تصور تكرار الحمض النووي جزيء واحدة مع مضان المجهري

Biology
 

Summary

يوضح هذا البروتوكول بسيطة المجهري مضان المفرد جزيء تقنية لتصور تكرار الحمض النووي التي replisomes الفردية في الوقت الحقيقي.

Cite this Article

Copy Citation | Download Citations

Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy. J. Vis. Exp. (32), e1529, doi:10.3791/1529 (2009).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وصفنا بسيطة مضان المجهري المستندة في الوقت الحقيقي لمراقبة طريقة تكرار الحمض النووي على مستوى واحد جزيء. ومرفق بهذا التعميم ، قالب الحمض النووي متشعب إلى ساترة functionalized الزجاج على نطاق واسع وتكرارها بعد إدخال البروتينات النسخ والنيوكليوتيدات (الشكل 1). يتم توسيع المتزايد الناتج المزدوج حبلا الحمض النووي (dsDNA) مع تدفق الصفحي وتصور باستخدام صبغة الإقحام. قياس موقف نهاية الحمض النووي المتنامي في الوقت الحقيقي يسمح التحديد الدقيق لمعدل التكرار (الشكل 2). وعلاوة على ذلك ، وطول الحمض النووي الانتهاء من المنتجات تقارير عن processivity من تكرارها. يمكن إجراء هذه التجربة بسهولة وبسرعة جدا ويتطلب سوى مضان المجهر مع كاميرا حساسة إلى حد معقول.

Protocol

قبل إجراء التجربة تكرار المفرد جزيء ، وعدد قليل من المواد تحتاج إلى أن تكون معدة مسبقا.

1. الحمض النووي المتماثل قالب

الركيزة للتفاعل المتماثل هو ، الذيل biotinylated M13 دائرة المتداول أعدت باستخدام معيار تقنيات البيولوجيا الجزيئية 1،2.

المواد : M13mp18 احد الذين تقطعت بهم السبل الحمض النووي ، Biotinylated التمهيدي قليل النوكليوتيد الذيل (البيوتين 5' - 36 - T - 3 AATTCGTAAT CATGGTCATAGCTGTTTCCT ') ، T7 بوليميريز الحمض النووي ، وكتلة حرارية ، الكحول الفينول / Isoamyl / الكلوروفورم

  1. يصلب بنسبة ضئيلة الذيل biotinylated إلى M13 بإضافة فائض بمقدار 10 أضعاف في جزئية من المخزن TBS (330 نانومتر الذيل بنسبة ضئيلة ، 33 نانومتر M13).
  2. حرارة الخليط إلى 65 درجة مئوية في كتلة الحرارة. يسخن مرة واحدة ، وتحويل الحرارة خارج كتلة والسماح لتبريد البطيء يصلب بشكل صحيح التمهيدي.
  3. إضافة M13 تستعد لخليط من 64 نانومتر بوليميريز الحامض النووي وT7 T7 العازلة التي تحتوي على تكرار dNTPs وMgCl 2.
  4. احتضان رد الفعل عند 37 درجة مئوية لمدة 12 دقائق ، ويشفي مع EDTA 100 ملم.
  5. تنقية شغلها في الحمض النووي المنتج مع استخراج الكحول الفينول / كلوروفورم / isoamyl وdialyze العازلة في الشركة المصرية للاتصالات أو غيرها العازلة التخزين المناسبة وتحديد تركيز الحمض النووي (العودة - استخراج كل مرحلة العضوية المتبقية لاسترداد أي معبي M13).
  6. يمكن للمرء أن التكرار من إعداد قالب بسهولة جعل عدة ملليلتر من قالب تركيز nanomolar ، وهو ما يكفي لمئات الآلاف من التجارب جزيء واحد.

2. Functionalized Coverslips

لتركيب الحمض النووي للساترة الزجاج ، والزجاج functionalized لأول مرة مع aminosilane ، الذي يقترن ثم إلى جزيئات PEG biotinylated. طلاء هذا يساعد على الحد من التفاعلات غير محددة من الحمض النووي والبروتينات المتماثل مع سطح 1،3.

