Summary
Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved.
Abstract
Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for use as a chassis for synthetic biological endeavors within the gastrointestinal tract. The wide phenotypic and genotypic variation observed within the genus led to a recent reclassification and the introduction of 23 novel genera.
Due to the breadth of variations within the old genera, protocols demonstrated in one member may not work as advertised with other members. A lack of centralized information on how exactly to manipulate specific strains has led to a range of ad hoc approaches, often adapted from other bacterial families. This can complicate matters for researchers starting in the field, who may not know which information does or does not apply to their chosen strain.
In this paper, we aim to centralize a set of protocols with demonstrated success, specifically in the Limosilactobacillus reuteri strain designation F275 (other collection numbers: DSM20016, ATCC23272, CIP109823), along with troubleshooting advice and common issues one may encounter. These protocols should enable a researcher with little to no experience working with L. reuteri DSM20016 to transform a plasmid, confirm transformation, and measure system feedback in a plate reader via a reporter protein.
Introduction
The genus Lactobacillus were historically classified as gram-positive, rod-shaped, non-spore-forming, either facultative anaerobes or microaerophiles that break sugars down to primarily produce lactic acid1. These loose criteria led to Lactobacillus being, phenotypically and genotypically, an extremely diverse genus. This broad categorization resulted in the genus being reclassified, introducing 23 novel genera in 20202.
The old, broader genus included major commensal and probiotic species generally regarded as safe (GRAS) for consumption3. The Lactobacillaceae family maintains a public perception of being 'good bacteria' due to many reported health benefits bestowed via the consumption of various strains4,5,6,7. The ease with which they can navigate the gastrointestinal tract8 and their public acceptance combine to position Lactobacillaceae strains as strong candidates as chassis organisms for ingestible medicinal, therapeutic, or diagnostic applications.
The wide range of characteristics present within the Lactobacillaceae family has led to a situation in which there is no de facto model-organism strain; research groups have tended to select species with the properties most relevant to their particular aims. (For example, dairy fermentation labs could choose L. lactis; studies of vegetable fermentation might select L. plantarum; research on probiotics might focus on L. acidophilus; and so on.)
This same wide range of characteristics across species has led to an accumulation of protocols and procedures that may work well for one subset of the Lactobacillaceae family, but require optimization to work efficiently (or perhaps to function at all) in others9. This need for optimization between family members and even within members of the same species can frustrate the efforts of unfamiliar researchers. Protocols published in the methods sections of papers can also include their own modifications10, leading to fragmented, decentralized protocol collections.
L. reuteri is considered a widely vertebrate commensal, found consistently in mammalian, avian11 and fish12 gastrointestinal (GI) tracts. L. reuteri sub-strains are often genetically specialized, via mucus adhesion protein adaptation, to more permanently colonize specific native hosts8,11,13. GI tract Limosilactobacillus species can be isolated in hosts outside their native host, but tend more toward a transient nature8.
Due to human-host specialization, L. reuteri DSM20016 positions itself very well as a chassis for diagnostic or therapeutic applications at any point in the human GI tract, and the strain DSM20016 could provide a longer-lasting window of effect for interventions when compared to more transitory strains.
In this paper, we outline a series of protocols with demonstrated effectiveness in Limosilactobacillus reuteri (strain designation: F275; other collection numbers: DSM20016, ATCC23272, CIP109823), along with centralized information on the strain from other sources to aid in molecular and systems biology applications. Procedures laid out herein should enable a researcher with no prior experience to culture L. reuteri, create electrocompetent stocks, select transformed colonies, confirm transformation via colony polymerase chain reaction (PCR), and measure designed system response via fluorescent reporter proteins.
We note that related protocols have covered CRISPR-Cas9 assisted ssDNA genome recombineering in L. reuteri (strain: ATCC-PTA-6475)14, and CRSIPR-Cas9 nickase-assisted genome editing in multiple non-L. reuteri, Lactobacillaceae family stains15,16; these do not, however, address the L. reuteri DSM20016 strain that is our focus here.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
1. Preparing L. reuteri DSM20016 electrocompetent cells
NOTE: This is based on a protocol by Berthier et al.17, with centrifugation speeds informed by Rattanachaikunsopon et al.18.
