में आनुवंशिक अभिव्यक्ति प्रोफाइल निर्धारण सी. एलिगेंस माइक्रोएरे और वास्तविक समय पीसीआर का उपयोग

Biology
 

Summary

माइक्रोएरे विश्लेषण में आनुवंशिक अभिव्यक्ति प्रोफाइल को निर्धारित करने के लिए आयोजित किया गया

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Synapses संकेत और लक्ष्य कक्ष में एक postsynaptic टर्मिनल सेल में एक presynaptic सक्रिय क्षेत्र की रचना कर रहे हैं. रासायनिक synapses के मामले में, संदेश presynaptic टर्मिनल से जारी है और postsynaptic कोशिकाओं पर रिसेप्टर्स द्वारा प्राप्त न्यूरोट्रांसमीटर द्वारा किया जाता है. हमारे Caenorhabditis एलिगेंस में पिछले अनुसंधान से पता चला है कि वीएसएम-1 नकारात्मक exocytosis नियंत्रित. इसके अतिरिक्त, VSM-1 म्यूटेंट में synapses के विश्लेषण से पता चला है कि एक पूरी तरह कार्यात्मक वीएसएम-1 वृद्धि हुई है synaptic कनेक्टिविटी की कमी पशुओं. इन प्रारंभिक निष्कर्षों के आधार पर, हम धारणा है कि सी. एलिगेंस वीएसएम - एक synaptogenesis में एक महत्वपूर्ण भूमिका निभा सकते हैं. इस परिकल्पना का परीक्षण करने के लिए, डबल - लेबल माइक्रोएरे विश्लेषण किया था, और जीन की अभिव्यक्ति प्रोफाइल निर्धारित किया गया है. पहले कुल शाही सेना पृथक किया गया, विपरीत सीडीएनए लिखित, और डीएनए संकरित. फिर, फ्लोरोसेंट जांच संकरण के विश्लेषण में सिलिको बढ़ाया synaptogenesis साथ म्यूटेंट में कई प्रमुख शुक्राणु प्रोटीन (एमएसपी) परिवार के सदस्यों के लिए कोडिंग जीन की महत्वपूर्ण शामिल से पता चला. MSPS सी. में शुक्राणु का एक प्रमुख घटक हैं एलिगेंस और निमेटोड oocyte परिपक्वता और ovulation के संकेत दिखाई देते हैं. फल मक्खियों में, चाय और 1 सहयोगियों दिखा दिया कि एमएसपी की तरह अणुओं neuromuscular जंक्शन पर presynaptic bouton संख्या और आकार को विनियमित. इसके अलावा, विश्लेषण Tsuda और सहकर्मियों के द्वारा प्रदर्शन दो सुझाव दिया है कि MSPS Eph रिसेप्टर्स और ट्रिगर रिसेप्टर tyrosine kinase संकेत cascades के लिए ligands के रूप में कार्य कर सकते हैं. अंत में, वास्तविक समय पीसीआर विश्लेषण पुष्टि की है कि एमएसपी 32 के लिए कोडिंग के जीन (ok1468) VSM-1 म्यूटेंट में प्रेरित है. साथ में ले ली, हमारी प्रयोगशाला द्वारा निष्पादित अनुसंधान दिखाया है कि-1 VSM म्यूटेंट synaptic घनत्व में एक महत्वपूर्ण वृद्धि हुई है, जो एमएसपी 32 संकेतन द्वारा मध्यस्थता हो सकता है.

