Multiomics-analyse van TMEM200A als een pan-kanker biomarker
Summary
Hier wordt een protocol gepresenteerd waarin meerdere bio-informaticatools worden gecombineerd om de biologische functies van TMEM200A bij kanker te bestuderen. Daarnaast valideren we ook experimenteel de bioinformatica voorspellingen.
Abstract
Van het transmembraaneiwit, TMEM200A, is bekend dat het in verband wordt gebracht met menselijke kankers en immuuninfiltratie. Hier beoordeelden we de functie van TMEM200A bij veel voorkomende kankers door middel van multiomics-analyse en gebruikten we in vitro celculturen van maagcellen om de resultaten te verifiëren. De expressie van TMEM200A in verschillende soorten kanker bij de mens werd beoordeeld met behulp van de RNA-seq-gegevens uit de UCSC Xena-database. Bio-informatica-analyse onthulde een mogelijke rol van TMEM200A als diagnostische en prognostische biomarker.
Culturen van normale maag- en kankercellijnen werden gekweekt en TMEM200A werd neergehaald. De expressieniveaus van TMEM200A werden gemeten met behulp van kwantitatieve real-time polymerasekettingreactie en western blotting. In vitro onderzoeken naar functieverlies werden vervolgens gebruikt om de rol van TMEM200A in het kwaadaardige gedrag en de tumorvorming van maagkankercellen (GC) te bepalen. Westerse blots werden gebruikt om het effect van de knockdown op de epitheliale-mesenchymale overgang (EMT) en de PI3K/AKT-signaleringsroute in GC te beoordelen. Bio-informatica-analyse toonde aan dat TMEM200A op hoge niveaus in GC tot expressie kwam.
De proliferatie van GC-cellen werd geremd door TMEM200A knockdown, die ook vimentine-, N-cadherine- en Snai-eiwitten verminderde en AKT-fosforylering remde. De PI3K/AKT-signaleringsroute bleek ook betrokken te zijn bij TMEM200A-gemedieerde regulatie van GC-ontwikkeling. De hier gepresenteerde resultaten suggereren dat TMEM200A de micro-omgeving van de tumor reguleert door de EMT te beïnvloeden. TMEM200A kan ook EMT beïnvloeden via PI3K/AKT-signalering, waardoor de micro-omgeving van de tumor wordt beïnvloed. Daarom kan TMEM200A bij pan-kankers, met name GC, een potentiële biomarker en oncogen zijn.
Introduction
Kanker is naar voren gekomen als een hardnekkig probleem voor de volksgezondheid dat wereldwijd de menselijke gezondheid in gevaar brengt1vanwege de hoge morbiditeits- en sterftecijfers wereldwijd, wat een zware financiële en medische last vormt voor de samenleving2. Er is de afgelopen jaren aanzienlijke vooruitgang geboekt op het gebied van kankertherapie dankzij de ontdekking van kankermarkers3, en onderzoekers hebben nieuwe diagnostische methoden en nieuwe medicijnen ontwikkeld om kanker te behandelen. Sommige patiënten met kanker hebben echter nog steeds slechte prognoses vanwege factoren zoals medicatieresistentie, bijwerkingen van medicijnen en chemische gevoeligheid4. Daarom is er dringend behoefte aan het identificeren van nieuwe biomarkers voor het screenen en behandelen van kanker in een vroegstadium5.
Membraaneiwitten zijn eiwitten die kunnen binden en integreren in cellen en organelmembranen6. Deze kunnen worden gegroepeerd in drie categorieën, afhankelijk van de sterkte van de binding aan het membraan en hun locatie: lipide-verankerde eiwitten, integrale eiwitten en perifere membraaneiwitten 7,8. Een transmembraan (TMEM) eiwit is een integraal membraaneiwit dat bestaat uit ten minste één transmembraansegment9, dat geheel of gedeeltelijk door het biologische membraan gaat.