- In a 50 mL centrifuge tube, inoculate L. reuteri from glycerol stock into 6 mL of deMan Rogosa Sharpe (MRS) broth. Incubate aerobically overnight at 37 °C in a static incubator.
- The next morning, inoculate 4 mL of the overnight culture into 200 mL of MRS broth (1:50 dilution).
- Allow to grow aerobically in a static 37 °C incubator until the 600 nm optical density value (OD600) reaches 0.5-0.85; this should take roughly 2-3 h.
- As soon as an adequate OD600 value is reached, decant the media into 50 mL centrifuge tubes and place on ice while balancing the tubes.
- Centrifuge for 5 min at 5,000 x g in a pre-chilled, 4 °C centrifuge.
- Discard the supernatant, resuspend each pellet in 50 mL of pre-chilled (0 °C to 4 °C) ddH2O, and centrifuge again with the same settings as the previous step. Keep the cells on ice as much as possible.
- Repeat step 1.6.
- Resuspend each pellet in 25 mL of ddH2O: 0.5 M sucrose, 10% glycerol. Centrifuge at 5,000 x g at 4 °C for 10 min. Discard the supernatant and put the cells back on ice.
- Resuspend all the pellets in the same 2 mL of ddH2O: 0.5 M sucrose, 10% glycerol.
- Aliquot into 50 µL to 100 µL portions in pre-chilled microcentrifuge tubes; store at -80 °C for later use.
2. Electroporation of L. reuteri
NOTE: Avoid pipetting as much as possible in the following steps. Inclusion of a control electroporation, with no plasmid added, is advised to ensure the antibiotic selection is adequate.
- Take an entire electrocompetent L. reuteri aliquot and thaw it on ice.
- Gently mix 5 µL to 10 µL of plasmid (final plasmid concentration >6 nM) into the thawed aliquot, avoiding pipetting as much as possible.
- Transfer to an ice-chilled, 1 mm gap electroporation cuvette.
- Electroporate at 1.25 kV, 400 Ω, and 25 µF.
- Add 1 mL of room temperature (RT) MRS broth and mix by inverting the cuvette once or twice.
- Place the cuvettes into a static incubator at 37 °C for 2.5-3 h to allow for recovery.
- Plate the entire amount onto multiple MRS agar plates with appropriate selection.
- Place the plates inside a completely airtight container with a small lit candle ("tealight") and an anaerobic atmosphere-generating sachet.
- Grow at 37 °C for 2-3 days or until visible colonies are present.
3. Measurement of the acid-resistant fluorescent reporter protein mCherry2
- Pick any colonies required for measurement and inoculate into a 96-well storage microplate with 1.5 mL of filter sterilized (non-autoclaved) MRS broth per well and an appropriate selection antibiotic.
- Incubate aerobically for 24 h overnight at 37 °C without shaking.
NOTE: This storage microplate should be kept for use in section 4 (colony PCR). - L. reuteri will precipitate out of the media when in the stationary phase; resuspend the overnight culture via pipetting.
- Transfer 200 µL into a flat, clear-bottom, 96-well plate, transfer the plate to a plate reader, and measure the OD and fluorescence of mCherry2 (excitation [Ex]: 589 nm; emission [Em]: 610 nm) or other relevant reporters.
4. Confirmation of plasmid uptake via colony PCR
- From the 96-well storage microplate from section 3, transfer 5 µL to a PCR tube.
NOTE: If >5 min have passed, it may be necessary to resuspend the L. reuteri a second time. - In a portable benchtop microcentrifuge, spin down until the pellet can be seen (roughly 2 min at 2,000 x g), discard the supernatant, and resuspend the pellet in 20 µL of 20 mM NaOH.
- Boil at 95 °C for 5 min, vortex, and repeat the boil a second time.
- Immediately chill the samples; try to keep the samples on ice as much as possible in the following steps to lower the likelihood of template degradation and PCR inhibition.
- Spin down in a portable benchtop microcentrifuge at 2,000 x g for 2 min until the cell debris is pelleted, then take 1 µL of the supernatant and dilute into 99 µL of ice-cold DNase- and RNase-free ddH2O (100x dilution).
- Use the 100x dilution as the template DNA in a standard PCR reaction using plasmid-specific primers. Include a positive control with a plasmid derived from the E. coli mini-prep.
- Return the samples on ice and add an appropriate loading dye at a 1x concentration.