Protocol

1. कुल शाही सेना के अलगाव

  1. स्वस्थ सिंक्रनाइज़ नेमाटोड कमरे के तापमान M9 मध्यम के साथ प्लेटें धोने, थाली 2-3 मिलीलीटर प्रति का उपयोग करके काटा गया. Resuspended नेमाटोड centrifugation, 3200 ग्राम से 15 मिलीलीटर शंक्वाकार ट्यूबों और pelleted नीचे करने के लिए हस्तांतरित किया गया 4 मिनट के लिए 4 ° C में. काटा नेमाटोड 0.1M NaCl के 7 मिलीग्राम और बर्फ के ठंडे 60% w / ध् sucrose के 7 मिलीलीटर के साथ गोली resuspending द्वारा जारी बैक्टीरिया से बाहर साफ कर रहे थे. resuspended मिश्रण बर्फ पर 15 मिनट और स्वच्छ नेमाटोड के लिए incubated था, तैरना जो sucrose के समाधान के माध्यम से, 3200 जी में 4 ° C में 4 मिनट के लिए मिश्रण centrifuging के बाद एकत्र किए गए थे. बैक्टीरिया मुक्त कीड़े को एक नया ट्यूब शंक्वाकार बाँझ pipettes का उपयोग करने के लिए स्थानांतरित कर दिया गया और ऊपर से 15 मिलीलीटर RNase मुक्त 4 पर एक 3200 छ centrifugation ° सी 2 मिनट के लिए द्वारा पीछा पानी के साथ दो बार धोया. साफ शिथिल ठोस गोली 1.5 मिलीलीटर microcentrifuge ट्यूब को हस्तांतरित किया गया है और 30 सेकंड के लिए अधिकतम गति (लगभग 10,000 छ) पर centrifuged. अंत में, सबसे RNase मुक्त पानी निकाल दिया गया था और RNAlater के 10 संस्करणों गोली जोड़ा गया है, और 4 में संग्रहीत डिग्री सेल्सियस तक आगे बढ़ने के लिए तैयार है.
  2. कुल शाही सेना के नमूने तैयार करने के लिए, काटा नेमाटोड 4 मिनट के लिए अधिकतम गति (लगभग 10,000 छ) पर centrifuged थे और RNAlater खारिज कर दिया था. फिर, आण्विक पीस राल (bioscience जी) का एक चुटकी गोली जोड़ा गया है और मिश्रण तरल नाइट्रोजन का उपयोग जम गया था. फ्रोजन कीड़ा निलंबन एक ठीक पाउडर में मूसल और तरल नाइट्रोजन के साथ grinded था आवश्यक के रूप में जोड़ा गया है पाउडर ठंड रखने. पीसने के बाद, निकालने के 5 मिनट के लिए बर्फ पर रखा गया था और फिर 700 μl RLT / BME (अनुपात RLT के 100 मात्रा: BME की एक मात्रा) के साथ मिश्रित (Qiagen) और 472 μl 100% इथेनॉल.
  3. कुल शाही सेना RNeasy मिनी किट (Qiagen) का उपयोग कर और निर्माता की सिफारिश प्रोटोकॉल के बाद पृथक किया गया. पृथक शाही सेना के अंतिम मात्रा जैविक नमूना प्रति 60 μl था.

2. डीएनए पाचन और आरएनए क्लीनअप

  1. कुल संभावित जीनोमिक डीएनए के साथ दूषित शाही सेना के 50 μg DNase मैं (Qiagen) के साथ पचा किया गया था. डाइजेस्ट प्रतिक्रियाओं युक्त 0.1 यू DNase 1 / μg शाही सेना और 1X बफर RDP 10 मिनट के लिए कमरे के तापमान पर incubated रहे थे.
  2. आरएनए नमूने DNase के साथ इलाज किया, मैं साफ - RNeasy MinElute किट क्लीन अप (Qiagen) का उपयोग कर रहे थे. निर्माता द्वारा सिफारिश प्रोटोकॉल का पालन थे और 60 μl अंतिम eluted मात्रा प्राप्त हुई थी.