المواد : coverslips زجاج الجرار يلطخ ، 3 - aminopropyltriethoxysilane ، استر ميثوكسي - PEG5k - NHS ، البيوتين PEG5k NHSester ، الأسيتون ، KOH 1M ، والإيثانول ، فرن sonicator باث ،

  1. بدقة تنظيف الزجاج coverslips عن طريق وضعها في تلطيخ الجرار وملء الجرار مع الايثانول. يصوتن لمدة 30 دقيقة والتشطيف وملء الجرار مع KOH M 1. يصوتن لمدة 30 دقيقة كرر كل من يغسل.
  2. للتفاعل functionalization أولا ، كل أثر للمياه يجب أن يتم إزالتها. ملء الجرار مع الأسيتون ويصوتن لمدة 10 دقيقة. شطف الجرار مرة أخرى مع الأسيتون.
  3. إعداد 2 ٪ V / V حل كاشف سيلاني في الأسيتون. إضافة إلى تلطيخ الجرار وتستنهض الهمم لمدة 2 دقيقة. هذا رد فعل الأزواج المجموعة alkoxy من aminosilane على الزجاج ، وترك رد الفعل للأمين اقتران الخطوة المقبلة. إخماد التفاعل مع وجود فائض كبير من المياه.
  4. تجفيف coverslips بواسطة الخبز لهم في 110 درجة مئوية في الفرن لمدة 30 دقيقة.
  5. إعداد ميثوكسي 50:1 : البيوتين PEG الخليط في 100 درجة الحموضة 8.2 مم 3 NaHCO. تهدف لPEG ث / ت حوالي 0.2 ٪ biotinylated.
  6. ماصة 100 ميكرولتر من الخليط على PEG ساترة a silanized الجافة ومكان آخر ساترة على القمة. وبما في ذلك هل تسمح ساترة الزجاج العازل للcoverslips.
  7. لاحتضان coverslips في حل PEG لمدة 3 ساعات ، ثم فصل كل زوج من coverslips على نطاق واسع ، ويغسل بالماء. توخي الحذر للحفاظ على الجانب coverslips functionalized تصل كما سيتم المغلفة مرة واحدة فقط مع الجانب PEG.
  8. coverslips تجفيف وتخزين تحت فراغ. أسطح تظل ثابتة لمدة شهر على الأقل ، حتى يمكن إجراء عشرات coverslips في دفعة واستخدامها عند الحاجة.

وينبغي أن تكون هذه المواد في وقت مبكر ، وتستخدم بعد ذلك في كل تجربة. لبدء تجربة كل واحد جزيء ، تبدأ بتجميع غرفة التدفق.

3. تدفق غرفة التحضير

يتم إجراء التجربة باستخدام غرفة تدفق بسيطة شيدت مع ساترة functionalized ، الشريط على الوجهين ، وشريحة الكوارتز الأنبوب. غرفة واحدة مستعدة لتدفق 1،4 تجربة كل جزيء واحد.

المواد : الشريط على الوجهين ، شفرة الحلاقة ، مرر كوارتز مع ثقوب للأنابيب الإيبوكسي السريعة الجافة ، ساترة Functionalized (انظر أعلاه) ، Streptavidin حل (25 ميكرولتر من 1 ملغ / مل في برنامج تلفزيوني) ، الأنابيب ، العازلة الحظر (20 ملي تريس الرقم الهيدروجيني 7.5 ، 2 مم EDTA ، 50 مم كلوريد الصوديوم ، و 0.2 ملغ / مل جيش صرب البوسنة ، 0.005 ٪ توين - 20)