- Run in 1% agarose gel in TAE buffer (tris-acetate-ethylenediaminetetraacetic acid [EDTA]) at 110 V for 30 min. Image if necessary.
5. Mini-prep protocol for L. reuteri , followed by PCR to confirm plasmid presence
NOTE: Protocol intended for use with the mini-prep kit listed in the Table of Materials.
- Inoculate L. reuteri into 10 mL of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 °C in a static incubator.
- Centrifuge at 5,000 x g for 10 min in a pre-chilled 4 °C centrifuge.
- Wash the pellet in 2 mL of standard P1 buffer (included with the kit) in order to negate acidity that may interfere with later steps, centrifuge with the same setting as previously described, and discard the supernatant.
- Resuspend the pellet in 250 µL of modified P1 buffer containing 10 mg/mL lysozyme and 100 U/mL mutanolysin in order to lyse bacterial cells. Incubate for 1-2 h at 37 °C.
- Add 250 µL of buffer P2, mix by inverting four to six times, and incubate at RT for no longer than 5 min.
- Add 350 µL of buffer N3 (included with the kit) and immediately invert four to six times gently to mix.
- Centrifuge at 10,000 x g for 10 min.
- Transfer as much supernatant as possible to a spin column and centrifuge at 10,000 x g for 60 s. Discard the flow through.
- Wash the spin column with 500 µL of buffer PB (included with the kit) and centrifuge at 10,000 x g for 60 s. Discard the flow through.
- Wash the spin column with 750 µL of buffer PE (included with the kit), and centrifuge at 10,000 x g for 60 s. Discard the flow through and centrifuge for 60 s to remove any residual buffer.
- Place the spin column in a 1.5 mL microcentrifuge tube. Apply 20-30 µL of DNAse- and RNAse-free ddH2O to the filter of the spin column and leave for 1-2 min, before centrifuging at 10,000 x g for 60 s.
- Perform a standard PCR reaction using plasmid-specific primers (pTRKH3_pTUSeq_F: CACCCGTTCTCGGAGCA, pTRKH3_pTUSeq_R: CTACGAGTTGCATGATAAAGAAGACA), with eluate providing the template DNA. Include a positive control with a plasmid derived from the E. coli mini-prep.
NOTE: The PCR settings used in this study are: 98 °C for 5 min, (98 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s) 30 cycles, 72 °C for 2 min, 4 °C hold. The parameters are highly dependent on the polymerase used, fragment length, and exact primers used by any person utilizing this protocol.
Subscription Required. Please recommend JoVE to your librarian.
Representative Results
Transformation efficiencies
L. reuteri does not require a dcm-/dam- non-methylated plasmid, as observed for other Lactobacillaceae19,20 (see Figure 1). Electroporation of L. reuteri DSM20016 with 10 µL of the 8.5 kb plasmid pTRKH3_mCherry2 (pAMβ1 theta origin of replication) should give transformation efficiencies of roughly 80 colony forming units (CFU)/µg (five to eight colonies per 200 µL plated), regardless of the plasmid methylation condition. With selective curing and retransformation, it is possible to obtain mutated L. reuteri strains with far greater transformation efficiencies21, observed with pTRKH3_mCherry2 of roughly 4 x 103 CFU/µg (200-250 colonies per 200 µL plated), allowing for higher-throughput applications. Similar results were also observed for the reporter mTFP1. Transformations were also carried out with pNZ123 (pSH71 rolling circle origin), carrying no exogenous constitutive reporter protein, resulting in transformation efficiencies of 3 x 104 CFU/µg DNA (Supplementary Figure 1).
Figure 1: Electroporation efficiencies. Totals of 10 nM pTRKH3_mTFP1 and 80 nM pTRKH3_mCherry2 plasmid stocks were obtained from two sources: DH10β E. coli and dcm-/dam- methylase knockout E. coli. L. reuteri was then electroporated with 10 µL of the two different methylation pattern plasmids and the colonies counted. Error bars denote standard deviation. Please click here to view a larger version of this figure.
Transformation growth conditions
L. reuteri is aero-tolerant and can be grown in broth and on agar in normal atmospheric conditions. However, transformation success relies heavily on the generation of an anaerobic growth environment when plated; it is perhaps the most important condition for transformation success. O2 leaks can be detected by including a plate of non-transformed L. reuteri. Colony morphology noticeably changes in the presence of oxygen (see Figure 2); alternatively, anaerobic indicators can be used (see Table of Materials).
Figure 2: L. reuteri colony morphology. Colonies transformed with the pTRKH3_mCherry2 plasmid. (A) Undercorrect low-O2 conditions, colonies appear white, opaque, smooth, round, convex, and shiny. (B) Under partial or leaky O2 conditions, colonies appear white, opaque, undulate (wavy), round, umbonate (rounded/knobby), and shiny. (C) L. reuteri colonies with no plasmid transformation under atmospheric O2 levels. The colonies appear either opaque or translucent and either umbonate or flat; they always appear lobate, round, and dry. Please click here to view a larger version of this figure.
Reporter protein measurement
Wild-type L. reuteri DSM20016 reporter protein expression and growth vary between colonies (see Figure 3A), making accurate deductions on system activity difficult. It is possible to select and cure correctly transformed wild-type L. reuteri DSM20016; retransformation may give rise to strains with mutations enabling greater transformation efficiency. One strain developed via this method appeared far more stable in terms of reporter protein expression (see Figure 3B). It is advisable that such mutations be sought, via plasmid curing and retransformation, before carrying out work requiring tuned protein expression.
Figure 3: Growth, reporter fluorescence, and colony PCR outcomes for transformed L. reuteri. Both experiments use pTRKH3_mCherry2 plasmid at 80 nM. (A,B) Each column across each of the three sub-plots refers to the same colony's OD value, fluorescence value (Ex: 589 nm; Em: 610 nm), and PCR result (solid block indicates correct band observed).(A) All colonies from L. reuteri DSM20016 transformation picked (control transformation = zero colonies). Colonies incubated in filtered MRS broth for 24 h before measurement at gain 100. (B) A total of 88 colonies picked from the L. reuteri DSM20016 strain selected for higher transformation efficiencies, more consistent reporter protein production, and lower PCR inhibition (control transformation = zero colonies). Colonies incubated in filtered MRS broth for 24 h before measurement at gain 200. Controls are in blue, C = non-transformed DSM20016 cell control, M = filtered MRS broth only media control, and error bars denote standard deviation. Please click here to view a larger version of this figure.
Colony PCR
Colony PCR should not be used as the sole means of deducing correct transformation, as they can be unreliable even when samples are diluted and kept chilled (see Figure 4). If the no-plasmid control included with transformations exhibits zero colonies, it implies that all colonies have the plasmid carrying antibiotic resistance. However, if colony PCR is required, the optimized conditions set out here can greatly increase success.
Figure 4: Colony PCR of transformed L. reuteri. (A) L. reuteri DSM20016 colonies were screened for positive PCR bands; six were obtained and inoculated into fresh autoclaved MRS broth. Samples of 5 µL taken at various time points after inoculation were subject to PCR again at the indicated levels of dilution. Colors in each time/dilution box indicate the success of the PCR recovery: green = correct band observed; red = no band observed. (B) Results for a fixed 100x dilution show that varying the preparation temperature resulted in differing rates of PCR success: samples were prepared on ice and PCR-ed immediately (89.77%), prepared at room temperature and PCR-ed immediately (75%), or prepared at RT then incubated at 37 °C for 30 min before PCR (27.27%). (C) (1) Eight positive 100x dilution samples (R1-8) from the RT condition. (2) After being left at RT for 48 h, the samples were PCR-ed a second time, showing an absence of the bands at ~1.1 kb; positive and negative controls (lanes +/-) are the right-most lanes in C (2). The ladder used was 1 kb plus the DNA ladder, listed in the Table of Materials. Please click here to view a larger version of this figure.
L. reuteri mini-prep
Mini-prep for L. reuteri is limited and intended only as an alternative plasmid transformation confirmation method. A previous publication noted some strains are more effectively lysed by mutanolysin22; dual lysozyme-mutanolysin action was found to be the most effective for L. reuteri DSM20016. Running the mini-prep eluate through an agarose gel results in a smear rather than observable bands. Subsequent PCR should, however, produce expected band sizes (see Figure 5).