Hoewel de werkingsmechanismen van eiwitten die tot de TMEM-familie behoren niet goed worden begrepen, is bekend dat deze eiwitten betrokken zijn bij verschillende soortenkanker10. Verschillende TMEM-eiwitten worden geassocieerd met migrerende, proliferatieve en invasieve fenotypes, en hun expressie wordt vaak geassocieerd met de prognose van een patiënt11. Daarom zijn TMEM-familieleden het doelwit van onderzoek geworden. Een uitgebreid overzicht van bestaande rapporten over TMEM onthulde dat ze meestal geassocieerd zijn met inter- en intracellulaire signalering12, immuungerelateerde ziekten en tumorigenese10. Veel TMEM’s bezitten ook belangrijke fysiologische functies, bijvoorbeeld ionkanalen in het plasmamembraan, activering van signaaltransductieroutes, evenals de bemiddeling van celchemotaxis, adhesie, apoptose en autofagie10. Daarom veronderstelden we dat TMEM-eiwitten belangrijke prognostische markers kunnen zijn bij de detectie en behandeling van tumoren.
TMEM200A expressie is significant verhoogd bij maagkanker (GC). Een hogere expressie van TMEM200A13, dat acht exonen heeft en een volledige lengte van 77,536 kb op chromosoom 6q23.1, is in verband gebracht met een slechte prognose voor algehele overleving (OS) in gevallen van GC. Toch zijn de veranderingen in de expressie ervan zelden gemeld in oncologische studies. Dit artikel vergelijkt en analyseert het nut van TMEM200A als therapeutisch doelwit en tumordiagnostische marker in verschillende kankeronderzoeken met behulp van verschillende openbaar beschikbare datasets. We beoordeelden de effectiviteit van TMEM200A als een diagnostische en prognostische biomarker voor pankanker, evenals de expressieniveaus ervan bij verschillende soorten kanker bij de mens met behulp van RNA-seq-gegevens uit de UCSC Xena- en TCGA-databases, evenals door real-time kwantitatieve polymerasekettingreactie (qRT-PCR) en western blotting.
Het effect van TMEM200A expressieniveaus op mutatiesnelheden, regulerende processen, tumordiagnose en -prognose, immuuninfiltratie en immunotherapie werd verder onderzocht met behulp van een mix van computationele tools en datasetwebsites. CBioPortal en de Catalog of Somatic Mutations in Cancer Cells (COSMIC)-databases werden gebruikt om mutaties in TMEM200A te onderzoeken. De websites van Sangerbox en TISIDB werden gebruikt om te begrijpen hoe TMEM200A de immuuninfiltratie beïnvloedt. De online tool Tumor Immune Single Cell Center (TISCH) en de CancerSEA-database werden gebruikt om de functie van TMEM200A te onderzoeken. Ten slotte, om de impact van TMEM200A op het kwaadaardige gedrag en de tumorontwikkelingsfunctie van GC-cellen te beoordelen, werd een experiment met functieverlies uitgevoerd in een in vitro test. Daarnaast werd western blotting uitgevoerd om te beoordelen hoe TMEM200A knockdown de PI3K/AKT-signaleringsroute en de epitheliale-mesenchymale overgang (EMT) in GC beïnvloedde.
Protocol
Representative Results
Discussion
TMEM200A behoort tot een familie van TMEM’s die essentieel is voor de proliferatie van kankercellen38. De variabele expressie van TMEM200A bij verschillende maligniteiten heeft minder aandacht gekregen en een grondig pan-kankeronderzoek ontbreekt. Er blijft zich echter bewijs opstapelen, waaruit blijkt dat de TMEM-transmembraaneiwitfamilie belangrijk kan zijn bij het kwaadaardig houden van kankercellen door interacties met verschillende eiwitten, bijvoorbeeld activering van TMEM1…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd ondersteund door de National Natural Science Foundation of China (82160550).
Materials
| Anti-AKT antibody | Proteintech Group, Inc | 60203-2-Ig | |
| Anti-E-cadherin antibody | Proteintech Group, Inc | 20874-1-AP | |
| anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody | Proteintech Group, Inc | 10494-1-AP | |
| Anti-N-cadherin antibody | Proteintech Group, Inc | 22018-1-AP | |
| Anti-P-AKT antibody | Proteintech Group, Inc | 66444-1-Ig | |
| Anti-snail antibody | Proteintech Group, Inc | 13099-1-AP | |
| Anti-Vimentin antibody | Proteintech Group, Inc | 10366-1-AP | |
| AxyPrepMultisourceTotalRNAMini- prep Kit |
Suzhou Youyi Landi Biotechnology Co., Ltd | UEL-UE-MN-MS-RNA-50G | |
| BCA Protein Assay Kit | Epizyme Biotech | ZJ101L | |
| CCK-8 reagent | MedChemExpress | HY-K0301-500T | |
| Fetal bovine serum (FBS) | CYAGEN BIOSCIENCES (GUANGZHOU) INC | FBSSR-01021 | |
| GAPDH primer | Sangon Biotech (Shanghai) Co., Ltd. | Forward primer (5’-3’): TGACATCAAGAAGGTG GTGAAGCAG; Reverse primer (5’-3’): GTGTCGCTGTTGAAG TCAGAGGAG |
|
| HighGene plus Transfection reagent | ABclonal | RM09014P | |
| HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L) | Proteintech Group, Inc | SA00001-1 | |
| HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L) | Proteintech Group, Inc | SA00001-2 | |
| Human gastric mucosal epithelial GES-1 cells | Guangzhou Cellcook Biotech Co.,Ltd. | ||
| Human STAD HGC-27 cells | Procell Life Science&Technology Co.,Ltd | ||
| Human STAD SGC-7901 cells | Procell Life Science&Technology Co.,Ltd | ||
| MonAmp SYBR Green qPCR Mix (None ROX) | Mona (Suzhou) Biotechnology Co., Ltd | MQ10101S | |
| MonScript RTIII All-in-One Mix with dsDNase | Mona (Suzhou) Biotechnology Co., Ltd | MR05101M | |
| Omni-ECL Femto Light Chemiluminescence Kit | Epizyme Biotech | SQ201 | |
| PAGE Gel Fast Preparationb Kit | Epizyme Biotech | PG111 | |
| Penicillin-streptomycin (Pen-Strep) | Beijing Solarbio Science & Technology Co.,Ltd | P1400-100 | |
| Polyvinylidene difluoride (PVDF) membrane | Merck KGaA | IPVH00010-1 | |
| Protein Free Rapid Blocking Buffer | Epizyme Biotech | PS108P | |
| RIPA lysis solution | Beijing Solarbio Science & Technology Co., Ltd | R0010 | |
| RPMI 1640 complete medium | Thermo Fisher Scientific | C11875500BT | |
| Skimmed milk | Campina: Elk | ||
| TBST buffer solution | Beijing Solarbio Science & Technology Co., Ltd | T1082 | |
| The protein loading buffer | Epizyme Biotech | LT101S | |
| TMEM200A knockdown plasmid | MiaoLing Plasmid | ||
| TMEM200A primer | Sangon Biotech (Shanghai) Co., Ltd. | Forward primer (5’-3’): AAGGCGGTGTGGTGGTTCG; Reverse primer (5’-3’): GATTTTGGTCTCTTTGTCACGGTT | |
| TMEM200A SiRNA1 | MiaoLing Plasmid | Forward primer (5’-3’): ACAACTGATGATAAGACCAG; Reverse primer (5’-3’): TGTTGACTACTATTCTGGTC | |
| TMEM200A SiRNA2 | MiaoLing Plasmid | Forward primer (5’-3’): CGTGTGAATGTCAATGACTG; Reverse primer (5’-3’): GCACACTTACAGTTACTGAC | |
| TMEM200A SiRNA3 | MiaoLing Plasmid | Forward primer (5’-3’): ACAACCACAACATCTGCCCG; Reverse primer (5’-3’): TGTTGGTGTTGTAGACGGGC | |
| Transmembrane protein 200A Antibody | Proteintech Group, Inc | 48081-1 | |
| Equipment | |||
| CO2 cell culture incubator | Haier Group | PYXE-80IR | |
| Electrophoresis instrument | Bio-RAD | ||
| Fluorescence quantitative PCR instrument | Bio-RAD | ||
| Gel Imaging System (Tanon 5200) | Tanon Science & Technology Co., Ltd | LAB-0002-0007-SHTN | |
| Multifunctional Enzyme Labeler | Berthold |
References
- Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. Global cancer incidence and mortality rates and trends–an update. Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).
- Long, X., et al. Economic burden of malignant tumors – Yichang City, Hubei Province, China, 2019. China CDC Wkly. 4 (15), 312-316 (2022).
- Harbeck, N., Gnant, M. Breast cancer. Lancet. 389 (10074), 1134-1150 (2017).
- Bagchi, S., Yuan, R., Engleman, E. G. Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance. Annu Rev Pathol. 16, 223-249 (2021).
- Lam, G. T., et al. Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers. Mol Diagn Ther. 27 (1), 49-60 (2023).
- Gromiha, M. M., Ou, Y. Y. Bioinformatics approaches for functional annotation of membrane proteins. Brief Bioinform. 15 (2), 155-168 (2014).
- Schmit, K., Michiels, C. TMEM proteins in cancer: a review. Front Pharmacol. 9, 1345 (2018).
- Marx, S., et al. Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process. Semin Cancer Biol. 60, 96-106 (2020).
- Fu, K., et al. Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit. PLoS One. 12 (12), e0189006 (2017).
- Cuajungco, M. P., et al. Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology. Acta Histochem. 114 (7), 705-712 (2012).
- Zhang, S., et al. TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway. Cell Death Dis. 12 (12), 1086 (2021).
- Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry. Cell Mol Life Sci. 79 (2), 118 (2022).
- Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma. Onco Targets Ther. 13, 7735-7746 (2020).
- Jia, D., et al. Mining TCGA database for genes of prognostic value in glioblastoma microenvironment. Aging (Albany NY). 10 (4), 592-605 (2018).
- Wang, S., et al. UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data. Bioinformatics. 38 (2), 527-529 (2022).
- Li, T., et al. TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res. 48 (W1), W509-W514 (2020).
- Thul, P. J., et al. A subcellular map of the human proteome. Science. 356 (6340), eaal3321 (2017).
- Li, Y., Ge, D., Lu, C. The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization. Epigenetics Chromatin. 12 (1), 71 (2019).
- Chandrashekar, D. S., et al. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia. 25, 18-27 (2022).
- Tate, J. G., et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res. 47 (D1), D941-D947 (2019).
- Gao, J., et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 6 (269), pl1 (2013).
- Shen, W., et al. Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform. iMeta. 1 (3), e36 (2022).
- Ru, B., et al. TISIDB: an integrated repository portal for tumor-immune system interactions. Bioinformatics. 35 (20), 4200-4202 (2019).
- Yuan, H., et al. CancerSEA: a cancer single-cell state atlas. Nucleic Acids Res. 47 (D1), D900-D908 (2019).
- Sun, D., et al. TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment. Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).
- Warde-Farley, D., et al. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function. Nucleic Acids Res. 38, W214-W220 (2010).
- Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma. Front Genet. 13, 894865 (2022).
- Mueller Bustin, S. A., R, Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clin Sci (Lond). 109 (4), 365-379 (2005).
- Sun, L., Zhang, H., Gao, P. Metabolic reprogramming and epigenetic modifications on the path to cancer. Protein Cell. 13 (12), 877-919 (2022).
- Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. Genetics and epigenetics in asthma. Int J Mol Sci. 22 (5), 2412 (2021).
- Martínez-Reyes, I., Chandel, N. S. Cancer metabolism: looking forward. Nat Rev Cancer. 21 (10), 669-680 (2021).
- Chen, Y., et al. PremPS: Predicting the impact of missense mutations on protein stability. PLoS Comput Biol. 16 (12), e1008543 (2020).
- Li, M., Petukh, M., Alexov, E., Panchenko, A. R. Predicting the impact of missense mutations on protein-protein binding affinity. J Chem Theory Comput. 10 (4), 1770-1780 (2014).
- Hirsch, D., et al. Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system. J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).
- Poulogiannis, G., Frayling, I. M., Arends, M. J. DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome. Histopathology. 56 (2), 167-179 (2010).
- Chintamani, J., et al. The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer. Int Semin Surg Oncol. 4, 5 (2007).
- Deng, H., et al. High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer. Pathol Oncol Res. 29, 1610893 (2023).
- Stemmler, M. P. Cadherins in development and cancer. Mol Biosyst. 4 (8), 835-850 (2008).
- Bill, A., et al. ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer. Oncotarget. 6 (11), 9173-9188 (2015).
- De Las Rivas, J., et al. Cancer drug resistance induced by EMT: novel therapeutic strategies. Arch Toxicol. 95 (7), 2279-2297 (2021).
- Tian, S., et al. SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/β-catenin signaling pathway. Aging (Albany NY). 12 (4), 3574-3593 (2020).