  1. تبدأ بوضع 20-25 مل من حجب العازلة في مجفف لإزالة أي فقاعات هواء لخطوات لاحقة.
  2. اتخاذ ساترة الربط بين functionalized وانتشار 125 من الحل streptavidin PBS - المخفف على السطح. اترك هذا لاحتضان لمدة 20 دقيقة في حين تستعد أجزاء أخرى من الغرفة ، والسماح لربط streptavidin biotins السطح.
  3. قطع قطعة من الجانب المزدوجد الشريط لتتناسب مع حجم الشريحة الكوارتز. علامة الموقف من الثقوب أنابيب على الشريط مع قلم رصاص بحيث يمكن استخلاص الخطوط العريضة للغرفة تدفق على الشريط (1 ملغ / مل).
  4. جعل 2 ملم واسعة مستطيل حول الثقوب. هذا سيكون بمثابة قناة تدفق ، لذا يجب التأكد من أن الجانبين على التوالي ، وتترك مجالا حول مدخل ومخرج الأنابيب. إذا رغبت في ذلك ، يمكن استخدام قنوات متعددة أو أحجام مختلفة.
  5. قطع على طول الخطوط العريضة تعادل جعل على التوالي ، وخفض نظيف للتأكد من عدم يبرز لاصقة في القناة.
  6. تنظيف الأسيتون الكوارتز بدقة باستخدام الإيثانول أو لإزالة اللاصق من البناء تدفق الخلية السابقة.
  7. العثور على أفضل محاذاة مخطط القناة ، وإزالة جانب واحد من دعم لاصقة والمكان بعناية الشريط على الشريحة الكوارتز. كن حذرا لمحاذاة الشريط بشكل صحيح ، والثقوب مدخل ومخرج ضرورة أن تبقى الافراج.
  8. قطع أطوال الأنابيب لمدخل ومخرج الخلية التدفق. فهو يساعد على خفض نهاية الأنبوب بنحو زاوية 30 درجة بحيث الأنبوب لن يضغط على شقة أسفل القاعة. وضع أنابيب على نوع من الدعم للتعليق عليها لمرفق سهل الى خلية تدفق في الخطوات المقبلة.
  9. شطف ساترة streptavidin المغلفة جيدا بالماء والجافة باستخدام الهواء المضغوط. تذكر أن functionalized جانب واحد فقط ، وأن يكون حريصا على عدم تحويل ساترة أكثر. إزالة الجانب الآخر من الشريط النسخ ومكان على الشريحة الكوارتز وساترة.
  10. اضغط برفق على ساترة لطرد الهواء المحبوس في أي لاصقة. هذا سوف يساعد على تجنب أي فقاعات هواء الدخول في قناة التدفق.
  11. الختم على جانبي الغرفة مع الايبوكسي. تضاف قطع الأنابيب في الثقوب من الكوارتز والختم في مكان مع الايبوكسي. هذا يحتاج لتجف لبضع دقائق.
  12. الجاف مرة واحدة ، تبدأ حظر السطح عن طريق سحب بعض degassed عازلة تمنع من خلال واحدة من الأنابيب. إبرة عيار 21 يناسب تماما داخل الأنابيب 0.76 ملم. طرد عدة مرات لإزالة فقاعات الهواء ، والسماح للغرفة لاحتضان لمدة ساعة على الأقل النصف.

4. المفرد جزيء المتماثل التجربة

المواد : أعدت غرفة التدفق ، SYTOX أورانج ، TIRF المجهر ، 532 نانومتر ليزر ، CCD كاميرا والكمبيوتر مع برنامج الحصول على الصور ، المتداول ، دائرة الركيزة الحمض النووي والبروتينات المتماثل

