Method Article

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

2.9K views

⸱

DOI:

10.3791/64408

⸱

September 28th, 2022

Corresponding Authors: Christian H. Eggers <christian.eggers@quinnipiac.edu>

In This Article

Summary

The ability of bacteriophage to move DNA between bacterial cells makes them effective tools for the genetic manipulation of their bacterial hosts. Presented here is a methodology for inducing, recovering, and using φBB-1, a bacteriophage of Borrelia burgdorferi, to transduce heterologous DNA between different strains of the Lyme disease spirochete.

Abstract

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This process has notably lower efficiencies in the Lyme disease spirochete relative to other, better-characterized Gram-negative bacteria. The rate of success of transformation is highly dependent upon having concentrated amounts of high-quality DNA from specific backgrounds and is subject to significant strain-to-strain variability. Alternative means for introducing foreign DNA (i.e., shuttle vectors, fluorescent reporters, and antibiotic-resistance markers) into B. burgdorferi could be an important addition to the armamentarium of useful tools for the genetic manipulation of the Lyme disease spirochete. Bacteriophage have been well-recognized as natural mechanisms for the movement of DNA among bacteria in a process called transduction. In this study, a method has been developed for using the ubiquitous borrelial phage φBB-1 to transduce DNA between B. burgdorferi cells of both the same and different genetic backgrounds. The transduced DNA includes both borrelial DNA and heterologous DNA in the form of small shuttle vectors. This demonstration suggests a potential use of phage-mediated transduction as a complement to electroporation for the genetic manipulation of the Lyme disease spirochete. This report describes methods for the induction and purification of phage φBB-1 from B. burgdorferi, the use of this phage in transduction assays, and the selection and screening of potential transductants.

Introduction

The development of tools for the genetic manipulation of the spirochetal bacterium Borrelia burgdorferi has added immeasurable value to the understanding of the nature of Lyme disease1,2,3,4. B. burgdorferi has an unusually complex genome comprised of a small linear chromosome and both linear and circular plasmids5,6. Spontaneous plasmid loss, intragenic rearrangement (movement of genes from one plasmid to another within the same organism), and horizontal gene transfer (HGT, the movement of DNA between two organisms) have given rise to a dizzying amount of genetic heterogeneity among B. burgdorferi (for an example, see Schutzer et al.7). The resulting genotypes (or "strains") are all members of the same species but have genetic differences that influence their ability to transmit to and infect different mammalian hosts8,9,10,11. In this report, the term "strain" will be used to refer to B. burgdorferi with a particular naturally derived genetic background; the term "clone" will be used to refer to a strain that has been genetically modified for a particular purpose or as a result of experimental manipulation.

The molecular toolbox available for use in B. burgdorferi includes selectable markers, gene reporters, shuttle vectors, transposon mutagenesis, inducible promoters, and counter-selectable markers (for a review, see Drektrah and Samuels12). The effective use of these methodologies requires the artificial introduction of heterologous (foreign) DNA into a B. burgdorferi strain of interest. In B. burgdorferi, the introduction of heterologous DNA is achieved almost exclusively via electroporation, a method that utilizes a pulse of electricity to make a bacterial membrane transiently permeable to small pieces of DNA introduced into the media1. The majority of the cells (estimated to be ≥99.5%) are killed by the pulse, but the remaining cells have a high frequency of retaining the heterologous DNA13. Although considered to be among the most highly efficient methods of introducing DNA into bacteria, the frequency of electroporation into B. burgdorferi is very low (ranging from 1 transformant in 5 × 104 to 5 × 106 cells)13. The barriers to achieving higher frequencies of transformation seem to be both technical and biological. Technical barriers to the successful electroporation of B. burgdorferi include both the amount of DNA (>10 μg) that is necessary and the requirement of the spirochetes to be in exactly the correct growth phase (mid-log, between 2 × 107 cells·mL−1 and 7 × 107 cells·mL−1) when preparing electrocompetent cells12,13. These technical barriers, however, may be easier to overcome than the biological barriers.

Lyme disease researchers recognize that B. burgdorferi clones can be divided into two broad categories with respect to their ability to be manipulated genetically13,14. High passage, lab-adapted isolates are often readily transformed but usually have lost the plasmids essential for infectivity, behave in a physiologically aberrant fashion, and are not able to infect a mammalian host or persist within a tick vector12,13. While these clones have been useful for dissecting the molecular biology of the spirochete within the lab, they are of little value for studying the spirochete within the biological context of the enzootic cycle. Low-passage infectious isolates, on the other hand, behave in a physiologic manner reflective of an infectious state and can complete the infectious cycle but usually are recalcitrant to the introduction of heterologous DNA and are, therefore, difficult to manipulate for study12,13. The difficulty in transforming low-passage isolates is related to at least two different factors: (i) low-passage isolates often tightly clump together, particularly under the high-density conditions required for electroporation, thus blocking many cells from either the full application of the electrical charge or access to the DNA in the media13,15; and (ii) B. burgdorferi encodes at least two different plasmid-borne restriction-modification (R-M) systems that may be lost in high-passage isolates14,16. R-M systems have evolved to allow bacteria to recognize and eliminate foreign DNA17. Indeed, several studies in B. burgdorferi have demonstrated that transformation efficiencies increase when the source of the DNA is B. burgdorferi rather than Escherichia coli13,16. Unfortunately, acquiring the requisite high concentration of DNA for electroporation from B. burgdorferi is an expensive and time-consuming prospect. Another potential concern when electroporating and selecting low-passage isolates is that the process seems to favor transformants that have lost the critical virulence-associated plasmid, lp2514,18,19; thus, the very act of genetically manipulating low-passage B. burgdorferi isolates via electroporation may select for clones that are not suitable for biologically relevant analysis within the enzootic cycle20. Given these issues, a system in which heterologous DNA could be electrotransformed into high-passage B. burgdorferi clones and then transferred into low-passage infectious isolates by a method other than electroporation could be a welcome addition to the growing collection of molecular tools available for use in the Lyme disease spirochete.

In addition to transformation (the uptake of naked DNA), there are two other mechanisms by which bacteria regularly take up heterologous DNA: conjugation, which is the exchange of DNA between bacteria in direct physical contact with each other, and transduction, which is the exchange of DNA mediated by a bacteriophage21. Indeed, the ability of bacteriophage to mediate HGT has been used as an experimental tool for dissecting the molecular processes within a number of bacterial systems22,23,24. B. burgdorferi is not naturally competent for the uptake of naked DNA, and there is little evidence that B. burgdorferi encodes the apparatus necessary to promote successful conjugation. Previous reports have described, however, the identification and preliminary characterization of φBB-1, a temperate bacteriophage of B. burgdorferi25,26,27,28. φBB-1 packages a family of 30 kb plasmids found within B. burgdorferi25; the members of this family have been designated cp32s. Consistent with a role for φBB-1 in participating in HGT among B. burgdorferi strains, Stevenson et al. reported an identical cp32 found in two strains with otherwise disparate cp32s, suggesting a recent sharing of this cp32 between these two strains, likely via transduction29. There also is evidence of significant recombination via HGT among the cp32s in an otherwise relatively stable genome30,31,32,33. Finally, the ability of φBB-1 to transduce both cp32s and heterologous shuttle vector DNA between cells of the same strain and between cells of two different strains has been demonstrated previously27,28. Given these findings, φBB-1 has been proposed as another tool to be developed for the dissection of the molecular biology of B. burgdorferi.

The goal of this report is to detail a method for inducing and purifying phage φBB-1 from B. burgdorferi, as well as provide a protocol for performing a transduction assay between B. burgdorferi clones and selecting and screening potential transductants.

Protocol

All experiments using recombinant DNA and BSL-2 organisms were reviewed and approved by the Quinnipiac University Institutional Biosafety Committee.

