजी) -ग्राफ्टेड लिपिड11,12 के साथ बाइलेयर झिल्ली को डोपिंग कर रहा है। समर्थित लिपिड बाइलेयर (एसएलबी) पर प्रोटीन और लिपिड गतिशीलता के विज़ुअलाइज़ेशन के दौरान, ये पॉलिमर अंतर्निहित नकारात्मक चार्ज सब्सट्रेट (जैसे ग्लास) से झिल्ली-एम्बेडेड घटकों को अंतर्निहित समर्थन से प्रभावी ढंग से उठाकर ढालते हैं। बहुलक के आकार और एकाग्रता को बदलकर, कोई आणविक भीड़ की सीमा को नियंत्रित कर सकता है, साथ ही अंतर्निहित ठोस समर्थन13,14 से इसके अलगाव को भी नियंत्रित कर सकता है। यह स्पष्ट रूप से बहुलक कुशन15,16 के बिना ठोस सब्सट्रेट्स पर समर्थित लिपिड बाइलेयर पर एक लाभ है, जहां ट्रांसमेम्ब्रेन बायोमोलेक्यूल्स अपनी गतिविधि17,18,19 खो सकते हैं। इससे भी महत्वपूर्ण बात, यह हमें विट्रो में कोशिका झिल्ली के भीड़ भरे वातावरण को पुन: उत्पन्न करने की अनुमति देता है, जो कई झिल्ली प्रक्रियाओं के लिए महत्वपूर्ण है।
झिल्ली पर सतह-ग्राफ्टेड पॉलिमर भी उनके ग्राफ्टिंग घनत्व12 के आधार पर उनके विन्यास में परिवर्तन से गुजरते हैं। कम सांद्रता में, वे झिल्ली की सतह के ऊपर एक उष्णकटिबंधीय कुंडलित विन्यास में रहते हैं, जिसे मशरूम के रूप में जाना जाता है। बढ़ती एकाग्रता के साथ, वे बातचीत करना शुरू कर देते हैं और अनकॉइल और विस्तारित होते हैं, अंत में झिल्ली21 पर घने ब्रश जैसा गठन होता है। चूंकि मशरूम से ब्रश शासन में संक्रमण अत्यधिक विषम है और बहुलक की खराब विशेषता वाली स्थितियों में प्रकट होता है, इसलिए बहुलक-ग्राफ्टेड झिल्ली पर भीड़ के लिए अच्छी तरह से विशेषता वाली स्थितियों का उपयोग करना महत्वपूर्ण है। हाल के एक अध्ययन20 की तुलना में, हम भीड़-भाड़ वाली झिल्ली रचनाओं की पहचान और रिपोर्ट करते हैं जो ट्रांसमेम्ब्रेन बायोमोलेक्यूल्स के परिवहन और गतिविधि को बनाए रखते हैं।
इस प्रोटोकॉल में, हम चर्चा करते हैं कि पीईजीलेट लिपिड झिल्ली कैसे उत्पन्न करें और पीईजी घनत्व के लिए सिफारिशें प्रदान करें जो बहुलक विन्यास (अर्थात्, मशरूम और ब्रश) के दो अलग-अलग शासनों में भीड़ की नकल करते हैं। प्रोटोकॉल इन भीड़ भरे झिल्ली में एम्बेडेड अणुओं के लिए एकल-अणु बंधन, कण ट्रैकिंग और फोटोब्लीचिंग डेटा अधिग्रहण और विश्लेषण का भी वर्णन करता है। सबसे पहले, हम पूरी तरह से सफाई चरणों, इमेजिंग कक्ष की असेंबली और पीईजी-एसएलबी की पीढ़ी का वर्णन करते हैं। दूसरा, हम एकल-अणु बाइंडिंग, कण ट्रैकिंग और फोटोब्लीचिंग प्रयोगों के लिए विवरण प्रदान करते हैं। तीसरा, हम चर्चा करते हैं i) सापेक्ष बाध्यकारी समानताओं को निकालना, ii) आणविक प्रसार की विशेषता, और iii) झिल्ली पर एकल अणुओं की फिल्मों से प्रोटीन असेंबली में सबयूनिट्स की गिनती।
जबकि हमने इस प्रणाली को एकल-अणु इमेजिंग के साथ चित्रित किया है, प्रोटोकॉल लिपिड झिल्ली पर बायोमोलेक्यूलर प्रतिक्रियाओं पर भीड़ के प्रभाव को समझने में रुचि रखने वाले सभी झिल्ली बायोफिज़िसिस्टों के लिए उपयोगी है। कुल मिलाकर, हम भीड़ और समर्थित लिपिड बाइलेयर बनाने के लिए एक मजबूत पाइपलाइन प्रस्तुत करते हैं, साथ ही उन पर किए गए विभिन्न एकल-अणु परख और संबंधित विश्लेषण दिनचर्या।
यहां, हम समर्थित लिपिड बाइलेयर (एसएलबी) पर एकल-अणु प्रयोगों का प्रदर्शन करते हैं जो झिल्ली-एम्बेडेड बायोमोलेक्यूल्स के लिए भीड़ भरे वातावरण को प्रकट करते हैं। भीड़ भरा वातावरण एक बहिष्कृत मात्रा प्रभ?…
The authors have nothing to disclose.