  1. بعد أن تم حظر تدفق الخلية ، كل شيء جاهز لبدء تجربة واحدة جزيء.
  2. أخذ خلية تدفق ووضعه على المسرح المجهر. تعقد غرفة في مكان مع مقاطع المرحلة والتأكد من أن يتم وضع مستقيم على طول قناة تدفق المحور ص.
  3. مأخذ توصيل أنبوب تدفق الخلية إلى المضخة باستخدام حقنة موصل أنابيب قطرها أكبر أو إبرة. مكان مدخل المخزن في منع وسحب على حقنة لإزالة أي الهواء في الأنبوب. وسوف نفض الغبار لطيف من الأنبوب مساعدة مخرج واضح أي فقاعات الهواء المحتبسة في الخلية التدفق.
  4. تمييع القالب الحمض النووي المخزون إلى 25 مساء في 1 مل من العازلة حظر. تدفق الى غرفة بسعر معتدل للسماح بتدفق جيد تغطية السطح من الحمض النووي. 0.025 مل / دقيقة لمدة 30 دقيقة يعمل بشكل جيد. يمكن أن تختلف هذه القائمة على مدى العديد من جزيئات الحمض النووي الموجودة على السطح في كل دفعة من coverslips أو كم هي المطلوبة للتجربة.
  5. مرة واحدة في الحمض النووي ، ويغسل من الحمض النووي باستخدام الفائض عازلة حظر. تغسل عن تدفق كميات الخلية لا يقل عن 200 للتخلص من الحمض النووي للجميع مجانا.
  6. يبدأ التفريغ المخزن المؤقت النسخ المتماثل. لهاء تكرار التجارب القولونية ، القيام بذلك في 37 درجة مئوية للحد من مخاطر فقاعات في غرفة تدفق ساخنة.
  7. بدوره على الليزر والكاميرا. اتفاقية مكافحة التصحر تبريد درجة الحرارة لتصل الاحتياجات قبل أن تتمكن من استخدامه.
  8. إذا كان إجراء 37 تجربة درجة مئوية ، بدوره على المدفأة. تأكد من أن الهدف من ذلك هو على اتصال مع خلية تدفق أو أنها ستكون بالوعة الحرارة في وقت لاحق.
  9. بعد الغسيل والتفريغ ، يمكن أن تكون على استعداد للتفاعل. النيوكليوتيدات المزيج ، DTT وSYTOX في المخزن المؤقت النسخ المتماثل. ثم يضاف المزيج بلطف والبروتينات.
  10. تدفق خليط التفاعل في الخلية التدفق. هذا يحتاج الى سرعة تدفق تكون كافية لتمتد dsDNA. عن 2 ملم واسعة ، 100 ميكرومتر قناة تدفق طويل القامة 0.04 مل / دقيقة يعمل بشكل جيد.
  11. إتاحة الوقت لمزيج من دخول القاعة ويبدأ التصوير. نصيحة جيدة لتحريك مجال الرؤية إلى جانب القناة والتركيز على المواد اللاصقة. وسوف يضمن هذا كنت بالقرب من السطح للتركيز.
  12. ضبط قوة الليزر ، والتركيز المجهر ، وزاوية TIRF. الحفاظ على الطاقة المنخفضة لتجنب أي photocleavage من الحمض النووي الملون. الحصول على 1-5 إطارات / ثانية لعدة دقائق اعتمادا على معدل تكرار الحمض النووي. إذا رغبت في ذلك ، كرر مسارات أطول للحصول على النسخ أو الانتقال إلى حقل جديد لرؤية المزيد من الجزيئات.
  13. بعد خليط التفاعل فارغة تقريبا ، انها فكرة جيدة للتدفق في أكثر العازلة مع SYTOX لرؤية حقول النظر الأخرى. التقاط صور متعددة من مختلف الجزيئات منسوخة توفر إحصاءات لتحديد processivity.

5. ممثل النتائج

وتعتبر الجزيئات بسهولة تكرار بنشاط كخطوط متزايد من الحمض النووي الملون. في تجاربنا ، التي تتدفق من مساء 25 الركيزة M13 يعطي 100-1000 الجزيئات في 60x ، الحقل × 125 ميكرومتر ميكرومتر 125 من عرض (الشكل 1). تكرار إجراء التجارب باستخدام E. البروتينات القولونية replisome عند 37 درجة مئوية (انظر المواد للحصول على التفاصيل) يعطي جزيئات 50-50 تكرار في مجال الرؤية. بتركيزات يعادل replisome T7 ، الذي يبدأ على الركيزة بكفاءة أكبر بكثير ، ونحن نلاحظ> 70 ٪ من الجزيئات في تكرار الحقل. هذه الشروط العائد كثافة المنتج عالية جدا ، بحيث يصعب الجزيئات الفردية لحل وتحليل ، لذلك يتم إجراء التجارب T7 بتركيزات أقل من البروتين.