3. शाही सेना के गुणात्मक और मात्रात्मक विश्लेषण

  1. आरएनए एकाग्रता यूवी स्पेक्ट्रोफोटोमीटर Nanodrop (थर्मो वैज्ञानिक) का उपयोग करके निर्धारित किया गया था.
  2. शाही सेना के नमूनों की वफ़ादारी agarose वैद्युतकणसंचलन का उपयोग मूल्यांकन किया गया था. संक्षेप में, 1% RNase मुक्त agarose जैल 1X उत्तरी मैक्स Gly जेल तैयारी / रनिंग बफर (Ambion), 1% RNase मुक्त agarose ले (Ambion) और 0.5 / μg मिलीलीटर ethidium ब्रोमाइड का उपयोग कर तैयार किया गया. जबकि जेल polymerizing था, शाही सेना के नमूने Glyoxyl नमूना के 5 μl 50 में डाई / नमूना और नमूने incubating लोड हो रहा है ° C 30 मिनट के लिए जोड़ने द्वारा glyoxylated थे. शाही सेना सीढ़ी भी glyoxylated आकार तुलना के लिए लोड किया गया था.

4. सीडीएनए संश्लेषण

  1. प्रत्येक संश्लेषण प्रतिक्रिया के लिए, 8.4 μg आरएनए नमूना 1 μl आरटी प्राइमर (1 pmole / μl) के साथ मिलाया गया था. एक नमूना (WT या उत्परिवर्ती) Cy5 कब्जा आरटी प्राइमर प्राप्त है, अन्य नमूना Cy3 कब्जा आरटी प्राइमर (ऐरे 350 किट लेबल जांच, Genisphere के साथ प्रदान की) प्राप्त किया. नमूना मिश्रण 75-80 ° 10 मिनट के लिए सी में गर्म थे और 2-3 मिनट के लिए बर्फ को हस्तांतरित.
  2. जबकि शाही सेना के नमूने सेते हैं, MasterMix (Genisphere) के रूप में तैयार किया गया था: प्रत्येक आरटी प्रतिक्रिया के लिए, हम संयुक्त आर टी के लिए 4 μl 5X रिएक्शन बफर, 1 μl dNTP (10 मिमी प्रत्येक dATP dCTP, dGTP, dTTP), 1 μl Superase RNase (ऐरे 350 किट लेबल जांच, Genisphere के साथ प्रदान की) अवरोध करनेवाला, 1 μl आरटी एनजाइम (200 यू / μl). अंतिम MasterMix के 7 μl प्रत्येक शाही सेना के नमूने के लिए जोड़ा था, धीरे मिश्रित (भंवर उपयोग नहीं है) और 42 पर 2 घंटे incubated डिग्री सेल्सियस

5. आरएनए गिरावट और सीडीएनए नमूने के शोधन

  1. सीडीएनए संश्लेषण 3.5 μl 0.5m NaOH/50mM EDTA (अंतिम एकाग्रता) जोड़कर बंद कर दिया गया था और 65 में incubated डिग्री सेल्सियस 15 मिनट के लिए. फिर, प्रतिक्रियाओं Tris - एचसीएल 1M, पीएच 8.0 का उपयोग करने के लिए 850 मिमी Tris - एचसीएल के अंतिम एकाग्रता तक पहुँचने के निष्प्रभावी रहे थे. अन्त में, WT और उत्परिवर्ती cDNAs एक microcentrifuge ट्यूब में संयुक्त थे. 73 μl 1X ते बफर के साथ खाली ट्यूब rinsed किया गया था और सीडीएनए युक्त ट्यूब के लिए जोड़ा, संयुक्त cDNAs ट्यूब के अंतिम मात्रा 130 μl था.
  2. मिश्रित सीडीएनए निम्नलिखित निर्माता प्रोटोकॉल और QIAquick पीसीआर शोधन किट (Qiagen) शुद्ध किया गया था. सीडीएनए शुद्ध परिणामी eluted मात्रा 60 μl था.