1. Preparation of B. burgdorferi culture for the production of φBB-1

  1. Prepare Barbour-Stoenner-Kelly medium supplemented with 6.6% heat-inactivated normal rabbit serum (BSK)15. For 1 L of 1x BSK, combine the components listed in Table 1 in 900 mL of water, adjust the pH to 7.6 using 1 N sodium hydroxide, and mix slowly at 4 °C for 2-4 h. After mixing is complete, check and readjust the pH to 7.6 if necessary, and increase the volume to 1 L with water. Sterilize the medium by passing through a 0.22 µM filter (see Table of Materials) and use fresh or store at 4 °C for ≤2 months.
  2. Three to five days prior to beginning the transduction protocol, inoculate 150 µL of the appropriate B. burgdorferi clone(s) into 15 mL of 1x BSK in tightly capped sterile conical centrifuge tubes (see Table of Materials). Supplement the medium with the appropriate concentration of antibiotics or combination of antibiotics for the selection and maintenance of heterologous DNA within the B. burgdorferi clone(s) (Table 2).
    NOTE: B. burgdorferi is a biosafety level 2 organism. Take all appropriate precautions while working with this organism. Perform all work with live cultures of B. burgdorferi in a certified and properly disinfected class II biosafety cabinet. Properly dispose of all material that contacts B. burgdorferi and the organisms themselves based on CDC guidelines34.
  3. Incubate the cultures at 33 °C without shaking until the cultures reach a density of ≥5 × 107 spirochetes·mL−1, which takes approximately 3-5 days.

2. Determine the density of the B. burgdorferi culture(s) (modified from Samuels)15

  1. For densities anticipated to be above 5 × 106 cells·mL−1, determine the cell density using spectroscopy.
    1. Transfer 1 mL of culture to a 1.7 mL microcentrifuge tube and centrifuge at 8,000 x g for 5 min at room temperature.
    2. Discard the supernatant and resuspend the cell pellet in 1 mL of phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4). Transfer the entire cell suspension to a semi-micro UV transparent cuvette.
    3. Determine the optical density of the resuspended sample at a wavelength of 600 nm (A600). Zero the spectrophotometer (see Table of Materials) against PBS.
    4. To calculate the concentration of spirochetes·mL−1 in the original culture, multiply the optical density at A600 by 1.4 × 109.
  2. For densities anticipated to be between 5 × 104 cells·mL−1 and 5 × 106 cells·mL−1, determine the cell density using a Petroff-Hausser counting chamber (see Table of Materials) to directly count the number of spirochetes. This method also can be used for higher densities following appropriate dilution.
    NOTE: The visualization of live spirochetes requires a microscope modified with a darkfield condenser.
    1. Apply 10 µL of sample to the counting chamber and cover with appropriate cover glass. For densities higher than 1 × 107, dilute the sample in PBS to yield 50-100 spirochetes per field.
    2. Count the cells using a darkfield microscope at a magnification of 200x-400x. Count the entire field of 25 groups of 16 small squares in all planes.
    3. Multiply the number counted by the dilution factor (if any) and 5 × 104 to yield cells·mL−1 of original culture.

3. Induction of B. burgdorferi phage φBB-1

NOTE: Sterilize all the glassware and plasticware by autoclaving; sterilize all the solutions by autoclaving or filtration through a 0.22 µM filter. The steps below are presented based on volumes of 15 mL, but the method is scalable to smaller or larger volumes depending on the individual needs of the experiment.

  1. For the B. burgdorferi culture from which phage will be produced (the donor), use the concentration calculated by either method in step 2 to determine the volume of starter culture needed to yield 4 mL of 2 × 108 spirochetes·mL−1. This will yield a final concentration of 5 × 107 spirochetes·mL−1 in 15 mL during the recovery stage (step 3.6 below).
  2. Centrifuge the volume of culture calculated in step 3.1 at 6,000 x g for 10 min. Decant the supernatant and resuspend the pellet in 4 mL of fresh BSK. Transfer the sample to the smallest sterile tube available to hold the sample with minimal head space.
  3. Add the appropriate amount of inducing agent to the recommended concentration (Table 3) based on a culture volume of 4 mL to induce phage production. Cap the tube tightly and mix thoroughly.
  4. Incubate the sample at 33 °C for 2-4 h.
  5. After incubation, transfer the sample to a 15 mL centrifuge tube. Centrifuge the sample at 6,000 x g for 10 min. Decant the supernatant.
  6. Resuspend the cell pellet in 15 mL of 1x BSK.
    NOTE: After induction of the phage, there are two different ways to proceed with the transduction assay. These methods are presented in Figure 1 and in step 4 and step 6.

4. Transduction during co-culture following exposure of the donor to the inducing agent (Figure 1A)

NOTE: This protocol can only be used when the phage-producing strain (donor) has resistance to a particular antibiotic and the strain to be transduced (recipient) has resistance to another antibiotic.

  1. Prepare a B. burgdorferi culture to be used as the recipient in transduction assays, as described for the donor strain in step 1 above. Based on the density determined as in step 2, calculate the volume needed to yield 15 mL of 1 × 107 spirochetes·mL−1.
  2. Centrifuge the volume of culture calculated in step 4.1 at 6,000 x g for 10 min. Decant the supernatant.
  3. Resuspend the pellet in 1 mL of culture from step 3.6 (resuspended phage donor). Add the resuspended recipient back into the culture with the donor. Do not supplement with antibiotic. The total volume containing both cultures is 15 mL.
  4. Incubate at 33 °C for 72-96 h.
  5. Perform selection of transductants by solid-phase plating after co-culture as described in step 7.

5. Polyethylene glycol (PEG) precipitation to recover phage for use in transduction assay

NOTE: This protocol can be used in cases where the phage-producing strain (donor) has resistance to a particular antibiotic and the strain to be transduced (recipient) either has no antibiotic resistance or resistance to another antibiotic.

  1. Supplement the culture from step 3.6 with the appropriate antibiotic at the concentration indicated in Table 2. Incubate the sample at 33 °C for 72-96 h.
  2. Prepare solutions for PEG precipitation.
    1. Prepare 500 mL of 5 M NaCl. Sterilize by autoclaving and let cool prior to use. Store at room temperature.
    2. Prepare 500 mL of 40% PEG by dissolving 200 g of PEG8000 in 400 mL of water; heat gently while stirring until the solution is well-mixed. Bring the volume up to 500 mL with water. To completely dissolve the PEG8000 and sterilize the solution, autoclave the solution and cool prior to use. Store at room temperature.
    3. Prepare 100 mL of suspension medium (SM; 100 mM NaCl, 10 mM MgSO4, and 50 mM Tris-HCl [pH 7.5]). Sterilize by autoclaving. Store at 4 °C.
  3. For PEG precipitation of phage from the donor B. burgdorferi clone (from step 3.6), after 72-96 h of incubation, centrifuge the samples at 8,000 x g for 20 min at 4 °C.
  4. Decant the supernatant into a clean 50 mL conical tube; dispose of the cell pellet. Add 5 M NaCl to a final concentration of 1 M. Mix well. Rock gently at room temperature for 1 h.
  5. Centrifuge the samples at 8,000 x g for 10 min at 4 °C. Decant the supernatant into a clean 50 mL conical tube; the pellet might be small or absent. Add 40% PEG8000 solution to the supernatant to a final concentration of 10%. Mix well and set on ice for more than 1 h up to overnight.
    NOTE: Longer times do not seem to correlate with significantly increased phage recovery.
  6. Centrifuge the samples at 8,000 x g for 20 min at 4 °C. Discard the supernatant and remove as much excess liquid as possible without losing any pellet, which contains the phage particles.
  7. Resuspend the pellet in a minimal volume of SM, using the SM to wash down the side of the bottle and collect any potential phage particles. The recommended ratio is 400 µL of SM per 10 mL of original supernatant, but depending on the size of the pellet, more or less SM may be required for complete resuspension.
  8. Treat the recovered phage sample with an equal volume of chloroform based on the volume of resuspension. Mix the sample well and then centrifuge at 8,000 x g for 10 min. Remove the aqueous (top) layer to a clean tube, avoiding any of the thick interface layer.
    NOTE: φBB-1 is a non-enveloped bacteriophage and is not susceptible to chloroform treatment25. This step is done to further disrupt any membrane-bound structures (i.e., cells or blebs) and to kill any potential cellular contaminants. Chloroform is a volatile organic and is to be used only in a well-ventilated fume hood; discard material containing chloroform as organic waste.
  9. Determine the volume recovered after the first chloroform treatment and treat the sample again with an amount of chloroform equal to 10% of that volume. Mix well and centrifuge at 8,000 x g for 10 min. Remove the aqueous (top) layer, being careful to avoid any of the interface or organic layer. Transfer the aqueous layer to a clean tube.
  10. Use the phage immediately (as described in step 6) or store at 4 °C.
    ​NOTE: Freezing of φBB-1 phage samples is not recommended. Although the stability of φBB-1 at 4 °C has not been rigorously investigated, samples stored at 4 °C for up to 1 month after recovery have been used successfully in transduction assays.