تحليل البيانات : للحصول على معدل البيانات ، ببساطة مؤامرة نقطة النهاية من الحمض النووي في مقابل مرة وحساب المنحدر (الشكل 2). لprocessivity ، وتحديد الطول الكلي للالحمض النووي. سيكون كل من هذه الأرقام تحتاج إلى تحويلها إلى قاعدة أزواج. قبل تنفيذ التجربة ، يجب أن نعرف حجم بكسل للكاميرا في التكبير المناسب. لتحويل basepair ، وهو تقدير جيد هو تحويل ببساطة على أساس طول البلورات من الحمض النووي ، و 2.9 BP / نانومتر. ومع ذلك ، تدفق الصفحي ولن تمتد تماما الحمض النووي ، ولذلك يجب إجراء معايرة طول الحمض النووي DNA من خلال اتخاذ طول المعروف ، على سبيل المثال 48502 λ غليان الحمض النووي ، وإرفاقه مع تدفق خلية بنسبة ضئيلة biotinylated وقياس لها SYTOX الملطخة في طول معدل التدفق لتجربة استخدام النسخ المتماثل. وتحديد عدد من أزواج القاعدة / بكسل تسمح حساب دقيق لمعدلات تكرار وprocessivities. وسوف تتخذ العديد من الصور والأفلام توفير أعداد كبيرة من جزيء المنتج ، مما يسمح بالتخطيط لتوزيع معدل وprocessivity (الشكل 2) 1.

الشكل 1
الشكل 1 : (من المرجع 1). رسم كاريكاتوري) من تكرار تجربة متجددة ، دائرة. (SA ، streptavidin). الرائدة الجديلة التوليف يمتد الذيل ربط الدائرة والسطحية. يتم تحويلها إلى الذيل dsDNA من بوليميريز حبلا متخلفة وتعاني من الضغوط بسبب تدفق الصفحي.
ب) حقل مثال لعرض مع أورانج SYTOX الإثارة و 532 نانومتر. بقع الفلورسنت الصغيرة المربوطة ، غير منسوخة ركائز. لاحظ طول المدقع من المنتجات وعدد كبير من المنتجات في مجال (كل خلية تحتوي على تدفق> 5000 في تلك الحقول).

الشكل 2
الشكل 2 : (مقتبس من المرجع 1). أ ، ب) من الجزيئات Kymographs تكرار نموذجي من T7 (أ) و E. القولونية (ب) التجارب. ج) رسم مسارات الجزيئات من نقطة النهاية أ) و ب) في مقابل الوقت. يتم تركيبها مع مسارات الانحدار الخطي للحصول على معدلات تكرارها. الأمثلة المعروضة هي غليان 99.4 ق -1 و -1 غليان 467.1 ق. د) توزيع المنتجات طول التكرار ، تتناسب مع اضمحلال الأسي واحد للحصول على processivity : 25.3 ± 1.7 KBP (T7) ، 85.3 ± 6.1 KBP (كولاي). ه) توزيع معدل مسارات جزيء واحد ، تتناسب مع Gaussians واحد. يعني : 75.9 ± 4.8 غليان ق -1 (T7) ، 535.5 ± 39 سنة مضت ق -1 (كولاي).

Discussion

المراقبة الحرجة واحد هو دراسة تأثير أورانج SYTOX صمة عار ، على البروتينات تكرار الفائدة. وهناك طريقة بسيطة للقيام بذلك هي لتنفيذ تكرار التجربة في الخلية التدفق كما هو موضح ولكن مع إغفال SYTOX. بعد خليط التفاعل قد تدفقت عبر الغرفة ، إضافة إلى SYTOX العازلة مع وصمة عار الحمض النووي ودراسة توزيع طول جزيئات منسوخة. بدلا من ذلك ، يمكن استخدام معظم ردود الفعل القياسية لفحص أي تأثير على معدل تكرار SYTOX والكفاءة.

التجربة الموصوفة هنا فقط يستخدم تدفق قناة واحدة. يمكن تغيير هذا بسهولة من خلال خلق قنوات متعددة الغرف تدفق أو استخدام أو الأجهزة ميكروفلويديك PDMS مماثلة. زيادة عدد القنوات ييسر فحص تركيزات البروتين ، والمسوخ ، أو الجزيئات المانع ويزيد من سرعة جمع البيانات تكرارها.

