A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016

5.2K views

⸱

DOI:

10.3791/65463

⸱

June 23rd, 2023

In This Article

Summary

Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved.

Abstract

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for use as a chassis for synthetic biological endeavors within the gastrointestinal tract. The wide phenotypic and genotypic variation observed within the genus led to a recent reclassification and the introduction of 23 novel genera.

Due to the breadth of variations within the old genera, protocols demonstrated in one member may not work as advertised with other members. A lack of centralized information on how exactly to manipulate specific strains has led to a range of ad hoc approaches, often adapted from other bacterial families. This can complicate matters for researchers starting in the field, who may not know which information does or does not apply to their chosen strain.

In this paper, we aim to centralize a set of protocols with demonstrated success, specifically in the Limosilactobacillus reuteri strain designation F275 (other collection numbers: DSM20016, ATCC23272, CIP109823), along with troubleshooting advice and common issues one may encounter. These protocols should enable a researcher with little to no experience working with L. reuteri DSM20016 to transform a plasmid, confirm transformation, and measure system feedback in a plate reader via a reporter protein.

Introduction

The genus Lactobacillus were historically classified as gram-positive, rod-shaped, non-spore-forming, either facultative anaerobes or microaerophiles that break sugars down to primarily produce lactic acid1. These loose criteria led to Lactobacillus being, phenotypically and genotypically, an extremely diverse genus. This broad categorization resulted in the genus being reclassified, introducing 23 novel genera in 20202.

The old, broader genus included major commensal and probiotic species generally regarded as safe (GRAS) for consumption3. The Lactobacillaceae family maintains a public perception of being 'good bacteria' due to many reported health benefits bestowed via the consumption of various strains4,5,6,7. The ease with which they can navigate the gastrointestinal tract8 and their public acceptance combine to position Lactobacillaceae strains as strong candidates as chassis organisms for ingestible medicinal, therapeutic, or diagnostic applications.

The wide range of characteristics present within the Lactobacillaceae family has led to a situation in which there is no de facto model-organism strain; research groups have tended to select species with the properties most relevant to their particular aims. (For example, dairy fermentation labs could choose L. lactis; studies of vegetable fermentation might select L. plantarum; research on probiotics might focus on L. acidophilus; and so on.)

This same wide range of characteristics across species has led to an accumulation of protocols and procedures that may work well for one subset of the Lactobacillaceae family, but require optimization to work efficiently (or perhaps to function at all) in others9. This need for optimization between family members and even within members of the same species can frustrate the efforts of unfamiliar researchers. Protocols published in the methods sections of papers can also include their own modifications10, leading to fragmented, decentralized protocol collections.

L. reuteri is considered a widely vertebrate commensal, found consistently in mammalian, avian11 and fish12 gastrointestinal (GI) tracts. L. reuteri sub-strains are often genetically specialized, via mucus adhesion protein adaptation, to more permanently colonize specific native hosts8,11,13. GI tract Limosilactobacillus species can be isolated in hosts outside their native host, but tend more toward a transient nature8.

Due to human-host specialization, L. reuteri DSM20016 positions itself very well as a chassis for diagnostic or therapeutic applications at any point in the human GI tract, and the strain DSM20016 could provide a longer-lasting window of effect for interventions when compared to more transitory strains.

In this paper, we outline a series of protocols with demonstrated effectiveness in Limosilactobacillus reuteri (strain designation: F275; other collection numbers: DSM20016, ATCC23272, CIP109823), along with centralized information on the strain from other sources to aid in molecular and systems biology applications. Procedures laid out herein should enable a researcher with no prior experience to culture L. reuteri, create electrocompetent stocks, select transformed colonies, confirm transformation via colony polymerase chain reaction (PCR), and measure designed system response via fluorescent reporter proteins.