6. Transduction assay following PEG precipitation of φBB-1 (Figure 1B)

  1. Prepare B. burgdorferi cultures to be used as the recipient in transduction assays, as described for the donor strain in step 1 above. Based on the density determined as in step 2, calculate the volume of culture of recipient needed to yield 15 mL of 1 × 107 spirochetes·mL−1.
  2. Centrifuge the volume of culture calculated in step 6.1 at 6,000 x g for 10 min. Decant the supernatant and resuspend the pellet in 14.5 mL of fresh BSK.
  3. Add ≤500 µL of PEG-precipitated phage sample (from step 5) to the culture of the recipient clone. Mix well and incubate at 33 °C for 72-96 h.
    ​NOTE: The amount of phage recovered during PEG precipitation can be variable, depending on a number of factors. However, from 15 mL culture of induced B. burgdorferi strain CA-11.2A, 500 µL typically contains 50-1,000 viable phage28. Volumes of phage recovery ≥500 µL adversely affect B. burgdorferi growth, likely due to the increased ratio of SM to BSK.
  4. Perform the selection of transductants by solid-phase plating after mixing with PEG-precipitated phage as described in step 7.

7. Selection of transductants

NOTE: Solid-phase plating of potential transductants is performed using a single-layer modification of the protocol first described by Samuels15. B. burgdorferi colonies grow within the agar, so for the selection of transductants by solid-phase plating, the samples must be added to the media while the plates are poured. An alternative method for the selection of transformants using a dilution method in 96-well plates also has been described previously35. This technique also might be effective for the selection of transductants but has not yet been tried for this purpose.

  1. Determine the number of plates needed for the selection of transductants based on the number of samples from the transduction assays and controls to be plated.
    NOTE: Typically, two plates are poured per sample, one equivalent to approximately 10% of the culture volume and one that includes the remainder of the culture. Additionally, pour plates that serve as negative controls to individually test that the phage preparation and/or parent clones used as the donor and the recipient do not grow in the presence of the antibiotic(s) used during selection. Preparing plating material for at least two extra plates is also recommended. For example, if the number of samples and controls to be plated is eight, prepare enough plating mix for 10 plates.
  2. Prepare solutions for plating as described below.
    NOTE: Each plate will be 30 mL, consisting of 20 mL of 1.5x BSK for plating and 10 mL of 2.1% agarose (2:1 ratio). This will yield a plate with final concentrations of 1x BSK and 0.7% agarose. For example, for 10 plates, prepare a total plating mix of 300 mL, consisting of 200 mL of 1.5x BSK and 100 mL of 2.1% agarose.
    1. Prepare 1 L of 1.5x BSK as described for 1x BSK in step 1.1 using the amounts of each component listed for 1.5x BSK in Table 1. Store as described for 1x BSK.
    2. Prepare 2.1% agarose in water and autoclave. Use the agarose solution fresh or store at room temperature. If stored at room temperature, microwave with the lid on loosely until completely molten prior to plating.
    3. Determine the volume of antibiotic(s) needed to achieve the appropriate concentration (Table 2) based on the entire plating mix.
      NOTE: If the total volume of the final plating solution is 300 mL, mix 200 mL of 1.5x BSK and enough antibiotic to ensure that the entire 300 mL has the correct final antibiotic concentration. If both the donor and the recipient in the transduction assay have different antibiotic-resistance genes, the plating mix should contain both antibiotics. If the PEG-precipitated phage from the donor (as prepared in step 5) encodes an antibiotic-resistance marker and the recipient has none, the plating mix should contain only the one antibiotic.
  3. Based on the number of plates to be poured, transfer the appropriate amount of 1.5x BSK and antibiotic(s) to a sterile bottle large enough to hold the entire plating mix. Equilibrate in a water bath at 56 °C for ≥15 min.
  4. Equilibrate molten agarose from the autoclave or microwave in a 56 °C water bath for ≥15 min.
  5. After equilibration, add the determined amount of 2.1% agarose to the bottle with the 1.5x BSK (with antibiotic) and put the plating solution back in the water bath at 42 °C for 10-15 min.
    NOTE: Higher temperatures can damage or kill the spirochetes36. If using the same water bath as above, cool the water bath to 42-45 °C before starting the timer for the equilibration. Do not let the plating solution equilibrate at 42 °C for more than 20 min or it will start to solidify while pouring the plates.
  6. During equilibration, prepare the B. burgdorferi samples to be plated. Transfer the amount to be plated to a sterile 50 mL conical centrifuge tube (see Table of Materials).
    1. If plating an amount less than 1.5 mL (<5% of the final 30 mL plate volume), transfer the sample to the new tube and add the plating mix directly to the sample during plating.
    2. For larger volumes, transfer the desired volume of culture to the new tube and then centrifuge at 6,000 x g for 10 min at room temperature. Decant all but 100-500 µL of the supernatant and use the remainder to resuspend the pellet completely prior to plating.
    3. For control plates following co-culture, add ≥107 cells of the donor or recipient clones to sterile 50 mL conical centrifuge tubes. If the volume is over 1.5 mL, centrifuge and resuspend the pellet as in step 7.6.2. If a transduction assay was performed using the PEG-precipitated phage, in addition to the recipient clone, add 100-250 µL of the phage sample into a sterile 50 mL conical tube for plating.
  7. After the plating solution has equilibrated at 42-45 °C for 10-15 min, transfer 30 mL of the plating solution into a tube with the appropriate sample; immediately dispense the plating mix and sample into a labeled plate. Repeat with a fresh pipette for each sample to be plated.
  8. Allow the plates to solidify for 15-20 min and then place them in a 33 °C incubator supplemented with 5% CO2. Do not invert the plates for at least 48 h after being poured.
  9. Depending on the background of the recipient clone, check that the colonies appear within the agarose on the selection plates after 10-21 days of incubation. Pick at least 5-10 colonies that grow on the plate in the presence of both antibiotics using a sterilized cotton-plugged 5.75 in borosilicate pipette (see Table of Materials) and inoculate them into 1.5 mL of 1x BSK with the appropriate antibiotic(s).
  10. Grow the inoculated colonies at 33 °C as in step 1.3 for 3-5 days or until they reach a density of approximately 20-40 spirochetes per field at 200x magnification using darkfield microscopy.
    ​NOTE: Once screened (see step 8), the spirochetes can be frozen for long-term storage at −80 °C by mixing an equal volume of culture with a mixture of 60% glycerol and 40% 1x BSK sterilized by filtration through a 0.22 µm filter.

8. Verification of potential transductants

NOTE: Screen the clones that grow on plates in the presence of two antibiotics to verify that they represent true transductants in the anticipated (recipient) background. These methods are based on the amplification, and potentially sequencing, of specific regions by the polymerase chain reaction. Detailed protocols and practices of performing PCR in B. burgdorferi are described elsewhere (for a recent example, see Seshu et al.37). Select the primers used for screening the transductants based on the strains used. Some suggestions as to how to approach screening the transductants are described below.