كما ذكرنا ، فإننا أداء E. تكرار التجارب القولونية عند 37 درجة مئوية باستخدام تدفق الالومنيوم تدفئة المنازل بنيت الخلية ، عنصر التدفئة مقاوم (خرطوشة سخان) والمتغير امدادات الطاقة. وهذا يعطي درجة حرارة جيدة الاستقرار والابتعاد عن شراء سخان الهدف. لمعايرة جهاز التدفئة ، ونحن ببساطة حفر حفرة في وسط تدفق رأس خلية الكوارتز ، وإدراج الحرارية في قناة تدفق وتدفق العازلة كالمعتاد. قياس درجة حرارة التدفق العازلة خلية في زيادة الفولتية يسمح التدفئة دقيقة.

Acknowledgments

سمير حمدان ساعد في تطوير هذه التقنية. E. البروتينات القولونية هي من مختبر البروفيسور نيك ديكسون ، جامعة ولونغونغ ، والبروتينات هي من T7 البروفيسور تشارلز ريتشاردسون ، كلية هارفارد الطبية. وتدعم العمل الذي قامت به المعاهد الوطنية للصحة (GM077248 لAMvO) والتابوت جين تشايلدز مؤسسة (JJL).

Materials

Name Company Catalog Number Comments
M13mp18 ssDNA New England Biolabs N4040
Biotinylated Tail Oligo Integrated DNA Technologies
T7 DNA Polymerase New England Biolabs M0274 Use T7 replication buffer for substrate preparation
Phenol/ Isoamyl Alcohol/ Chloroform Roche Group 03117987001 24:24:1 v/v
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Ribonucleotide triphosphate solutions Amersham 272056 272066 272076 272086
SYTOX Orange Invitrogen S11368 Other dsDNA stain can be used
Fluorescence Microscope with 60x TIRF objective Olympus Corporation IX-71 Microscope, camera, etc. can be substituted for similar equipment
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
532 nm laser Coherent Inc. Compass 215M-75 Select wavelength to correspond to stain of choice
EMCCD Camera Hamamatsu Corp. ImagEM
Emission filter Chroma Technology Corp. HQ600/75m

T7 Replication: 40 mM Tris pH 7.5, 50 mM potassium glutamate, 10 mM magnesium chloride, 100 μg/mL BSA, with 5 mM dithiothreitol, 600 μM dNTPs, 300 μM ATP, 300 μM CTP, and 15 nM SYTOX Orange added immediately before use. Proteins added as: 5 nM gp4 (hexamer), 40 nM polymerase (1:1 gp5: thioredoxin), 360 nm gp2.51,5.

E. coli Replication: 50 mM HEPES pH 7.9, 12 mM magnesium acetate, 80 mM potassium chloride, 100 μg/mL BSA with 10 mM dithiothreitol, 40 μM dNTPs, 200 μM rNTPs, and 15 nM SYTOX Orange added immediately before use. Proteins added as: 30 nM DnaB (hexamer), 180 nM DnaC (monomer), 30 nM αεθ, 15 nM τ2γ1δδ’χψ or τ3δδ’χψ, 30 nM β (dimer), 300 nM DnaG, 250 nM SSB (tetramer), 20 nM PriA, 40 nM PriB, 320 nM PriC, 480 nM DnaT1,6

E. coli Replication: 50 mM HEPES pH 7.9, 12 mM magnesium acetate, 80 mM potassium chloride, 100 μg/mL BSA with 10 mM dithiothreitol, 40 μM dNTPs, 200 μM rNTPs, and 15 nM SYTOX Orange added immediately before use. Proteins added as: 30 nM DnaB (hexamer), 180 nM DnaC (monomer), 30 nM αεθ, 15 nM τ2γ1δδ’χψ or τ3δδ’χψ, 30 nM β (dimer), 300 nM DnaG, 250 nM SSB (tetramer), 20 nM PriA, 40 nM PriB, 320 nM PriC, 480 nM DnaT1,6

DOWNLOAD MATERIALS LIST

References

  1. Tanner, N. A., et al. Real-time single-molecule observation of rolling-circle DNA replication. Nucleic Acids Res. 37, e27 (2009).
  2. Tabor, S., Huber, H. E., Richardson, C. C. Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene 5 protein of bacteriophage t7. J Biol Chem. 262, 16212-16223 (1987).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) grafted to silicon surfaces: Grafting density and protein adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. DNA replication: Methods and protocols. Vengrova, S., Dalgaard, J. Z. 521, Humana Press. New York. 397-410 (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. Heller, R. C., Marians, K. J. Replication fork reactivation downstream of a blocked nascent leading strand. Nature. 439, 557-562 (2006).