बेंजामिन शूलर को क्लाया प्रोटीन के लिए अभिव्यक्ति प्लास्मिड साझा करने के लिए स्वीकार करते हैं। इस काम को ह्यूमन फ्रंटियर साइंस प्रोग्राम (आरजीपी0047-2020) द्वारा समर्थित किया गया था।
2.5 ml Syringes | HMD Healthcare | Dispo Van, 2.5 ml Tuberculin | Plastic syringe |
Acetone | Finar Chemicals | 10020LL025 | |
Acrylic Sheet | 2 mm thick | ||
Acrylic Sheet | BigiMall | 2 mm, Clear | |
Bath Sonicator | Branson | CPX-1800 | |
Calcium Chloride | |||
Chloroform | Sigma | 528730 | HPLC grade |
Cholesterol | Avanti | 700100 | |
Coplin Jar | Duran Wheaton Kimble | S6016 | 8 Slide Jar with Glass Cover |
Coverslips | VWR | 631-1574 | 24 mm X 50 mm |
Cy3-DNA Strand | IDT | GCTGCTATTGCGTCCGTTTGGTT GGTGTGGTTGG-Cy3 |
|
Cyanine Dye (Cy3) | Cytiva Life Sciences | PA23001 | |
DiI | Invitrogen | D3911 | Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3))) |
DNA Connector Strand 1 | Sigma Aldrich | GCTGCTATTGCGTCCGTTTAGCT GGGGGAGTATTGCGGAGGAAGC T |
|
DNA Connector Strand 2 | Sigma Aldrich | CGGACGCAATAGCAGCTCACAG TCGGTCACAT |
|
DNA Tocopherol Strand | Biomers | Toco-CCCAATGTGACCGACTGTGA | |
DOPE-PEG2000 | Avanti | 880130 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) |
Double Sided Tape | 3M | LF93010LE | |
Drill Bits (Diamond Coated) | 0.5 – 1 mm | ||
Drilling Machine | Dremel | 220 | Workstation |
EMCCD | Andor | DU-897U-CS0-#BV | |
Fluorescence Beads | Invitrogen | F10720 | |
Glass Slides | Blue Star | Micro Slides, PIC-1 | |
Glass Vials | Sigma | 854190 | |
Hydrogen Peroxide | Lobachemie | 00182 | 30% Solution, AR Grade |
Labolene | Thermo-Fischer Scientific | Detergent | |
Laser 532 nm | Coherent | Sapphire | |
Laser Cutter | Universal Laser Systems | ILS12.75 | |
Lissamine Rhodamine DOPE | Avanti | 810150 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt) |
Methanol | Finar Chemicals | 30932LL025 | |
Microscope | Olympus | IX81 | |
Phosphate Buffer Saline (PBS) | 1X | ||
Plasma Cleaner | Harrick Plasma Inc | PDC-002 | |
POPC | Avanti | 850457 | 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine |
Programmable Syringe Pump | New Era Pump Systems | NE1010 | High Pressure Syringe Pump |
PTFE Caps | Sigma | 27141 | |
PTFE Tubing | Cole-Parmer | WW-06417-21 | Masterflex, 0.022" ID x 0.042" OD |
Sulphuric Acid | SD Fine Chemicals | 98%, AR Grade | |
TIRF Objective | Olympus | UPLAPO100XOHR | |
Vacuum Desiccator | Tarsons | ||
Vortex Mixer | Tarsons |