6. प्रथम माइक्रोएरे संकरण

  1. सी एलिगेंस माइक्रोएरे GCAT (सक्रिय शिक्षण के लिए जीनोम कंसोर्टियम) के माध्यम से प्राप्त की स्लाइड पर अवरुद्ध किया गया1 0.1 मिलीग्राम / मिलीलीटर sonicated सामन 3X एसएससी में शुक्राणु डीएनए, 0.1% एसडीएस का उपयोग कर एक घंटे के लिए कमरे के तापमान. अवरोधित स्लाइड्स ddH2O और स्पिन नीचे में KimWipe साथ 50 मिलीलीटर शंक्वाकार ट्यूबों में 2,000 ग्राम पर 1 मिनट के लिए centrifuging द्वारा सूखे में सूई से rinsed थे.
  2. फिर, 2X संकरण formamide आधारित बफर (Genisphere) 55 ° जी सी, 10 मिनट के लिए अच्छी तरह से मिला क्रिस्टल भंग करने और +१०००० पर 1 मिनट के लिए centrifuged में incubated अगला, 25 μl सीडीएनए नमूना धीरे 2X संकरण formamide आधारित बफर के 25 μl के साथ flicking द्वारा मिलाया गया था. पतला सीडीएनए नमूना फ़्लैश स्पिन से 15 सेकंड के लिए एकत्र किया गया था और 80 डिग्री 10 मिनट के लिए सी incubated.
  3. अंतिम, सीडीएनए ध्यान से स्लाइड को छू के बिना पूरे गरम सीडीएनए नमूना pipetting द्वारा स्लाइड माइक्रोएरे संकरित किया गया था. नमूना समान धीरे एक कवर पर्ची एक सिरिंज सुई का उपयोग कम से माइक्रोएरे पर फैल गया था. से पहले कवर पर्ची पूरी तरह से उतारा गया, कवर पर्ची वापस ऊपर खींच लिया था, तो सुई के साथ उतारा फिर से, और धीरे जगह में गिर करने की अनुमति, हवाई बुलबुले के गठन को न्यूनतम. पहले ऊपर सेट संकरण स्लाइड क्षैतिज स्लाइड नीचे एक 50 मिलीलीटर शंक्वाकार ट्यूब में डाल DDH 2 हे 50 μl के साथ समापन हुआ था और 37 डिग्री सेल्सियस पर रातोंरात incubated