Comments

16 Comments

  1. Nice job!

    Reply
    Posted by: Gloria K.
    March 4, 2010 - 10:35 AM
  2. 1-Her voice makes me nervous.
    ²- What is the brand/manufacturer of the double sided tape?

    Reply
    Posted by: Anonymous
    May 23, 2011 - 10:28 PM
  3. Double-sided tape is from Grace BioLabs, SecureSeal SA-S-1L

    Reply
    Posted by: Anonymous
    May 23, 2011 - 10:38 PM
  4. Thanks a lot for the response. One last question, s the tape waterproof too?
    ps. Her voice still bothers me!

    Reply
    Posted by: Anonymous
    May 24, 2011 - 5:10 PM
  5. Random questions, where did you get your air gun from?

    Reply
    Posted by: Anonymous
    January 30, 2012 - 6:59 PM
  6. I honestly don't remember, and another guy in the lab had ordered them, but it's a clean room product, so maybe some clean room supplier? Sorry.

    Reply
    Posted by: Anonymous
    February 9, 2012 - 9:01 AM
  7. DŒs any part of the work need to be done under a fume hood? Or everything can be done in open air.
    Thanks

    Reply
    Posted by: Anonymous
    February 8, 2012 - 9:45 PM
  8. No, none of it requires a fume hood. If you don't like the smell of acetone you could do the glass drying/functionalization steps in a hood, but it's not necessary.

    Reply
    Posted by: Anonymous
    February 9, 2012 - 9:02 AM
  9. Thanks for the answer. Really nice work!

    Reply
    Posted by: Anonymous
    February 9, 2012 - 9:19 AM
  10. Did you face any problem with the laser focus drifting because of the flow? If that happens how do you handle it.

    Reply
    Posted by: Anonymous
    March 2, 2012 - 5:34 PM
  11. No, the flow in the chamber is sufficiently independent of the microscope optics. The only thing that can affect focus is sudden, large pressure changes which could cause the glass to flex, and these would be only temporary. Flow dŒs affect TIRF, as molecules are stretched close to the surface and therefore in the TIRF evanescent wave, but that's the only way the optics and flow are connected.

    Reply
    Posted by: Anonymous
    March 5, 2012 - 5:00 PM
  12. I am doing single molecule FRET experiments. My slide surfaces get very dirty (at single molecule level) after the silanisation step. I am using Piranha solution for surface cleaning and the surfaces are very clean just before silanisation. Is there something I should be careful about in the silanisation step, do you have a cleaning step in addition to what you have described?
    thanks and best regards

    Reply
    Posted by: Tunc Y.
    June 20, 2012 - 8:20 PM
  13. Hi! I have exactly the same problem! Before the silanization everything is completely clean, without any inpurity. Do you filter your aminosilane or do you treat it somehow (e.g centrifuging before applying?)
    Thanks for your help

    Reply
    Posted by: Ulf H.
    May 29, 2013 - 5:36 AM
  14. We certainly saw some surface variability, i.e. clean spots and dirty spots, but it was never really a big issue (though we're looking stained dsDNA here vs. single fluorophores). We didn't filter our silane solutions, but from the two comments it sounds like some sort of impurity is conferred in that step so perhaps some cleanup would help. We did notice that the fresher the silane, the better the surfaces, so I'd recommend the smallest bottle size and limited re-use. Sorry for not being more helpful, just never spent time dealing with that step. I'm not currently doing fluorescence experiments, though, so there may be improved methods out there.

    Reply
    Posted by: Anonymous
    May 29, 2013 - 8:07 AM
  15. Thank you very much!

    Reply
    Posted by: Ulf H.
    May 30, 2013 - 4:35 AM
  16. Hi, I should say first it is a very nice technique that you developed. I was wondering if I can analyze long DNA chains with this tecnique. So, my question is; does this technique have a size limitation of DNA?

    Reply
    Posted by: Fabio C.
    November 20, 2015 - 11:40 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics