ניתוח מולטיומיקס של TMEM200A כסמן ביולוגי פאן-סרטני
Summary
כאן מוצג פרוטוקול שבו משולבים כלים ביואינפורמטיים מרובים כדי לחקור את הפונקציות הביולוגיות של TMEM200A בסרטן. בנוסף, אנו גם מאמתים באופן ניסיוני את תחזיות הביואינפורמטיקה.
Abstract
החלבון הטרנסממברנלי, TMEM200A, ידוע כקשור לסרטן אנושי ולחדירה חיסונית. כאן, הערכנו את הפונקציה של TMEM200A בסוגי סרטן נפוצים על ידי ניתוח מולטיומיקס והשתמשנו בתרביות תאי מבחנה של תאי קיבה כדי לאמת את התוצאות. ביטוי TMEM200A במספר סוגי סרטן בבני אדם הוערך באמצעות נתוני RNA-seq ממסד הנתונים UCSC Xena. ניתוח ביואינפורמטי גילה תפקיד פוטנציאלי של TMEM200A כסמן ביולוגי אבחוני ופרוגנוסטי.
תרביות של קווי תאי קיבה וסרטן תקינים גדלו TMEM200A הופל. רמות הביטוי של TMEM200A נמדדו באמצעות תגובת שרשרת כמותית בזמן אמת של פולימראז וכתמים מערביים. לאחר מכן נעשה שימוש במחקרי אובדן תפקוד במבחנה כדי לקבוע את תפקידי TMEM200A בהתנהגות הממאירה ובהיווצרות הגידול של תאי סרטן הקיבה (GC). כתמים מערביים שימשו להערכת ההשפעה של ההפלה על מעבר אפיתל-מזנכימלי (EMT) ומסלול איתות PI3K/AKT ב- GC. ניתוח ביואינפורמטי הראה כי TMEM200A באה לידי ביטוי ברמות גבוהות ב- GC.
התפשטות תאי GC עוכבה על ידי TMEM200A knockdown, אשר גם הפחיתה וימנטין, N-cadherin, וחלבוני Snai, ועיכבה זרחן AKT. נראה כי מסלול האיתות PI3K/AKT מעורב גם ברגולציה בתיווך TMEM200A של פיתוח GC. התוצאות המוצגות כאן מצביעות על כך TMEM200A מסדיר את המיקרו-סביבה של הגידול על ידי השפעה על החובש. TMEM200A עשוי להשפיע גם על EMT באמצעות איתות PI3K/AKT, ובכך להשפיע על המיקרו-סביבה של הגידול. לכן, בפאן סרטן, במיוחד GC, TMEM200A עשוי להיות סמן ביולוגי פוטנציאלי אונקוגן.
Introduction
מחלת הסרטן התגלתה כבעיה מתמשכת בתחום בריאות הציבור המסכנת את בריאות האדם בעולם1בשל שיעורי התחלואה והתמותה הגבוהים ברחבי העולם, ומהווה נטל כלכלי ורפואי כבד על החברה2. התקדמות משמעותית בטיפול בסרטן הושגה בשנים האחרונות הודות לגילוי סמני סרטן3, וחוקרים פיתחו שיטות אבחון חדשניות ותרופות חדשות לטיפול בסרטן. עם זאת, לחלק מהחולים עם סרטן עדיין יש פרוגנוזות גרועות בגלל גורמים כגון עמידות לתרופות, תופעות לוואי של תרופות ורגישות כימית4. לכן, יש צורך דחוף בזיהוי סמנים ביולוגיים חדשים לבדיקות סקר וטיפול בסרטן בשלב מוקדם5.
חלבוני ממברנה הם חלבונים שיכולים להיקשר ולהשתלב בתאים ובקרומי אברונים6. ניתן לקבץ אותם לשלוש קטגוריות בהתאם לחוזק הקשירה לממברנה ומיקומם: חלבונים מעוגני שומנים, חלבונים אינטגרליים וחלבוני קרום היקפי 7,8. חלבון טרנסממברנה (TMEM) הוא חלבון קרום אינטגרלי המורכב לפחות מקטע טרנסממברנהאחד 9, העובר באופן מלא או חלקי דרך הממברנה הביולוגית.
למרות שמנגנוני הפעולה של חלבונים השייכים למשפחת TMEM אינם מובנים היטב, חלבונים אלה ידועים כמעורבים במספר סוגים של סרטן10. מספר חלבוני TMEM קשורים לפנוטיפים נודדים, מתרבים ופולשניים, והביטוי שלהם קשור לעתים קרובות לפרוגנוזה של המטופל11. לכן, בני משפחת TMEM הפכו למטרה למחקר. סקירה מקיפה של דיווחים קיימים על TMEM גילתה כי הם קשורים בעיקר לאיתות בין-תאיותוך-תאי 12, מחלות הקשורות למערכת החיסון וגידולים10. ל-TMEMs רבים יש גם פונקציות פיזיולוגיות חשובות, לדוגמה, תעלות יונים בקרום הפלזמה, הפעלת מסלולי העברת אותות, כמו גם תיווך של כימוטקסיס של תאים, הידבקות, אפופטוזיס ואוטופגיה10. לכן, שיערנו כי חלבוני TMEM עשויים להיות סמנים פרוגנוסטיים חשובים בגילוי וטיפול בגידולים.
ביטוי TMEM200A מוגבר באופן משמעותי בסרטן קיבה (GC). ביטוי גבוה יותר של TMEM200A13, שיש לו שמונה אקסונים ואורך מלא של 77.536 קילו-בתים בכרומוזום 6q23.1, נקשר לפרוגנוזה גרועה להישרדות כוללת (OS) במקרים של GC. עם זאת, השינויים בביטויו כמעט ולא דווחו במחקרים אונקולוגיים. מאמר זה משווה ומנתח את התועלת של TMEM200A כמטרה טיפולית וכסמן אבחוני גידול במחקרי סרטן שונים באמצעות מערכי נתונים שונים הזמינים לציבור. הערכנו את היעילות של TMEM200A כסמן ביולוגי פאן סרטני אבחוני ופרוגנוסטי וכן את רמות הביטוי שלו בסוגי סרטן שונים בבני אדם באמצעות נתוני RNA-seq ממסדי הנתונים UCSC Xena ו-TCGA, כמו גם על ידי תגובת שרשרת כמותית בזמן אמת של פולימראז (qRT-PCR) וכתמים מערביים.
ההשפעה של רמות ביטוי TMEM200A על שיעורי מוטציות, תהליכי ויסות, אבחון ופרוגנוזה של גידולים, חדירה חיסונית ואימונותרפיה נחקרה עוד יותר באמצעות שילוב של כלים חישוביים ואתרי מערכי נתונים. CBioPortal וקטלוג המוטציות הסומטיות בתאי סרטן (COSMIC) שימשו לבחינת מוטציות בשנת TMEM200A. אתרי האינטרנט Sangerbox ו-TISIDB שימשו כדי להבין כיצד TMEM200A משפיע על חדירה חיסונית. הכלי המקוון TISCH (Tumor Immune Single Cell Center) ומסד הנתונים CancerSEA שימשו לחקר תפקודו של TMEM200A. לבסוף, כדי להעריך את ההשפעה של TMEM200A על ההתנהגות הממאירה ותפקוד התפתחות הגידול של תאי GC, נערך ניסוי אובדן תפקוד במבחנה . בנוסף, בוצעה כתם מערבי כדי להעריך כיצד הפלה TMEM200A השפיעה על מסלול האיתות PI3K/AKT ועל המעבר האפיתל-מזנכימלי (EMT) ב- GC.
Protocol
Representative Results
Discussion
TMEM200A שייך למשפחה של TMEMs החיונית לתאי סרטן להתרבות38. הביטוי המשתנה של TMEM200A בממאירויות שונות קיבל פחות תשומת לב, וחקירה פאן-סרטנית יסודית לוקה בחסר. עם זאת, עדויות ממשיכות להצטבר, ומראות כי משפחת החלבונים הטרנסממברנליים TMEM עשויה להיות חשובה בשמירה על תאי סרטן ממאירים ב…
Disclosures
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכה על ידי הקרן הלאומית למדעי הטבע של סין (82160550).
Materials
| Anti-AKT antibody | Proteintech Group, Inc | 60203-2-Ig | |
| Anti-E-cadherin antibody | Proteintech Group, Inc | 20874-1-AP | |
| anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody | Proteintech Group, Inc | 10494-1-AP | |
| Anti-N-cadherin antibody | Proteintech Group, Inc | 22018-1-AP | |
| Anti-P-AKT antibody | Proteintech Group, Inc | 66444-1-Ig | |
| Anti-snail antibody | Proteintech Group, Inc | 13099-1-AP | |
| Anti-Vimentin antibody | Proteintech Group, Inc | 10366-1-AP | |
| AxyPrepMultisourceTotalRNAMini- prep Kit |
Suzhou Youyi Landi Biotechnology Co., Ltd | UEL-UE-MN-MS-RNA-50G | |
| BCA Protein Assay Kit | Epizyme Biotech | ZJ101L | |
| CCK-8 reagent | MedChemExpress | HY-K0301-500T | |
| Fetal bovine serum (FBS) | CYAGEN BIOSCIENCES (GUANGZHOU) INC | FBSSR-01021 | |
| GAPDH primer | Sangon Biotech (Shanghai) Co., Ltd. | Forward primer (5’-3’): TGACATCAAGAAGGTG GTGAAGCAG; Reverse primer (5’-3’): GTGTCGCTGTTGAAG TCAGAGGAG |
|
| HighGene plus Transfection reagent | ABclonal | RM09014P | |
| HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L) | Proteintech Group, Inc | SA00001-1 | |
| HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L) | Proteintech Group, Inc | SA00001-2 | |
| Human gastric mucosal epithelial GES-1 cells | Guangzhou Cellcook Biotech Co.,Ltd. | ||
| Human STAD HGC-27 cells | Procell Life Science&Technology Co.,Ltd | ||
| Human STAD SGC-7901 cells | Procell Life Science&Technology Co.,Ltd | ||
| MonAmp SYBR Green qPCR Mix (None ROX) | Mona (Suzhou) Biotechnology Co., Ltd | MQ10101S | |
| MonScript RTIII All-in-One Mix with dsDNase | Mona (Suzhou) Biotechnology Co., Ltd | MR05101M | |
| Omni-ECL Femto Light Chemiluminescence Kit | Epizyme Biotech | SQ201 | |
| PAGE Gel Fast Preparationb Kit | Epizyme Biotech | PG111 | |
| Penicillin-streptomycin (Pen-Strep) | Beijing Solarbio Science & Technology Co.,Ltd | P1400-100 | |
| Polyvinylidene difluoride (PVDF) membrane | Merck KGaA | IPVH00010-1 | |
| Protein Free Rapid Blocking Buffer | Epizyme Biotech | PS108P | |
| RIPA lysis solution | Beijing Solarbio Science & Technology Co., Ltd | R0010 | |
| RPMI 1640 complete medium | Thermo Fisher Scientific | C11875500BT | |
| Skimmed milk | Campina: Elk | ||
| TBST buffer solution | Beijing Solarbio Science & Technology Co., Ltd | T1082 | |
| The protein loading buffer | Epizyme Biotech | LT101S | |
| TMEM200A knockdown plasmid | MiaoLing Plasmid | ||
| TMEM200A primer | Sangon Biotech (Shanghai) Co., Ltd. | Forward primer (5’-3’): AAGGCGGTGTGGTGGTTCG; Reverse primer (5’-3’): GATTTTGGTCTCTTTGTCACGGTT | |
| TMEM200A SiRNA1 | MiaoLing Plasmid | Forward primer (5’-3’): ACAACTGATGATAAGACCAG; Reverse primer (5’-3’): TGTTGACTACTATTCTGGTC | |
| TMEM200A SiRNA2 | MiaoLing Plasmid | Forward primer (5’-3’): CGTGTGAATGTCAATGACTG; Reverse primer (5’-3’): GCACACTTACAGTTACTGAC | |
| TMEM200A SiRNA3 | MiaoLing Plasmid | Forward primer (5’-3’): ACAACCACAACATCTGCCCG; Reverse primer (5’-3’): TGTTGGTGTTGTAGACGGGC | |
| Transmembrane protein 200A Antibody | Proteintech Group, Inc | 48081-1 | |
| Equipment | |||
| CO2 cell culture incubator | Haier Group | PYXE-80IR | |
| Electrophoresis instrument | Bio-RAD | ||
| Fluorescence quantitative PCR instrument | Bio-RAD | ||
| Gel Imaging System (Tanon 5200) | Tanon Science & Technology Co., Ltd | LAB-0002-0007-SHTN | |
| Multifunctional Enzyme Labeler | Berthold |
References
- Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. Global cancer incidence and mortality rates and trends–an update. Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).
- Long, X., et al. Economic burden of malignant tumors – Yichang City, Hubei Province, China, 2019. China CDC Wkly. 4 (15), 312-316 (2022).
- Harbeck, N., Gnant, M. Breast cancer. Lancet. 389 (10074), 1134-1150 (2017).
- Bagchi, S., Yuan, R., Engleman, E. G. Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance. Annu Rev Pathol. 16, 223-249 (2021).
- Lam, G. T., et al. Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers. Mol Diagn Ther. 27 (1), 49-60 (2023).
- Gromiha, M. M., Ou, Y. Y. Bioinformatics approaches for functional annotation of membrane proteins. Brief Bioinform. 15 (2), 155-168 (2014).
- Schmit, K., Michiels, C. TMEM proteins in cancer: a review. Front Pharmacol. 9, 1345 (2018).
- Marx, S., et al. Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process. Semin Cancer Biol. 60, 96-106 (2020).
- Fu, K., et al. Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit. PLoS One. 12 (12), e0189006 (2017).
- Cuajungco, M. P., et al. Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology. Acta Histochem. 114 (7), 705-712 (2012).
- Zhang, S., et al. TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway. Cell Death Dis. 12 (12), 1086 (2021).
- Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry. Cell Mol Life Sci. 79 (2), 118 (2022).
- Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma. Onco Targets Ther. 13, 7735-7746 (2020).
- Jia, D., et al. Mining TCGA database for genes of prognostic value in glioblastoma microenvironment. Aging (Albany NY). 10 (4), 592-605 (2018).
- Wang, S., et al. UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data. Bioinformatics. 38 (2), 527-529 (2022).
- Li, T., et al. TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res. 48 (W1), W509-W514 (2020).
- Thul, P. J., et al. A subcellular map of the human proteome. Science. 356 (6340), eaal3321 (2017).
- Li, Y., Ge, D., Lu, C. The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization. Epigenetics Chromatin. 12 (1), 71 (2019).
- Chandrashekar, D. S., et al. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia. 25, 18-27 (2022).
- Tate, J. G., et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res. 47 (D1), D941-D947 (2019).
- Gao, J., et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 6 (269), pl1 (2013).
- Shen, W., et al. Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform. iMeta. 1 (3), e36 (2022).
- Ru, B., et al. TISIDB: an integrated repository portal for tumor-immune system interactions. Bioinformatics. 35 (20), 4200-4202 (2019).
- Yuan, H., et al. CancerSEA: a cancer single-cell state atlas. Nucleic Acids Res. 47 (D1), D900-D908 (2019).
- Sun, D., et al. TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment. Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).
- Warde-Farley, D., et al. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function. Nucleic Acids Res. 38, W214-W220 (2010).
- Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma. Front Genet. 13, 894865 (2022).
- Mueller Bustin, S. A., R, Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clin Sci (Lond). 109 (4), 365-379 (2005).
- Sun, L., Zhang, H., Gao, P. Metabolic reprogramming and epigenetic modifications on the path to cancer. Protein Cell. 13 (12), 877-919 (2022).
- Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. Genetics and epigenetics in asthma. Int J Mol Sci. 22 (5), 2412 (2021).
- Martínez-Reyes, I., Chandel, N. S. Cancer metabolism: looking forward. Nat Rev Cancer. 21 (10), 669-680 (2021).
- Chen, Y., et al. PremPS: Predicting the impact of missense mutations on protein stability. PLoS Comput Biol. 16 (12), e1008543 (2020).
- Li, M., Petukh, M., Alexov, E., Panchenko, A. R. Predicting the impact of missense mutations on protein-protein binding affinity. J Chem Theory Comput. 10 (4), 1770-1780 (2014).
- Hirsch, D., et al. Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system. J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).
- Poulogiannis, G., Frayling, I. M., Arends, M. J. DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome. Histopathology. 56 (2), 167-179 (2010).
- Chintamani, J., et al. The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer. Int Semin Surg Oncol. 4, 5 (2007).
- Deng, H., et al. High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer. Pathol Oncol Res. 29, 1610893 (2023).
- Stemmler, M. P. Cadherins in development and cancer. Mol Biosyst. 4 (8), 835-850 (2008).
- Bill, A., et al. ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer. Oncotarget. 6 (11), 9173-9188 (2015).
- De Las Rivas, J., et al. Cancer drug resistance induced by EMT: novel therapeutic strategies. Arch Toxicol. 95 (7), 2279-2297 (2021).
- Tian, S., et al. SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/β-catenin signaling pathway. Aging (Albany NY). 12 (4), 3574-3593 (2020).