  1. Prepare B. burgdorferi lysates for PCR screening.
    NOTE: The following protocol is used to produce washed B. burgdorferi lysates from cultured cells grown as in step 7.9 for immediate analysis of the DNA by PCR. This method is designed to minimize the interference of potential inhibitors in BSK but is not recommended for producing high-quality DNA for sequencing or storage. For that purpose, use a protocol or kit for total genome extraction (see Table of Materials). It is highly recommended that lysates from the parent clones (both donor and recipient strains) also be prepared at the same time to include in each analysis.
    1. Transfer 500 µL of each potential transductant selected and cultured as in step 7.10 to a clean microcentrifuge tube.
    2. Centrifuge the cultures for 10 min at 8,000 x g at room temperature.
    3. Remove the supernatant and resuspend each pellet in 500 µL of TE (10 mM Tris Cl, pH 8.0; 1 mM EDTA, pH 8.0). Centrifuge for 5 min at 8,000 x g at room temperature.
    4. Remove the supernatant and resuspend each pellet in 50 µL of PCR-quality water. Boil the samples for 10 min. Let them cool briefly, and then centrifuge at 8,000 x g for 10 min at room temperature.
    5. For each PCR, immediately use 2 µL from the top of the centrifuged sample; avoid disturbing the pellet.
  2. Screen the potential transductants for the specific genes encoding antibiotic resistance using PCR. See Table 4 for the primers for screening antibiotic-resistance markers commonly used in transduction assays.
    NOTE: Although rare in our experience, spontaneous mutation to the aminoglycoside antibiotics used for the selection of heterologous DNA in B. burgdorferi can occur.
  3. Screen the potential transductants also using another strain or clone marker to confirm that the background is that of the recipient. Include both the donor and the recipient parent clones in these analyses. Screen for strain-specific markers using sequences based on the strains used and individual laboratory protocols for determining strain integrity.
  4. If attempting to transduce into virulent clones for use within the tick vector or mammalian host or for direct comparison with another clone, determine the complete plasmid content of the transductants and the parent clones. This is done to ensure the same plasmid content as that of the comparative strain or the presence of the genetic elements necessary for propagation within the enzootic cycle, as is described elsewhere 18,19,37,38,39.

Results

The use of bacteriophage to move DNA between more readily transformable B. burgdorferi strains or clones that are recalcitrant to electrotransformation represents another tool for the continued molecular investigation of the determinants of Lyme disease. The transduction assay described herein can be modified as needed to facilitate the movement of DNA between any clones of interest using either one or two antibiotics for the selection of potential transductants. The transduction of both prophage DNA and heterologous E. coli/B. burgdorferi shuttle vectors between a high-passage strain CA-11.2A clone and both a high-passage strain B31 clone and a low-passage virulent clone of strain 297 have been previously demonstrated28. The results presented below demonstrate the movement of prophage DNA between two high-passage, avirulent clones. The donor clone, c1673, is a B. burgdorferi strain CA-11.2A clone that encodes a kanamycin-resistance gene on the prophage DNA27,28. The recipient is a clone of B. burgdorferi strain B31, designated c1706, which encodes a gentamicin-resistance marker on the chromosome28. The transduction assay was performed as illustrated in Figure 1B; the PEG-precipitated phage recovered from the supernatants of c1673 exposed to 5% ethanol was mixed with c1706 as described in step 6 of the protocol.

After mixing approximately 20% of the phage recovered by PEG precipitation from the supernatants of ethanol-exposed c1673 (encoding resistance to kanamycin) with c1706 (encoding resistance to gentamicin), the mixture was plated in the presence of both antibiotics; colony-forming units (CFUs) that are able to grow in the presence of both kanamycin and gentamicin are indicative of transduction events (Figure 2)27,28. The number of CFUs is reported as the transduction frequency per initial recipient cell. In this representative experiment, approximately 275 transductants were recovered after incubation of the phage with 1 × 107 recipient cells, yielding a transduction frequency of 2.75 × 10−5 CFUs per recipient cell.

Following the recovery of the potential transductants, PCR amplification of the genes encoding kanamycin and gentamicin resistance was performed on 10 of the clones, with two representative samples shown in Figure 3. The kanamycin-resistance gene could be amplified from the donor (c1673) and the potential transductants but not the recipients (c1706). Similarly, the gentamicin-resistance gene could be amplified from the recipient (c1706) and the potential transductants but not the donor. Thus, the recovered clones specifically encode both antibiotic-resistance genes and represent transduction events, not spontaneous mutants.

To demonstrate that the kanamycin-resistance cassette was transduced by φBB-1 from the donor into the recipient, the background of the transductants was determined using strain-specific markers, as described previously28. This is particularly important if the transductants have been generated by the co-culture method of transduction. Briefly, previously published primers28 were used to amplify specific regions of various borrelial plasmids, generating a profile that can be used to identify the background of the clone (Figure 4). The c1673 clone in the CA-11.2A background encodes specific amplicons 4, 5, and 6, whereas c1706, which has a high-passage B31 background, does not. Similarly, the two transductants are missing amplicons 4, 5, and 6; thus, these clones have the c1706 background and have acquired the kanamycin-resistance gene from c1673.

Component1x BSK (for culturing) (1 L)1.5x BSK (for plating) (1 L)
Bovine serum albumin (fraction V)35 g52.5 g
10x CMRL-1066 (without L-glutamine)8 g12 g
Neopeptone4 g6 g
yeastolate1.6 g2.4 g
HEPES4.8 g7.2 g
Glucose4 g6 g
Sodium citrate0.56 g0.84 g
Sodium pyruvate0.64 g0.96 g
N-acetyl-glucosamine0.32 g0.48 g
Sodium bicarbonate1.76 g2.64 g
Heat-inactivated normal rabbit serum (INRS)66 mL99 mL

Table 1: BSK for the cultivation and selection of B. burgdorferi clones for transduction assays. The formulation and preparation of 1x BSK for culturing B. burgdorferi and 1.5x BSK for the solid-phase selection of B. burgdorferi clones described here are based upon Samuels15. Different formulations of BSK (or MKP)37,40,41 that support the growth of B. burgdorferi have not yet been tested using the transduction assay.

AntibioticStock concentrationFinal concentration in culture of Bb
Kanamycin100 mg.mL-1 (in water)200-400 μg.mL-1
Gentamicin50 mg.mL-1 (in water)50 μg.mL-1
Streptomycin50 mg.mL-1 (in water)50 μg.mL-1
Erythromycin2 mg.mL-1 (in EtOH)0.06 μg.mL-1

Table 2: Potential antibiotics and concentrations to be used for the selection and maintenance of heterologous DNA in B. burgdorferi. This list is based on current antibiotic-resistant markers commonly used in Borrelia burgdorferi42,43,44,45. Kanamycin, gentamicin, and streptomycin are prepared in water, filter-sterilized through a 0.22 µM filter, and stored at −20 °C. Erythromycin is prepared in 95% ethanol and stored at −20 °C. Many laboratories report the successful use of kanamycin for selection at a concentration of 200 µg·mL−1; when using both gentamicin and kanamycin for selection in transduction assays, 400 µg·mL−1 kanamycin is used. The aadA gene confers resistance to both streptomycin and spectinomycin44. For the selection of constructs containing the aadA gene in E. coli, 100 µg·mL−1 spectinomycin is used. Note that the aminoglycosides (kanamycin, gentamicin, and streptomycin) are not clinically relevant in the treatment of Lyme disease; however, erythromycin is used clinically in certain situations46. Although natural resistance to this antibiotic in B. burgdorferi has been reported47, this resistance marker has not been used thus far in the transduction assays reported here.