Figure 5: Agarose gel electrophoresis of PCR and mini-prep products. The same six colonies from Figure 4A were mini-prepped using the protocol set out in this paper. (Bottom row) Mini-prep eluate shows a smear. (Top row) After PCR was carried out using the eluant as a DNA template, clear positive bands are observed. The ladder used was 1 kb plus the DNA ladder, listed in the Table of Materials. Please click here to view a larger version of this figure.
Supplementary Figure 1: Transformation efficiencies of L. reuteri DSM20016 with pNZ123 plasmid. Transformations carried out with pNZ123 (pSH71 rolling circle origin), carrying no exogenous constitutive reporter protein. Please click here to download this File.
Supplementary File 1: CAD files for anaerobic chambers. Sheet 1: Base drawing; Sheet 2: Long wall drawing; Sheet 3: Small wall drawing; Sheet 4: Top drawing; Sheet 5: Lid drawing; Sheet 6: Lock lip drawing; Sheet 7: Clamp bar drawing; Sheet 8: Clamp plate drawing; Sheet 9: Assembly overview; Sheet 10: Overview with numbered parts. Please click here to download this File.
Subscription Required. Please recommend JoVE to your librarian.
Discussion
The most critical step for the transformation of L. reuteri DSM20016 is the generation of anaerobic growth conditions after transformations are plated; colonies gained in aerobic conditions are only very occasional and generally fail to grow when inoculated in MRS broth. Plating the entire recovery volume should also be practiced to maximize the probability of colony growth. Even with these two critical steps, transformation efficiency is still a limitation on experimentation, as expected colonies can number as low as one or two per plate during transformations (see Figure 1).
Commercial food containers were initially used and found to be insufficient for consistent O2 exclusion. CAD files for anaerobic chambers designed by the university's machine shop can be found in Supplementary File 1. Since these boxes can occasionally have air infiltration through small gaps in joinery, it is advised to fill them with water (unsealed) to check for any leaks prior to first use; subsequent checks are generally not necessary. These boxes should have O2 replacement systems rather than O2 sequestering systems, as they have not been tested for pressurization.
Media issues can arise; autoclaved MRS broth is selective but possesses highly auto-fluorescent properties, hampering the measurement of low fluorescent readings. Modification to use filter sterilized MRS broth ameliorates this issue, but is less selective. L. reuteri lowers the pH of the media to around pH 4 after 24 h (see Figure 6), so the media requires buffering to detect acid-sensitive GFP23. We modified this protocol to use more acid-resistant mCherry2 instead, avoiding this issue.
Figure 6: pH over time of L. reuteri in MRS broth. L. reuteri DSM20016 lowers pH over time (dashed line); the pKa value indicates the pH at which the reporter protein fluorescence would be 50% of the maximum value due to acidity (horizontal lines). EGFP pKa = 6, mTFP1 pKa = 4.3, mCherry2 pKa = 3.3. Each reporter protein has reporter effectiveness reduced to 50% of the maximal fluorescence at different time points due to their acid sensitivities when produced within increasingly acidic L. reuteri (vertical lines). Please click here to view a larger version of this figure.
L. reuteri DSM20016 appears to inhibit colony PCR efforts, severely limiting the usefulness of this procedure. As little as 30 min at 37 °C after step 4.3 can increase the PCR failure rate, while 48 h at RT results in complete PCR failure (see Figure 4B,C). The modification to dilute the samples and keep the samples on ice at all times is critical to increasing colony PCR success.
Much remains unknown about the internal functions of L. reuteri DSM20016. Transformation control plates with no plasmid added during electroporation, showing zero colonies, should imply that any colonies present in the plasmid condition possess the plasmid. However, subsequent colony PCR has been shown to not reliably confirm plasmid uptake even with modifications. This could be due to restriction endonucleases degrading PCR DNA fragments. Endonucleases have been encountered in other Lactobacillaceae species and overcome via the use of dam-/dcm-E.coli19,20. L. reuteri DSM20016 does have several putative restriction-modification enzymes annotated via computational analysis24. Transformation efficiencies of DSM20016 could potentially be raised further if its restriction modification (RM) enzyme recognition sites could be characterized and avoided. Further investigation is needed.
The modified electroporation method set out in this paper offers a less complex, more modern alternative to a method previously described for L. reuteri DSM20016 by Ahrne et al.25. This paper investigates significant stipulations made by Ahrne et al. regarding dam-/dcm- methylation requirements for plasmid uptake, which have not been corroborated. The transformation method set out in this paper also emphasizes the critical anaerobic growth requirement after plating, not explicitly conveyed by Ahrne et al.
Some methods and approaches set out herein can be used in future applications to aid other Lactobacillaceae family manipulation attempts, notably: the inclusion of transformation control plates, use of the acid-resistant reporter mCherry2, colony PCR temperature requirements, and mini-prep mutanolysin inclusion. However, some may still need modifications to work optimally in other strains.
L. reuteri DSM20016 is of clinical and agricultural importance due to its position not only as a generic vertebrate commensal (with potential uses as an additive in livestock feed), but also as one of a very small number of Lactobacillaceae-family strains intrinsically associated with the human gut environment8. Efficient manipulation of this microbe will open it up as a chassis for the future delivery of novel therapies within the GI tract and noninvasive monitoring of inflammatory conditions. In this article, these methods have been explicitly collated and collectively demonstrated with modifications for, specifically, the non-model L. reuteri strain DSM20016.
Subscription Required. Please recommend JoVE to your librarian.
Disclosures
No conflicts of interest exist.
Acknowledgments
We greatly appreciate the valuable advice provided by Prof. J.P. van Pijkeren (University of Wisconsin-Madison), whose guidance on working with L. reuteri ATCC PTA 6475 provided a foundation for the methods described here.
Materials
| Name | Company | Catalog Number | Comments |
| 1 kb Plus DNA Ladder | NEB | N3200L | |
| 1mL Spectrophotometer cuvettes | Thomas Scientific | 1145J12 | |
| Agarose | BioShop | AGR001 | |
| Allegra X-15R (refrigerated centrifuge) | Beckman Allegra | N/A | No longer in production |
| AnaeroGen 2.5 L Sachet | Thermo Scientific | OXAN0025A | |
| BTX, ECM 399 electroporation system | VWR | 58017-984 | |
| Centrifuge tubes (50 mL) | FroggaBio | TB50-500 | |
| DNA gel x6 loading dye | NEB | B7024S | |
| Electroporation cuvette | Fisherbrand | FB101 | |
| Erythromycin | Millipore Sigma | E5389-5G | |
| Gel electroporation bath/dock | VWR | 76314-748 | |
| Glycerol | BioShop | GLY001 | |
| Limosilactobacillus reuteri | Leibniz Institute DSMZ | DSM20016 | Strain designation F275 |
| Lysozyme | BioShop | LYS702.5 | |
| Microcentrifuge tubes (1.7 mL) | FroggaBio | LMCT1.7B | |
| Miniprep kit (Qiagen) | Qiagen | 27106 | slpGFP replaced with constitutive, codon optimised, mCherry2 reporter protein |
| MRS Broth (Dehydrated) | Thermo Scientific | CM0359B | |
| Mutanolysin | Millipore Sigma | M9901-5KU | |
| NaOH | Millipore Sigma | 1064691000 | |
| P100 Pipette | Eppendorf | 3123000047 | |
| P1000 Pipette | Eppendorf | 3123000063 | |
| P2.5 Pipette | Eppendorf | 3123000012 | |
| P20 Pipette | Eppendorf | 3123000039 | |
| P200 Pipette | Eppendorf | 3123000055 | |
| PCR tubes | FroggaBio | STF-A120S | |
| Personal benchtop microcentrifuge | Genlantis | E200100 | |
| Petri dishes | VWR | 25384-088 | |
| PTC-150 Thermal Cycler | MJ Research | N/A | No longer in production |
| pTRKH3_slpGFP (modified) | Addgene | 27168 | |
| SPECTRONIC 200 Spectrophotometer | Thermo Scientific | 840-281700 | |
| Storage microplate | Fisher Scientific | 14-222-225 | |
| Sucrose | BioShop | SUC507 | |
| TAE Buffer 50x | Thermo Scientific | B49 | |
| Vortex | VWR | 58816-121 | No longer in production |
| VWR 1500E incubator | VWR | N/A | No longer in production |
References
- Makarova, K., et al. Comparative genomics of the lactic acid bacteria. Proceedings of the National Academy of Sciences. 103 (42), 15611-15616 (2006).
- Zheng, J., et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. International Journal of Systematic and Evolutionary Microbiology. 70 (4), 2782-2858 (2020).
- Adams, M. R., Marteau, P. On the safety of lactic acid bacteria from food. International Journal of Food Microbiology. 27 (2-3), 263-264 (1995).
- Urbańska, M., Gieruszczak-Białek, D., Szajewska, H. Systematic review with meta-analysis: Lactobacillus reuteri DSM 17938 for diarrhoeal diseases in children. Alimentary Pharmacology and Therapeutics. 43 (10), 1025-1034 (2016).
- Jansson, P. A., et al. Probiotic treatment using a mix of three Lactobacillus strains for lumbar spine bone loss in postmenopausal women: a randomised, double-blind, placebo-controlled, multicentre trial. The Lancet Rheumatology. 1 (3), e154-e162 (2019).
- Yang, C., et al. Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacterpylori eradication: A randomized double-blind placebo-controlled trial. Helicobacter. 26 (6), 12856 (2021).
- Nikawa, H., et al. Lactobacillus reuteri in bovine milk fermented decreases the oral carriage of mutans streptococci. International Journal of Food Microbiology. 95 (2), 219-223 (2004).
- Reuter, G. The Lactobacillus and Bifidobacterium microflora of the human intestine: Composition and succession. Current Issues in Intestinal Microbiology. 2 (2), 43-53 (2001).
- Aukrust, T. W., Brurberg, M. B., Nes, I. F.
- Lubkowicz, D., et al. Reprogramming probiotic Lactobacillus reuteri as a biosensor for Staphylococcus aureus derived AIP-I detection. ACS Synthetic Biology. 7 (5), 1229-1237 (2018).
- Walter, J., Britton, R. A., Roos, S. Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm. Proceedings of the National Academy of Sciences. 108, 4645-4652 (2011).
- Ahmad, W., et al. Production of bimodal molecular weight levan by a Lactobacillus reuteri isolate from fish gut. Folia Microbiologica. 67 (1), 21-31 (2022).
- MacKenzie, D. A., et al. Strain-specific diversity of mucus-binding proteins in the adhesion and aggregation properties of Lactobacillus reuteri. Microbiology. 156 (11), 3368-3378 (2010).
- Oh, J. H., van Pijkeren, J. P.
- Song, X., Huang, H., Xiong, Z., Ai, L., Yang, S. CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei. Applied and Environmental Microbiology. 83 (22), e01259 (2017).
- Goh, Y. J., Barrangoua, R. Portable CRISPR-Cas9N system for flexible genome engineering in Lactobacillus acidophilus, Lactobacillus gasseri, and Lactobacillus paracasei. Applied and Environmental Microbiology. 87 (6), e02669 (2021).
- Berthier, F., Zagorec, M., Champomier-Verg, M., Ehrlich, S. D., Morel-Devillel, F. Efficient transformation of Lactobacillus sake by electroporation. Microbiology. 142 (5), 1273-1279 (1996).
- Rattanachaikunsopon, P., Phumkhachorn, P. Glass bead transformation method for gram-positive bacteria. Brazilian Journal of Microbiology. 40 (4), 923 (2009).
- Pflügl, S., Marx, H., Mattanovich, D., Sauer, M.
- Spath, K., Heinl, S., Grabherr, R. Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete. Microbial Cell Factories. 11, 141 (2012).
- Ortiz-Velez, L., et al. Genome alterations associated with improved transformation efficiency in Lactobacillus reuteri. Microbial Cell Factories. 17 (1), 138 (2018).
- O'Sullivan, D. J., Klaenhammer, T. R. Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp. Applied and Environmental Microbiology. 59 (8), 2730-2733 (1993).
- Lizier, M., Sarra, P. G., Cauda, R., Lucchini, F. Comparison of expression vectors in Lactobacillus reuteri strains. FEMS Microbiology Letters. 308 (1), 8-15 (2010).
- Roberts, R. J., Vincze, T., Posfai, J., Macelis, D. REBASE-a database for DNA restriction and modification: Enzymes, genes and genomes. Nucleic Acids Research. 43, Database issue D298-D299 (2015).
- Ahrne, S., Molin, G., Axelsson, L. Transformation of Lactobacillus reuteri with electroporation: Studies on the erythromycin resistance plasmid pLUL631. Current Microbiology. 24, 199-205 (1992).