7. दूसरा संकरण

  1. Hybridized प्रोटीन 2X एसएससी के साथ विभिन्न तापमान पर धोया गया. सबसे पहले, माइक्रोएरे स्लाइड्स शंक्वाकार ट्यूबों युक्त कमरे के तापमान 2X एसएससी और 0.2% एसडीएस के लिए स्थानांतरित कर दिया गया और धीरे sloshed कवर फिसल जाता है हटा. फिर, माइक्रोएरे स्लाइड्स शंक्वाकार 55 डिग्री सेल्सियस 2X एसएससी और 0.2% एसडीएस युक्त ट्यूबों के लिए स्थानांतरित कर दिया गया है और 55 डिग्री सेल्सियस incubated 15 मिनट के लिए. अगला, स्लाइड एसएससी 2X स्थानांतरित कर दिया गया और कमरे के तापमान पर incubated 15 मिनट के लिए, धीरे समय - समय मिलाते हुए. अंतिम, स्लाइड्स 0.2X एसएससी स्थानांतरित कर दिया गया और 15 मिनट के लिए कमरे के तापमान पर incubated, धीरे समय - समय मिलाते हुए. धोया स्लाइड्स स्पिन नीचे में एक KimWipe के साथ 50 मिलीलीटर शंक्वाकार ट्यूबों में स्लाइड्स के नीचे लेबल साइड शुरू करने से सूख रहे थे और जी 2000 में 1 मिनट के लिए centrifuged
  2. आगे, दूसरे संकरण मिश्रण 2X संकरण formamide आधारित बफर (Genisphere) का उपयोग कर तैयार किया गया था. संकरण बफर 55 ° सी में 10 मिनट के लिए incubated था और १०,००० में 1 मिनट के लिए जी centrifuged फ्लोरोसेंट अभिकर्मकों कैप्चर (Cy3 और Cy5) और विरोधी - फीका अभिकर्मक कमरे के तापमान पर thawed थे और पन्नी के साथ कवर photobleaching से अभिकर्मकों की रक्षा. बाद संकरण कदम कम से कम प्रकाश जोखिम के लिए अंधेरे में प्रदर्शन किया गया. 2X संकरण formamide आधारित बफर के 150 μl 1.5 μl विरोधी फीका संकरण विरोधी फीका इलाज मिश्रण बनाने अभिकर्मक के साथ संयुक्त किया गया था.
  3. अभिकर्मकों Cy3 और 3 सेकंड के लिए Cy5 vortexed थे और 15 सेकंड के लिए centrifuged, 10,000 जी पर कब्जा 75 μl संकरण विरोधी फीका इलाज मिश्रण, 60 μl nuclease मुक्त पानी, 7.5 μl Cy3 कब्जा अभिकर्मक, और 7.5 μl Cy5 कब्जा अभिकर्मक के संयोजन द्वितीय संकरण मिश्रण तैयार किया गया था. दूसरा संकरण मिश्रण 10 मिनट के लिए 75 में incubated किया गया था डिग्री सेल्सियस और गर्म मिश्रण के 50 μl बहुत सावधानी से माइक्रोएरे / धोया सूखे स्लाइड पर pipetted किया गया था. समान माइक्रोएरे पर नमूना फैल करने के लिए, एक कवर पर्ची धीरे एक सिरिंज सुई का उपयोग उतारा गया. से पहले कवर पर्ची पूरी तरह से उतारा गया, कवर पर्ची वापस ऊपर खींच लिया था, तो सुई के साथ उतारा फिर से, और धीरे जगह में गिर करने की अनुमति, हवाई बुलबुले के गठन को न्यूनतम. माइक्रोएरे स्लाइड Hybridizing क्षैतिज 50 मिलीलीटर शंक्वाकार पन्नी के साथ कवर और DDH 2 हे के 50 μl ट्यूब में रखा गया था एक नम कक्ष बनाने के लिए स्लाइड के नीचे जोड़ा गया है. दूसरा संकरण 37 ° C पर 2-5 घंटे के लिए incubated था.
  4. दूसरा hybridizing माइक्रोएरे अंधेरे का उपयोग कर कमरे के तापमान 2X एसएससी, एसडीएस 0.2%, 1 मिमी डीटीटी में धुल गया था और धीरे sloshed को कवर पर्ची निकालने. फिर, माइक्रोएरे कवर शंक्वाकार 55 डिग्री सेल्सियस 2X एसएससी, 0.2% एसडीएस, 1 मिमी डीटीटी युक्त ट्यूब के लिए स्थानांतरित किया गया था और 55 डिग्री सेल्सियस पर 15 मिनट के लिए incubated अगली स्लाइड कवर शंक्वाकार 2X एसएससी, 1 मिमी डीटीटी और 15 मिनट के लिए कमरे के तापमान पर incubated, धीरे समय - समय मिलाते युक्त ट्यूब को हस्तांतरित किया गया. अंतिम स्लाइड 0.2X एसएससी, 1 मिमी डीटीटी को हस्तांतरित किया गया और 15 मिनट के लिए कमरे के तापमान पर incubated, धीरे समय - समय मिलाते हुए. माइक्रोएरे स्लाइड 1 मिनट, 2,000 जी, लेबल साइड कवर 50 मिलीलीटर नीचे में KimWipe साथ शंक्वाकार ट्यूब में स्लाइड नीचे के लिए centrifuging सूख गया था. सूखी माइक्रोएरे स्लाइड्स डेविडसन कॉलेज में GenePix व्यक्तिगत स्कैनर मॉडल 4100A का उपयोग स्कैन किया गया.