Inducing agentStock concentration (solvent)Final concentration in sample
Ethanol100% (none)5%
Mitomycin C2 mg.mL-1 (water)20 μg.mL-1
1-methyl-3-nitroso-nitroguanidine (MNNG)50 mg.mL-1 (DMSO)10 μg.mL-1

Table 3: Potential inducing agents and concentrations used for the induction of φBB-1 from B. burgdorferi. N-methyl-N′-nitro-N-nitrosoguanidine (MNNG), mitomycin C, and ethanol, as well as methanol and isopropanol, have all been demonstrated to induce φBB-1 above constitutive levels in B. burgdorferi strain CA.11-2A25,26,28. MNNG is a suspected carcinogen and environmental hazard; use with caution, dissolve in a combustible solvent, and incinerate for disposal. Mitomycin C is a suspected carcinogen and potential environmental hazard; use with caution under a chemical fume hood and dispose of properly. While published data suggest that MNNG is the most effective agent for inducing φBB-126, the hazards of working with this chemical and difficulties in acquiring it make its use complicated48, particularly with students. Induction with ethanol is consistently better than with methanol or isopropanol28 and has been most commonly used in the transduction assay.

Gene name or designationAntibiotic resistanceReferencePrimer namePrimer sequence (5΄ to 3΄)
kanR from Tn903kanamycin42kanR 382FCGGTTGCATTCGATTCCTGT
kanR 684RGGCAAGATCCTGGTATCGGT
aacC1gentamicin43aacC1 166FACCTACTCCCAACATCAGCC
aacC1 497RTCTTCCCGTATGCCCAACTT
aadAstreptomycin44aadA 273FTGTGCACGACGACATCATTC
aadA 594RTACTGCGCTGTACCAAATGC

Table 4: Primers used for the preliminary analysis of transduction of antibiotic resistance markers. The primers indicated here are for the detection of antibiotic-resistance genes commonly used in transduction assays. These primers are used in PCR with the following conditions repeated for 28 cycles: denaturation at 92 °C for 15 s, primer annealing at 56 °C for 15 s, and target DNA extension at 72 °C for 30 s.

Phage transduction diagram, DNA transfer method, co-culture to transductant selection on antibiotic plates.
Figure 1: Transduction assay for monitoring the phage-mediated movement (transduction) of DNA. The transduction assay can be performed using either (A) the co-culture method or (B) phage recovered from culture supernatant by PEG precipitation. For the co-culture method (A), an induced B. burgdorferi clone (the donor) encoding an antibiotic-resistance gene on the DNA to be transduced by φBB-1 (green circle) is cultured with a non-induced B. burgdorferi clone (the recipient), which encodes a second antibiotic-resistance gene on the chromosome or other stable genetic element (red circle). This method requires the use of two different antibiotic-resistance markers (in this example, genes encoding kanamycin and gentamicin resistance). To use the purified phage in the transduction assay (B), phage particles recovered by PEG precipitation of the supernatant from the induced donor are mixed with the recipient. While shown here using two different antibiotics, this method can be performed with the use of only one antibiotic-resistance marker encoded on the φBB-1 prophage DNA, as previously demonstrated27. Following incubation, transductants are selected by solid-phase plating in the presence of both antibiotics; if method B is being used with only one antibiotic resistance marker encoded on the phage DNA, then selection is done using only that antibiotic during solid-phase plating. The transductants will contain both antibiotic-resistance markers and have the background of the recipient. This figure is reprinted from Eggers et al.28 with the permission of Oxford University Press. In the modeled experiment, c1673 and c1650 represent two different CA-11.2A clones; c1673 carries a φBB-1 prophage encoding kanamycin resistance, and c1650 encodes a gentamicin-resistance marker in a non-phage location28. Please click here to view a larger version of this figure.

Bacterial colony growth on agar plate, microbiology experiment, cultured petri dish observation.
Figure 2: Colony-forming units selected by solid-phase plating following the transduction assay. Colonies that grow in the presence of both antibiotics following mixing of the phage from c1673 with c1706 represent potential transductants. No colonies should grow on control plates containing the individual donor and recipient clones or a sample of phage prep (not shown). The minimum number of productive phage in the original sample can be determined by counting the number of CFUs and multiplying by the dilution factor. In this case, 20% of the phage sample PEG-precipitated from a 15 mL culture of the donor yielded approximately 275 colonies. Thus, the original concentration of productive phage recovered by PEG precipitation was ≥1.3 × 103 virions. Please click here to view a larger version of this figure.

Kanamycin and gentamicin resistance electrophoresis results; transduction assay analysis.
Figure 3: PCR amplification of the genes conferring kanamycin resistance and gentamicin resistance from two potential transductants. PCR using primers for the kanamycin- and gentamicin-resistance genes (Table 4) was performed to screen the lysates generated from two colonies (transductant 1 and transductant 2). These colonies were selected on a plate containing both kanamycin and gentamicin following the mixing of c1673 (donor) and c1706 (recipient). The amplicons were resolved on a 1% agarose gel electrophoresed for 60 min at 120 V in 1x Tris-acetate-EDTA (TAE) buffer and stained with 0.5 µg·mL−1 ethidium bromide. The numbers indicate size markers in kilobase pairs. Please click here to view a larger version of this figure.

Gel electrophoresis results; DNA bands from donor, recipient, transductants; genetic analysis.
Figure 4: Confirming the background of the transductants. Regions of specific genetic elements were amplified from c1673, c1706, and the two transductants, as described previously28, to confirm that the background of the transductants was that of the recipient clone, c1706. The regions chosen were based on the sequences of genes on specific linear or circular plasmids (lp or cp, respectively) within the B. burgdorferi type strain, B316. 1 = BBA60 (lp54), 2 = BBB19 (cp26), 3 = BBE22 (lp25), 4 = BBG13 (lp28-2), 5 = BBI28 (lp28-4), 6 = BBK12 (lp36), 7 = BBS41 (cp32), and 8 = fla gene (chromosome). The amplicons were resolved on a 1% agarose gel electrophoresed for 60 min at 120 V in 1x TAE buffer and stained with 0.5 µg·mL−1 ethidium bromide. The numbers indicate size markers in kilobase pairs. Please click here to view a larger version of this figure.

Discussion

The use of transduction could represent one method of overcoming at least some of the biological and technical barriers associated with the electrotransformation of B. burgdorferi1,4,13,37. In many systems, bacteriophage can move host (non-prophage) DNA between bacterial cells by either generalized or specialized transduction22,23,24,49,50. In specialized transduction, a few host genes are always packaged within the phage capsid along with the prophage DNA49,50. For example, φBB-1 always packages those portions of the cp32 that are bacterial in origin, because they are inextricably linked on the plasmid to the portions of the cp32 that are the phage genome. In generalized transduction, the packaging mechanism of the bacteriophage is believed to latch on to homologous non-phage sequences and "accidentally" package random host DNA instead of phage DNA; these pieces of DNA are then capable of being introduced into another cell49,50. Little is yet known about generalized transduction by phage in B. burgdorferi; however, in better-characterized bacterial systems, as many as 1% of the bacteriophage released from a cell can contain random bacterial genes instead of phage DNA51. Thus far, no chromosomal markers have been observed to be transduced between different B. burgdorferi clones, but the prior demonstration that both cp32s and small heterologous shuttle vectors can be packaged and transduced by φBB-1 indicates that this phage can participate in both specialized and generalized transduction28. Therefore, a use-case for transduction in the laboratory is proposed, in which electrotransformation generating a chromosomal mutation is still done in the background of interest; however, the introduction of shuttle vectors for complementation in trans or for expression studies using reporter constructs into strains recalcitrant to electrotransformation could be done via transduction between a more transformable high-passage clone and less transformable strains. If future studies demonstrate the ability of φBB-1 to also package and move chromosomal loci, then the methods described herein could also prove useful in moving modified chromosomal DNA between more readily transformable strains and strains that are otherwise difficult to electrotransform. The cp32-like plasmids are pervasive among all B. burgdorferi strains and the vast majority of the other Lyme diseases spirochetes52,53; there also is evidence for homologs in other Borrelia species, including B. mayonii, B. miyamotoi, and those that cause relapsing fever54,55,56. Whether the homologs in other Borrelia species also are prophage is not yet known, but if so, then transduction could also be a tool for the molecular dissection of these species, some of which have yet to be successfully genetically manipulated.

Two methods for transducing DNA have been presented here: co-culturing the donor and recipient clones together prior to selection (Figure 1A) or PEG-precipitating phage from the donor and mixing only that phage with the recipient (Figure 1B). The number of transduction events per recipient cell is higher following co-culture than it is using PEG-precipitated phage28, but co-culture requires that both the donor and the recipient carry different antibiotic-resistance markers and that the background of any potential transductants be carefully screened. As the φBB-1 prophage are ubiquitous among the Borrelia52,53, there is a theoretical chance that, when mixing actively growing clones, an antibiotic-resistance marker or other heterologous DNA could move from the recipient to the donor (rather than from the donor to the recipient, as intended). Using PEG-precipitated phage in the transduction assay eliminates this possibility, as the donor is not present in the phage/recipient mix. Additionally, PEG precipitation of the phage is required if the phage and its genomic contents are to be used both for analysis (i.e., structural analysis, quantification, identification of packaged material, etc.) and transduction. Despite these advantages, using PEG-precipitated phage does have its potential drawbacks; in addition to not yielding as many transductants as with co-culture, PEG precipitation can be time-consuming, may lead to significant phage loss, and results in samples that have contaminants that can interfere with downstream applications57,58.

Transduction has been demonstrated from three B. burgdorferi strains thus far: CA-11.2A, a high-passage B31 clone, and a low-passage 297 clone28. Of these three, the B. burgdorferi strain CA-11.2A produces the highest amount of phage following induction25,26,28; however, even following induction, the number of phage recovered from B. burgdorferi is still orders of magnitude lower than the phage recovered in better-characterized systems, such as that of coliphage λ25,28,59. Thus, one issue that may arise in the use of transduction via either co-culture or mixing of phage following PEG precipitation is the small number of bacteriophage that are released from B. burgdorferi, even when exposed to inducing agents. Additionally, batch-to-batch variation in phage production is significant, even when all conditions, media components, and methods seem to be consistent between experiments. For this reason, determining that at least a minimum number of phage are produced from a given clone or under a given condition is important. Traditional assays to determine the number of phage in a sample require mixing a small amount of sample containing phage with a permissive bacterial host in which the bacteriophage is lytic; the number of productive phage particles in the sample is determined by the number of lytic events that occur in that background, resulting in the formation of plaques on a lawn of the bacteria60,61. The number of phage is reported as plaque-forming units (PFUs)61. Quantifying the number of productive φBB-1 released following induction using a plaque assay is hindered by the inability to grow Borrelia burgdorferi in a dense lawn and a current lack of understanding of the mechanisms that control the switch between the lysogenic and lytic replication cycles of φBB-1. Indeed, while anecdotal reports of lysed cultures of B. burgdorferi are numerous, there have, thus far, been no published studies correlating the observation of the lysis of an entire culture with the production of phage. From experience, only a small number of cells in a given culture seem to spontaneously produce phage, presumably by lysis, and this production can be only modestly increased with exposure to the known inducing agents25,28,62. Thus, a plaque assay is currently not possible for quantifying φBB-1 from B. burgdorferi.

To quantify the number of productive phage produced following the induction of B. burgdorferi, the transduction assay as described in this report can be performed using a permissive B. burgdorferi clone with an antibiotic different than that packaged by the bacteriophage. This assay results in colonies that result from transduction, with each colony representing a confirmed phage. Thus, the minimum number of phage in a sample can be reported as CFU rather than PFU. This number is likely (far) lower than the actual total number of phage produced due to inefficiencies inherent in the recovery of phage by PEG precipitation (if used), the attachment and injection of DNA by phage, and the solid-phase plating of B. burgdorferi.

One potential method to determine the total amount of prophage DNA within the supernatants of B. burgdorferi cultures is quantitative PCR (qPCR), but qPCR protocols for cp32 DNA from B. burgdorferi are not well represented in the literature, and qPCR is not yet a methodology widely used for this purpose. To qualitatively determine that there is at least a moderate level of phage DNA in a given sample, the total DNA can be extracted from the PEG-precipitated supernatants of the B. burgdorferi cultures following DNase treatment prior to extraction; the phage DNA will be protected by an intact phage capsid25. The recovered DNA is then resolved in an agarose gel and visualized with a DNA stain; this protocol typically yields a faint 30 kb band representing the linear DNA packaged within the phage head25. Based on the sensitivity of the stain and the intensity of the correctly sized phage DNA band relative to a marker, the approximate number of total phage recovered can be determined25,27. A strong positive correlation of the levels of total phage DNA recovered from the supernatant with the number of transductants recovered following the transduction assay has been demonstrated previously28.

The choice of the donor and recipient strains is critical to the success of the use of transduction as a molecular tool. Our understanding of cp32s as a prophage of φBB-1 is complicated both by the pervasiveness of the cp32s in the Lyme disease spirochetes52,53 and by the fact that an individual B. burgdorferi cell can contain multiple homologs of these plasmids. All the cp32s within a cell appear to be packaged within phage heads in the phage-producing strains that have been examined27. It is not clear, however, whether all the B. burgdorferi strains containing cp32s can produce bacteriophage, and strains should be tested for this ability prior to use. Similarly, nothing is known about the receptors allowing a particular strain to be transduced by φBB-1, although the ubiquity of the prophage plasmid throughout the genus suggests a high likelihood that a particular strain can be transduced. As might be inferred from the presence of multiple cp32 plasmids within an individual B. burgdorferi cell, there does not seem to be any phage immunity63 conferred by the presence of an extant prophage; strains CA.11-2A, B31, and 297 have been used in transduction assays and both produce and can be transduced by φBB-127,28. While previous reports indicated that transduction was possible into only a limited number of strains using PEG-precipitated phage27, that may have been due to technical difficulties with that method, as all the strains tested to date have been successfully transducible using the co-culture method28.

When designing an experiment to use the transduction assay, the major considerations for the choice of donor strain should be the genetic background, its ability to be readily transformed via electroporation, and its ability to produce phage. Although an exhaustive survey of the high-passage clones of every strain has not been done, the strain CA-11.2A produces phage constitutively at detectable levels even in the absence of induction. Similarly, high-passage clones of B31, the first B. burgdorferi strain to be completely sequenced5 and a commonly used strain in molecular studies, also constitutively produce detectable amounts of φBB-1 and are generally highly transformable1,4,25,27,37,64. If investigations require other strains, it is recommended that high-passage clones of that strain first be tested for their transformability by introducing a plasmid containing an antibiotic-resistance marker via electroporation and then assessed for their ability to be transduced by performing a transduction assay with a permissive recipient, such as CA-11.2A or B31, encoding a different antibiotic-resistance marker. Similarly, to ensure that a recipient strain or clone is permissive to transduction, a phage-producing strain, such as CA-11.2A carrying a prophage encoding resistance to an antibiotic, can be mixed with the clone of interest to ensure that transduction occurs.

Much remains to be understood about the molecular biology of φBB-1 and its role in HGT within B. burgdorferi, particularly as it transits the enzootic cycle. The ability of φBB-1 to experimentally transduce both phage and heterologous DNA within the laboratory, however, presents an opportunity to add another tool for the molecular dissection of B. burgdorferi and its role in the pathogenesis of Lyme disease.

Disclosures

The author has nothing to disclose.

Acknowledgements

The author wishes to thank Shawna Reed, D. Scott Samuels, and Patrick Secor for their useful discussion and Vareeon (Pam) Chonweerawong for their technical assistance. This work was supported by the Department of Biomedical Sciences and faculty research grants to Christian H. Eggers from the School of Health Sciences at Quinnipiac University.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1 L filter units (PES, 0.22 µm pore size)Millipore SigmaS2GPU10RE
12 mm x 75 mm tube (dual position cap) (polypropylene)USA Scientific1450-0810holds 4 mL with low void volume (for induction)
15 mL conical centrifuge tubes (polypropylene)USA Scientific5618-8271
1-methyl-3-nitroso-nitroguanidine (MNNG)Millipore SigmaCAUTION: potential carcinogen; no longer readily available, have not tested offered substitute
5.75" Pasteur Pipettes (cotton-plugged/borosilicate glass/non-sterile)Thermo Fisher Scientific13-678-8Aautoclave prior to use
50 mL conical centrifuge tubes (polypropylene)USA Scientific1500-1211
Absolute ethanol
Agarose LEDot Scientific inc.AGLE-500
Bacto NeopeptoneGibcoDF0119-17-9
Bacto TC YeastolateGibco255772
Bovine serum albumin (serum replacement grade)Gemini Bio-Products700-104P
Chloroform (for molecular biology)Thermo Fisher ScientificBP1145-1CAUTION: volatile organic; use only in a chemical fume hood
CMRL-1066 w/o L-Glutamine (powder)US BiologicalC5900-01cell culture grade
ErythromycinResearch Products International CorpE57000-25.0
Gentamicin reagent solutionGibco15750-060
Glucose (Dextrose Anhydrous)Thermo Fisher ScientificBP350-500
HEPESThermo Fisher ScientificBP310-500
Kanamycin sulfateThermo Fisher Scientific25389-94-0
Millex-GS (0.22 µM pore size)Millipore SigmaSLGSM33SSto filter sterilize antibiotics and other small volume solutions
Mitomycin CThermo Fisher ScientificBP25312CAUTION: potential carcinogen; use only in a chemical fume hood
N-acetyl-D-glucosamineMP Biomedicals, LLC100068
Oligonucleotides (primers for PCR)IDT DNA
OmniPrep (total genomic extraction kit)G Biosciences786-136
Petri Dish (100 mm × 15 mm)Thermo Fisher ScientificFB0875712
Petroff-Hausser counting chamberHausser scientificHS-3900
Petroff-Hausser counting chamber cover glassHausser scientificHS-5051
Polyethylene glycol 8000 (PEG)Thermo Fisher ScientificBP233-1
Rabbit serum non-sterile trace-hemolyzed young (NRS)Pel-Freez Biologicals31119-3heat inactivate as per manufacturer's instructions
Semi-micro UV transparent cuvettesUSA Scientific9750-9150
Sodium bicarbonateThermo Fisher ScientificBP328-500
Sodium chlorideThermo Fisher ScientificBP358-1
Sodium pyruvateMillipore SigmaP8674-25G
Spectronic Genesys 5Thermo Fisher Scientific
Streptomycin sulfate solutionMillipore SigmaS6501-50G
Trisodium citrate dihydrateMillipore SigmaS1804-500Gsodium citrate for BSK

References

  1. Samuels, D. S., Drecktrah, D., Hall, L. S. Genetic transformation and complementation. Methods in Molecular Biology. 1690, 183-200 (2018).
  2. Winslow, C., Coburn, J. Recent discoveries and advancements in research on the Lyme disease spirochete Borrelia burgdorferi. F1000Research. 8, F1000 Faculty Rev-763 (2019).
  3. Coburn, J., et al. Lyme disease pathogenesis. Current Issues in Molecular Biology. 42, 473-518 (2021).
  4. Rosa, P. A., Jewett, M. W. Genetic manipulation of Borrelia. Current Issues in Molecular Biology. 42, 307-332 (2021).
  5. Fraser, C. M., et al. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature. 390 (6660), 580-586 (1997).
  6. Casjens, S., et al. A bacterial genome in flux: The twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Molecular Microbiology. 35 (3), 490-516 (2000).
  7. Schutzer, S. E., et al. Whole-genome sequences of thirteen isolates of Borrelia burgdorferi. Journal of Bacteriology. 193 (4), 1018-1020 (2011).
  8. Ohnishi, J., Piesman, J., de Silva, A. M. Antigenic and genetic heterogeneity of Borrelia burgdorferi populations transmitted by ticks. Proceedings of the National Academy of Sciences of the United States of America. 98 (2), 670-675 (2001).
  9. Dykhuizen, D. E., et al. The propensity of different Borrelia burgdorferi sensu stricto genotypes to cause disseminated infections in humans. American Journal of Tropical Medicine and Hygiene. 78 (5), 806-810 (2008).
  10. Hanincova, K., et al. Multilocus sequence typing of Borrelia burgdorferi suggests existence of lineages with differential pathogenic properties in humans. PLoS One. 8 (9), 73066(2013).
  11. Kern, A., et al. Heterogeneity of Borrelia burgdorferi sensu stricto population and its involvement in Borrelia pathogenicity: Study on murine model with specific emphasis on the skin interface. PLoS One. 10 (7), 0133195(2015).
  12. Drecktrah, D., Samuels, D. S. Genetic manipulation of Borrelia spp. Current Topics in Microbiology and Immunology. 415, 113-140 (2017).
  13. Tilly, K., Elias, A. F., Bono, J. L., Stewart, P., Rosa, P. DNA exchange and insertional inactivation in spirochetes. Journal of Molecular Microbiology and Biotechnology. 2 (4), 433-442 (2000).
  14. Lawrenz, M. B., Kawabata, H., Purser, J. E., Norris, S. J. Decreased electroporation efficiency in Borrelia burgdorferi containing linear plasmids lp25 and lp56: Impact on transformation of infectious B. burgdorferi. Infection and Immunity. 70 (9), 4798-4804 (2002).
  15. Samuels, D. S. Electrotransformation of the spirochete Borrelia burgdorferi. Methods in Molecular Biology. 47, 253-259 (1995).
  16. Rego, R. O., Bestor, A., Rosa, P. A. Defining the plasmid-borne restriction-modification systems of the Lyme disease spirochete Borrelia burgdorferi. Journal of Bacteriology. 193 (5), 1161-1171 (2011).
  17. Makarova, K. S., Wolf, Y. I., Koonin, E. V. Comparative genomics of defense systems in archaea and bacteria. Nucleic Acids Research. 41 (8), 4360-4377 (2013).
  18. Grimm, D., Elias, A. F., Tilly, K., Rosa, P. A. Plasmid stability during in vitro propagation of Borrelia burgdorferi assessed at a clonal level. Infection and Immunity. 71 (6), 3138-3145 (2003).
  19. Grimm, D., et al. Experimental assessment of the roles of linear plasmids lp25 and lp28-1 of Borrelia burgdorferi throughout the infectious cycle. Infection and Immunity. 72 (10), 5938-5946 (2004).
  20. Heery, D. M., Powell, R., Gannon, F., Dunican, L. K. Curing of a plasmid from E. coli using high-voltage electroporation. Nucleic Acids Research. 17 (23), 10131(1989).
  21. Ochman, H., Lawrence, J. G., Groisman, E. A. Lateral gene transfer and the nature of bacterial innovation. Nature. 405 (6784), 299-304 (2000).
  22. Morsczeck, C. Strategies for mycobacterial genetics. International Journal of Medical Microbiology. 293 (4), 251-259 (2003).
  23. Thomason, L. C., Costantino, N., Court, D. L. E. coli genome manipulation by P1 transduction. Current Protocols in Molecular Biology. , Chapter 1 1-8 (2007).
  24. Keller, C. M., Kendra, C. G., Bruna, R. E., Craft, D., Pontes, M. H. Genetic modification of Sodalis species by DNA transduction. mSphere. 6 (1), e01331(2021).
  25. Eggers, C. H., Samuels, D. S. Molecular evidence for a new bacteriophage of Borrelia burgdorferi. Journal of Bacteriology. 181 (23), 7308-7313 (1999).
  26. Eggers, C. H., et al. Bacteriophages of spirochetes. Journal of Molecular Microbiology and Biotechnology. 2 (4), 365-373 (2000).
  27. Eggers, C. H., et al. Transduction by φBB-1, a bacteriophage of Borrelia burgdorferi. Journal of Bacteriology. 183 (16), 4771-4778 (2001).
  28. Eggers, C. H., et al. Phage-mediated horizontal gene transfer of both prophage and heterologous DNA by φBB-1, a bacteriophage of Borrelia burgdorferi. Pathogens and Disease. 74 (9), (2016).
  29. Stevenson, B., Miller, J. C. Intra- and interbacterial genetic exchange of Lyme disease spirochete erp genes generates sequence identity amidst diversity. Journal of Molecular Evolution. 57 (3), 309-324 (2003).
  30. Dykhuizen, D. E., Baranton, G. The implications of a low rate of horizontal transfer in Borrelia. Trends in Microbiology. 9 (7), 344-350 (2001).
  31. Brisson, D., Drecktrah, D., Eggers, C. H., Samuels, D. S. Genetics of Borrelia burgdorferi. Annual Reviews in Genetics. 46, 515-536 (2012).
  32. Brisson, D., Zhou, W., Jutras, B. L., Casjens, S., Stevenson, B. Distribution of cp32 prophages among Lyme disease-causing spirochetes and natural diversity of their lipoprotein-encoding erp loci. Applied and Environmental Microbiology. 79 (13), 4115-4128 (2013).
  33. Schwartz, I., Margos, G., Casjens, S. R., Qiu, W. G., Eggers, C. H. Multipartite genome of Lyme disease Borrelia: Structure, variation and prophages. Current Issues in Molecular Biology. 42, 409-454 (2021).
  34. Centers for Disease Control and Prevention. Biosafety in Microbiological and Biomedical Laboratories,. 6th edition. , Centers for National Institutes of Health. Bethesda, Maryland. (2020).
  35. Yang, X. F., Pal, U., Alani, S. M., Fikrig, E., Norgard, M. V. Essential role for OspA/B in the life cycle of the Lyme disease spirochete. Journal of Experimental Medicine. 199 (5), 641-648 (2004).
  36. Lee, S. K., Yousef, A. E., Marth, E. H. Thermal inactivation of Borrelia burgdorferi, the cause of Lyme disease. Journal of Food Protection. 53 (4), 296-299 (1990).
  37. Seshu, J., Moy, B. E., Ingle, T. M. Transformation of Borrelia burgdorferi. Current Protocols. 1 (3), 61(2021).
  38. Purser, J. E., Norris, S. J. Correlation between plasmid content and infectivity in Borrelia burgdorferi. Proceedings of the National Academy of Sciences of the United States of America. 97 (25), 13865-13870 (2000).
  39. Labandeira-Rey, M., Seshu, J., Skare, J. T. The absence of linear plasmid 25 or 28-1 of Borrelia burgdorferi dramatically alters the kinetics of experimental infection via distinct mechanisms. Infection and Immunity. 71 (8), 4608-4613 (2003).
  40. Ruzic-Sabljic, E., et al. Comparison of MKP and BSK-H media for the cultivation and isolation of Borrelia burgdorferi sensu lato. PLoS One. 12 (2), 0171622(2017).
  41. Wang, G., et al. Variations in Barbour-Stoenner-Kelly culture medium modulate infectivity and pathogenicity of Borrelia burgdorferi clinical isolates. Infection and Immunity. 72 (11), 6702-6706 (2004).
  42. Bono, J. L., et al. Efficient targeted mutagenesis in Borrelia burgdorferi. Journal of Bacteriology. 182 (9), 2445-2452 (2000).
  43. Elias, A. F., et al. New antibiotic resistance cassettes suitable for genetic studies in Borrelia burgdorferi. Journal of Molecular Microbiology and Biotechnology. 6 (1), 29-40 (2003).
  44. Frank, K. L., Bundle, S. F., Kresge, M. E., Eggers, C. H., Samuels, D. S. aadA confers streptomycin resistance in Borrelia burgdorferi. Journal of Bacteriology. 185 (22), 6723-6727 (2003).
  45. Sartakova, M. L., et al. Novel antibiotic-resistance markers in pGK12-derived vectors for Borrelia burgdorferi. Gene. 303 (1-2), 131-137 (2003).
  46. Wormser, G. P., et al. The clinical assessment, treatment, and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: Clinical practice guidelines by the Infectious Diseases Society of America. Clinical Infectious Diseases. 43 (9), 1089-1134 (2006).
  47. Terekhova, D., Sartakova, M. L., Wormser, G. P., Schwartz, I., Cabello, F. C. Erythromycin resistance in Borrelia burgdorferi. Antimicrobial Agents and Chemotherapy. 46 (11), 3637-3640 (2002).
  48. Sorbye, H., Kvinnsland, S., Svanes, K. Penetration of N-methyl-N'-nitro-N-nitrosoguanidine to proliferative cells in gastric mucosa of rats is different in pylorus and fundus and depends on exposure time and solvent. Carcinogenesis. 14 (5), 887-892 (1993).
  49. Muniesa, M., Imamovic, L., Jofre, J. Bacteriophages and genetic mobilization in sewage and faecally polluted environments. Microbial Biotechnology. 4 (6), 725-734 (2011).
  50. Penades, J. R., Chen, J., Quiles-Puchalt, N., Carpena, N., Novick, R. P. Bacteriophage-mediated spread of bacterial virulence genes. Current Opinion in Microbiology. 23, 171-178 (2015).
  51. Thierauf, A., Perez, G., Maloy, A. S. Generalized transduction. Methods in Molecular Biology. 501, 267-286 (2009).
  52. Casjens, S. R., et al. Plasmid diversity and phylogenetic consistency in the Lyme disease agent Borrelia burgdorferi. BMC Genomics. 18 (1), 165(2017).
  53. Ojaimi, C., et al. Borrelia burgdorferi gene expression profiling with membrane-based arrays. Methods in Enzymology. 358, 165-177 (2002).
  54. Stevenson, B., et al. The relapsing fever spirochete Borrelia hermsii contains multiple, antigen-encoding circular plasmids that are homologous to the cp32 plasmids of Lyme disease spirochetes. Infection and Immunity. 68 (7), 3900-3908 (2000).
  55. Kingry, L. C., et al. Whole genome sequence and comparative genomics of the novel Lyme borreliosis causing pathogen, Borrelia mayonii. PLoS One. 11 (12), 0168994(2016).
  56. Kuleshov, K. V., et al. Whole genome sequencing of Borrelia miyamotoi isolate Izh-4: Reference for a complex bacterial genome. BMC Genomics. 21 (1), 16(2020).
  57. Dong, D., Sutaria, S., Hwangbo, J. Y., Chen, P. A simple and rapid method to isolate purer M13 phage by isoelectric precipitation. Applied Microbiology and Biotechnology. 97 (18), 8023-8029 (2013).
  58. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7(2015).
  59. Patterson, T. A., Dean, M. Preparation of high titer lambda phage lysates. Nucleic Acids Research. 15 (15), 6298(1987).
  60. Ackermann, H. W., et al. Guidelines for bacteriophage characterization. Advances in Virus Research. 23, 1-24 (1978).
  61. Anderson, B., et al. Enumeration of bacteriophage particles: Comparative analysis of the traditional plaque assay and real-time QPCR- and nanosight-based assays. Bacteriophage. 1 (2), 86-93 (2011).
  62. Eggers, C. H., Casjens, S., Samuels, D. S. Bacteriophages of Borrelia burgdorferi and Other Spirochetes. The Spirochetes: Molecular and Cellular Biology. Saier, M. H., Garcia-Lara, J. , Horizon Scientific Press. Wymondham, UK. Chapter 4 35-44 (2001).
  63. Birge, E. A. Bacterial and Bacteriophage Genetics,. 5th edition. , Springer. New York, NY. (2010).
  64. Eggers, C. H., et al. Identification of loci critical for replication and compatibility of a Borrelia burgdorferi cp32 plasmid and use of a cp32-based shuttle vector for the expression of fluorescent reporters in the Lyme disease spirochaete. Molecular Microbiology. 43 (2), 281-295 (2002).

Reprints and Permissions

Tags

Phage TransductionDNA IntroductionElectroporation AlternativeShuttle VectorsAntibiotic Resistance MarkersPEG PrecipitationStrain-Specific Markers