We note that related protocols have covered CRISPR-Cas9 assisted ssDNA genome recombineering in L. reuteri (strain: ATCC-PTA-6475)14, and CRSIPR-Cas9 nickase-assisted genome editing in multiple non-L. reuteri, Lactobacillaceae family stains15,16; these do not, however, address the L. reuteri DSM20016 strain that is our focus here.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Preparing L. reuteri DSM20016 electrocompetent cells

NOTE: This is based on a protocol by Berthier et al.17, with centrifugation speeds informed by Rattanachaikunsopon et al.18.

  1. In a 50 mL centrifuge tube, inoculate L. reuteri from glycerol stock into 6 mL of deMan Rogosa Sharpe (MRS) broth. Incubate aerobically overnight at 37 °C in a static incubator.
  2. The next morning, inoculate 4 mL of the overnight culture into 200 mL of MRS broth (1:50 dilution).
  3. Allow to grow aerobically in a static 37 °C incubator until the 600 nm optical density value (OD600) reaches 0.5-0.85; this should take roughly 2-3 h.
  4. As soon as an adequate OD600 value is reached, decant the media into 50 mL centrifuge tubes and place on ice while balancing the tubes.
  5. Centrifuge for 5 min at 5,000 x g in a pre-chilled, 4 °C centrifuge.
  6. Discard the supernatant, resuspend each pellet in 50 mL of pre-chilled (0 °C to 4 °C) ddH2O, and centrifuge again with the same settings as the previous step. Keep the cells on ice as much as possible.
  7. Repeat step 1.6.
  8. Resuspend each pellet in 25 mL of ddH2O: 0.5 M sucrose, 10% glycerol. Centrifuge at 5,000 x g at 4 °C for 10 min. Discard the supernatant and put the cells back on ice.
  9. Resuspend all the pellets in the same 2 mL of ddH2O: 0.5 M sucrose, 10% glycerol.
  10. Aliquot into 50 µL to 100 µL portions in pre-chilled microcentrifuge tubes; store at -80 °C for later use.

2. Electroporation of L. reuteri

NOTE: Avoid pipetting as much as possible in the following steps. Inclusion of a control electroporation, with no plasmid added, is advised to ensure the antibiotic selection is adequate.

  1. Take an entire electrocompetent L. reuteri aliquot and thaw it on ice.
  2. Gently mix 5 µL to 10 µL of plasmid (final plasmid concentration >6 nM) into the thawed aliquot, avoiding pipetting as much as possible.
  3. Transfer to an ice-chilled, 1 mm gap electroporation cuvette.
  4. Electroporate at 1.25 kV, 400 Ω, and 25 µF.
  5. Add 1 mL of room temperature (RT) MRS broth and mix by inverting the cuvette once or twice.
  6. Place the cuvettes into a static incubator at 37 °C for 2.5-3 h to allow for recovery.
  7. Plate the entire amount onto multiple MRS agar plates with appropriate selection.
  8. Place the plates inside a completely airtight container with a small lit candle ("tealight") and an anaerobic atmosphere-generating sachet.
  9. Grow at 37 °C for 2-3 days or until visible colonies are present.

3. Measurement of the acid-resistant fluorescent reporter protein mCherry2

  1. Pick any colonies required for measurement and inoculate into a 96-well storage microplate with 1.5 mL of filter sterilized (non-autoclaved) MRS broth per well and an appropriate selection antibiotic.
  2. Incubate aerobically for 24 h overnight at 37 °C without shaking.
    NOTE: This storage microplate should be kept for use in section 4 (colony PCR).
  3. L. reuteri will precipitate out of the media when in the stationary phase; resuspend the overnight culture via pipetting.
  4. Transfer 200 µL into a flat, clear-bottom, 96-well plate, transfer the plate to a plate reader, and measure the OD and fluorescence of mCherry2 (excitation [Ex]: 589 nm; emission [Em]: 610 nm) or other relevant reporters.