8. माइक्रोएरे विश्लेषण

  1. स्कैनिंग के बाद प्राप्त छवियाँ MAGICTool डेविडसन कॉलेज में लॉरी हेयर और उसके स्नातक छात्रों द्वारा विकसित सॉफ्टवेयर का उपयोग विश्लेषण किया गया. संक्षेप में, "परियोजना" टैब के अंतर्गत, एक "नई परियोजना" बनाया था और बचाया. "अभिव्यक्ति बनाएँ प्रोफाइल" टैब के तहत "लोड छवि जोड़ी" चयनित किया गया था और लाल छवि फ़ाइल (_635.tif) "लाल" के रूप में अपलोड किया गया था और हरे रंग की छवि फ़ाइल (_532.tif) "ग्रीन" के रूप में अपलोड किया गया था. फिर, "अभिव्यक्ति प्रोफ़ाइल बनाएँ" टैब और "लोड जीन सूची", एक सी. का उपयोग एलिगेंस जीन सूची GCAT वेबसाइट से प्राप्त फ़ाइल अपलोड किया गया था.
  2. माइक्रोएरे छवि को संबोधित किया गया था और "अभिव्यक्ति प्रोफ़ाइल बनाएँ" टैब और "ग्रिड बनाएँ / संपादित करें" विकल्प का उपयोग करते हुए gridded. , "22 पंक्तियाँ" और "प्रत्येक ग्रिड के लिए 22 स्तंभों", "ग्रिड" सेटअप संवाद बॉक्स ग्रिड की संख्या के लिए "48" का उपयोग कर संपादित किया गया था स्पॉट गिने "दाएँ से बाएँ" और "ऊपर से नीचे". "प्रतिशत कॉन्ट्रास्ट बदलें" बढ़ गया था और ग्रिड पर में zoomed है जब तक व्यक्ति स्पॉट आसानी से अलग पहचाना गया. ग्रिड पहले बाएँ हाथ पैनल पर "सेट टॉप वाम स्पॉट" का चयन करके बनाया गया था. फिर, ऊपरी बाएँ हाजिर केंद्र, ऊपर सही स्थान और नीचे पंक्ति "एक ग्रिड" पर क्लिक थे. यह gridding प्रक्रिया 48 ग्रिड के प्रत्येक के लिए दोहराया गया था, सही और ऊपर से नीचे के लिए छोड़ दिया कार्यवाही है. जब gridding पूरा किया गया, मौजूदा ग्रिड के अंतर्गत "फ़ाइल" "के रूप में वर्तमान ग्रिड सहेजें बचाया था. जब ग्रिड सफलतापूर्वक सहेजा गया है "समाप्त" टैब का चयन किया गया था.
  3. विश्लेषण से किसी भी असंबंधित धब्बे खत्म करने के लिए, "बनाएँ अभिव्यक्ति प्रोफाइल" टैब खोला गया था. के तहत विकल्प "फ़ुटपाथ स्पॉट" Gridding को संबोधित करते "चुना गया था. रेखादार धब्बे या पृष्ठभूमि प्रतिदीप्ति झंडी दिखाकर रवाना किया गया और चयन "फ़ाइल टैब" के अंतर्गत "जैसा कि वर्तमान झंडे सहेजें" द्वारा बचाया.
  4. ध्वजांकित फ़ाइलें "अभिव्यक्ति बनाएँ प्रोफाइल" टैब का उपयोग कर और पसंद के विखंडन विधि के रूप में "निश्चित त्रिज्या" का चयन खंडों थे. त्रिज्या इच्छित आकार करने के लिए स्थापित किया गया था, और "अद्यतन डाटा" क्लिक किया था. सुनिश्चित करें कि सर्कल gridded क्षेत्र (पीला वर्ग) के भीतर रहता है हम ऊपर से नीचे scrolled और सही करने के लिए छोड़ दिया और एक बार जाँच चयनित "अभिव्यक्ति प्रोफ़ाइल बनाएँ" था.
  5. स्पॉट है कि फ़ुटपाथ के बाद बने रहे प्रत्येक के लिए हरी प्रतिदीप्ति अनुपात: विभाजन के दौरान, सॉफ्टवेयर रेड गणना. "अभिव्यक्ति" टैब, "आंकड़ों में हेरफेर" रूपांतरण "का उपयोग चुना गया था. एक "रूपांतरण डाटा" संवाद बॉक्स दिखाई जहां "logb (x)" विकल्प, और ख = 2 प्रवेश किया था. "कार्य अभिव्यक्ति फ़ाइल" "अभिव्यक्ति" टैब से पता लगाया था. एक प्रयोग में जो जंगली प्रकार Cy3 (हरा) पर कब्जा अनुक्रम प्राप्त और उत्परिवर्ती Cy5 (लाल) पर कब्जा अनुक्रम प्राप्त के लिए, लॉग तब्दील अनुपात के मूल्य जीन है कि प्रेरित थे और दमित जीनों के लिए नकारात्मक के लिए सकारात्मक थे.
  6. पिछले है, प्रेरित किया है या एक निर्दिष्ट कारक द्वारा दमित जीन का चयन "अन्वेषण" "अभिव्यक्ति" टैब के तहत विश्लेषण किया गया. "तलाश" संवाद बॉक्स में, "मूल्य मिन. <एक्स (दमित जीन के लिए ऋणात्मक संख्या)" या "> एक्स (प्रेरित जीनों के लिए धनात्मक संख्या) अधिकतम मूल्य." के साथ जीन को स्थापित किया गया था "मिलान मानदंड जीन का पता लगाएं" # 5 में वर्णित के रूप में प्रयोग. मोड़ो अभिव्यक्ति के लिए 2x बराबर था, जहां 'एक्स' चयन मानदंड में प्रवेश संख्या का मूल्य है.