4. Confirmation of plasmid uptake via colony PCR

  1. From the 96-well storage microplate from section 3, transfer 5 µL to a PCR tube.
    NOTE: If >5 min have passed, it may be necessary to resuspend the L. reuteri a second time.
  2. In a portable benchtop microcentrifuge, spin down until the pellet can be seen (roughly 2 min at 2,000 x g), discard the supernatant, and resuspend the pellet in 20 µL of 20 mM NaOH.
  3. Boil at 95 °C for 5 min, vortex, and repeat the boil a second time.
  4. Immediately chill the samples; try to keep the samples on ice as much as possible in the following steps to lower the likelihood of template degradation and PCR inhibition.
  5. Spin down in a portable benchtop microcentrifuge at 2,000 x g for 2 min until the cell debris is pelleted, then take 1 µL of the supernatant and dilute into 99 µL of ice-cold DNase- and RNase-free ddH2O (100x dilution).
  6. Use the 100x dilution as the template DNA in a standard PCR reaction using plasmid-specific primers. Include a positive control with a plasmid derived from the E. coli mini-prep.
  7. Return the samples on ice and add an appropriate loading dye at a 1x concentration.
  8. Run in 1% agarose gel in TAE buffer (tris-acetate-ethylenediaminetetraacetic acid [EDTA]) at 110 V for 30 min. Image if necessary.

5. Mini-prep protocol for L. reuteri , followed by PCR to confirm plasmid presence

NOTE: Protocol intended for use with the mini-prep kit listed in the Table of Materials.

  1. Inoculate L. reuteri into 10 mL of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 °C in a static incubator.
  2. Centrifuge at 5,000 x g for 10 min in a pre-chilled 4 °C centrifuge.
  3. Wash the pellet in 2 mL of standard P1 buffer (included with the kit) in order to negate acidity that may interfere with later steps, centrifuge with the same setting as previously described, and discard the supernatant.
  4. Resuspend the pellet in 250 µL of modified P1 buffer containing 10 mg/mL lysozyme and 100 U/mL mutanolysin in order to lyse bacterial cells. Incubate for 1-2 h at 37 °C.
  5. Add 250 µL of buffer P2, mix by inverting four to six times, and incubate at RT for no longer than 5 min.
  6. Add 350 µL of buffer N3 (included with the kit) and immediately invert four to six times gently to mix.
  7. Centrifuge at 10,000 x g for 10 min.
  8. Transfer as much supernatant as possible to a spin column and centrifuge at 10,000 x g for 60 s. Discard the flow through.
  9. Wash the spin column with 500 µL of buffer PB (included with the kit) and centrifuge at 10,000 x g for 60 s. Discard the flow through.
  10. Wash the spin column with 750 µL of buffer PE (included with the kit), and centrifuge at 10,000 x g for 60 s. Discard the flow through and centrifuge for 60 s to remove any residual buffer.
  11. Place the spin column in a 1.5 mL microcentrifuge tube. Apply 20-30 µL of DNAse- and RNAse-free ddH2O to the filter of the spin column and leave for 1-2 min, before centrifuging at 10,000 x g for 60 s.
  12. Perform a standard PCR reaction using plasmid-specific primers (pTRKH3_pTUSeq_F: CACCCGTTCTCGGAGCA, pTRKH3_pTUSeq_R: CTACGAGTTGCATGATAAAGAAGACA), with eluate providing the template DNA. Include a positive control with a plasmid derived from the E. coli mini-prep.
    NOTE: The PCR settings used in this study are: 98 °C for 5 min, (98 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s) 30 cycles, 72 °C for 2 min, 4 °C hold. The parameters are highly dependent on the polymerase used, fragment length, and exact primers used by any person utilizing this protocol.

Access restricted. Please log in or start a trial to view this content.

Results

Transformation efficiencies
L. reuteri does not require a dcm-/dam- non-methylated plasmid, as observed for other Lactobacillaceae19,20 (see Figure 1). Electroporation of L. reuteri DSM20016 with 10 µL of the 8.5 kb plasmid pTRKH3_mCherry2 (pAMβ1 theta origin of replication) should give transformation efficiencies of roughly 80 colony forming units (CFU)/µg (five t...

Access restricted. Please log in or start a trial to view this content.

Discussion

The most critical step for the transformation of L. reuteri DSM20016 is the generation of anaerobic growth conditions after transformations are plated; colonies gained in aerobic conditions are only very occasional and generally fail to grow when inoculated in MRS broth. Plating the entire recovery volume should also be practiced to maximize the probability of colony growth. Even with these two critical steps, transformation efficiency is still a limitation on experimentation, as expected colonies can number as ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest exist.

Acknowledgements

We greatly appreciate the valuable advice provided by Prof. J.P. van Pijkeren (University of Wisconsin-Madison), whose guidance on working with L. reuteri ATCC PTA 6475 provided a foundation for the methods described here.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1 kb Plus DNA LadderNEBN3200L
1mL Spectrophotometer cuvettesThomas Scientific1145J12
Agarose BioShopAGR001
Allegra X-15R (refrigerated centrifuge)Beckman Allegra N/ANo longer in production
AnaeroGen 2.5 L SachetThermo ScientificOXAN0025A
BTX, ECM 399 electroporation systemVWR58017-984
Centrifuge tubes (50 mL)FroggaBioTB50-500
DNA gel x6 loading dyeNEBB7024S
Electroporation cuvetteFisherbrandFB101
ErythromycinMillipore SigmaE5389-5G
Gel electroporation bath/dockVWR76314-748
Glycerol BioShopGLY001
Limosilactobacillus reuteriLeibniz Institute DSMZDSM20016Strain designation F275
LysozymeBioShopLYS702.5
Microcentrifuge tubes (1.7 mL)FroggaBioLMCT1.7B
Miniprep kit (Qiagen)Qiagen27106slpGFP replaced with constitutive, codon optimised, mCherry2 reporter protein 
MRS Broth (Dehydrated)Thermo ScientificCM0359B
MutanolysinMillipore SigmaM9901-5KU
NaOH Millipore Sigma1064691000
P100 PipetteEppendorf3123000047
P1000 PipetteEppendorf3123000063
P2.5 PipetteEppendorf3123000012
P20 PipetteEppendorf3123000039
P200 PipetteEppendorf3123000055
PCR tubesFroggaBioSTF-A120S
Personal benchtop microcentrifugeGenlantisE200100
Petri dishesVWR25384-088
PTC-150 Thermal CyclerMJ ResearchN/ANo longer in production
pTRKH3_slpGFP (modified)Addgene27168
SPECTRONIC 200 SpectrophotometerThermo Scientific840-281700
Storage microplateFisher Scientific14-222-225
SucroseBioShopSUC507
TAE Buffer 50xThermo ScientificB49
VortexVWR58816-121No longer in production
VWR 1500E incubatorVWRN/ANo longer in production

References

  1. Makarova, K., et al. Comparative genomics of the lactic acid bacteria. Proceedings of the National Academy of Sciences. 103 (42), 15611-15616 (2006).
  2. Zheng, J., et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. International Journal of Systematic and Evolutionary Microbiology. 70 (4), 2782-2858 (2020).
  3. Adams, M. R., Marteau, P. On the safety of lactic acid bacteria from food. International Journal of Food Microbiology. 27 (2-3), 263-264 (1995).
  4. Urbańska, M., Gieruszczak-Białek, D., Szajewska, H. Systematic review with meta-analysis: Lactobacillus reuteri DSM 17938 for diarrhoeal diseases in children. Alimentary Pharmacology and Therapeutics. 43 (10), 1025-1034 (2016).
  5. Jansson, P. A., et al. Probiotic treatment using a mix of three Lactobacillus strains for lumbar spine bone loss in postmenopausal women: a randomised, double-blind, placebo-controlled, multicentre trial. The Lancet Rheumatology. 1 (3), e154-e162 (2019).
  6. Yang, C., et al. Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacterpylori eradication: A randomized double-blind placebo-controlled trial. Helicobacter. 26 (6), 12856(2021).
  7. Nikawa, H., et al. Lactobacillus reuteri in bovine milk fermented decreases the oral carriage of mutans streptococci. International Journal of Food Microbiology. 95 (2), 219-223 (2004).
  8. Reuter, G. The Lactobacillus and Bifidobacterium microflora of the human intestine: Composition and succession. Current Issues in Intestinal Microbiology. 2 (2), 43-53 (2001).
  9. Aukrust, T. W., Brurberg, M. B., Nes, I. F. Transformation of Lactobacillus by electroporation. Methods in Molecular Biology. 47, 201-208 (1995).
  10. Lubkowicz, D., et al. Reprogramming probiotic Lactobacillus reuteri as a biosensor for Staphylococcus aureus derived AIP-I detection. ACS Synthetic Biology. 7 (5), 1229-1237 (2018).
  11. Walter, J., Britton, R. A., Roos, S. Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm. Proceedings of the National Academy of Sciences. 108, 4645-4652 (2011).
  12. Ahmad, W., et al. Production of bimodal molecular weight levan by a Lactobacillus reuteri isolate from fish gut. Folia Microbiologica. 67 (1), 21-31 (2022).
  13. MacKenzie, D. A., et al. Strain-specific diversity of mucus-binding proteins in the adhesion and aggregation properties of Lactobacillus reuteri. Microbiology. 156 (11), 3368-3378 (2010).
  14. Oh, J. H., van Pijkeren, J. P. CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri. Nucleic Acids Research. 42 (17), 131(2014).
  15. Song, X., Huang, H., Xiong, Z., Ai, L., Yang, S. CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei. Applied and Environmental Microbiology. 83 (22), e01259(2017).
  16. Goh, Y. J., Barrangoua, R. Portable CRISPR-Cas9N system for flexible genome engineering in Lactobacillus acidophilus, Lactobacillus gasseri, and Lactobacillus paracasei. Applied and Environmental Microbiology. 87 (6), e02669(2021).
  17. Berthier, F., Zagorec, M., Champomier-Verg, M., Ehrlich, S. D., Morel-Devillel, F. Efficient transformation of Lactobacillus sake by electroporation. Microbiology. 142 (5), 1273-1279 (1996).
  18. Rattanachaikunsopon, P., Phumkhachorn, P. Glass bead transformation method for gram-positive bacteria. Brazilian Journal of Microbiology. 40 (4), 923(2009).
  19. Pflügl, S., Marx, H., Mattanovich, D., Sauer, M. Genetic engineering of Lactobacillus diolivorans. FEMS Microbiology Letters. 344 (2), 152-158 (2013).
  20. Spath, K., Heinl, S., Grabherr, R. Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete. Microbial Cell Factories. 11, 141(2012).
  21. Ortiz-Velez, L., et al. Genome alterations associated with improved transformation efficiency in Lactobacillus reuteri. Microbial Cell Factories. 17 (1), 138(2018).
  22. O'Sullivan, D. J., Klaenhammer, T. R. Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp. Applied and Environmental Microbiology. 59 (8), 2730-2733 (1993).
  23. Lizier, M., Sarra, P. G., Cauda, R., Lucchini, F. Comparison of expression vectors in Lactobacillus reuteri strains. FEMS Microbiology Letters. 308 (1), 8-15 (2010).
  24. Roberts, R. J., Vincze, T., Posfai, J., Macelis, D. REBASE-a database for DNA restriction and modification: Enzymes, genes and genomes. Nucleic Acids Research. 43, Database issue D298-D299 (2015).
  25. Ahrne, S., Molin, G., Axelsson, L. Transformation of Lactobacillus reuteri with electroporation: Studies on the erythromycin resistance plasmid pLUL631. Current Microbiology. 24, 199-205 (1992).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Electroporation ProtocolSynthetic Biology ChassisPlasmid TransformationGut Commensal BacteriaReporter Protein AssayGastrointestinal TractPlate Reader MeasurementTherapeutic Delivery