9. सीडीएनए संश्लेषण और वास्तविक समय पीसीआर

  1. कुल शाही सेना को पृथक किया गया के रूप में पहले वर्णित है. एक बार और पृथक शाही सेना की गुणवत्ता और मात्रा निर्धारित किया गया था, सीडीएनए iScript सीडीएनए संश्लेषण (BioRad) किट, 500 एनजी / μl कुल जंगली प्रकार और उत्परिवर्ती, और निर्माता की सिफारिश प्रोटोकॉल से अलग शाही सेना का उपयोग संश्लेषित किया गया था.
  2. वास्तविक समय पीसीआर प्रतिक्रियाओं SYBR ग्रीन (बुद्धि BioRad) Supermix, 100-500 nmoles जीन विशिष्ट प्राइमरों (तालिका 1) और 4 μl पिछले कदम से उत्पादित cDNAs का उपयोग कर अप सेट थे. 10 μl प्रतिक्रियाओं thermocycler CFX96 सिस्टम रियल - टाइम (BioRad) का उपयोग कर चला गया.
  3. thermocycler पहली बार 95 डिग्री सेल्सियस 3 मिनट के लिए गर्म था. यह 5 सेकंड के लिए 95 ° C पर एक कदम और 58 डिग्री सेल्सियस 30 सेकंड के लिए द्वारा पीछा किया गया था. यह पाश कुल चालीस बार पूरा हो गया, और 0.5 डिग्री के एक ढाल के साथ एक 65-95 डिग्री सेल्सियस पिघल वक्र भी डाला गया था. ΔΔCT मूल्यों नियंत्रण के रूप में तीन जीन गृह व्यवस्था (अधिनियम-1, सीडीसी-42, और PMP-3) का उपयोग कर की गणना की गई.
जीन आगे प्राइमर रिवर्स प्राइमर
जीएसटी - 5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
जीएसटी - 9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl - 1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
ksr - 2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
लिम - 9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
LPR-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
संदेश 6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
एमएसपी 32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
एमएसपी 142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
msp-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
एमएसपी 45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
एमएसपी 49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
एमएसपी 56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

1 टेबल अग्रेषित और वास्तविक समय पीसीआर के लिए प्राइमर अनुक्रम रिवर्स

10. प्रतिनिधि परिणाम:

शाही सेना के अलगाव और विश्लेषण

Presynaptic साइटों पर सक्रिय क्षेत्र अग्रदूत vesicles के फ्यूजन synaptogenesis (3) के दौरान एक अनिवार्य कदम है. 1-वीएसएम, एक हाल ही में पहचान ध् जाल मास्टर प्रोटीन, एक अनपेक्षित तंत्र (4, और हमारे अप्रकाशित काम) द्वारा खमीर और नेमाटोड में synaptogenesis में पुटिका संलयन (चित्रा 1 देखें) को बाधित करने के लिए प्रस्तावित किया गया था. बेहतर आणविक अंतर्निहित मार्ग को समझने के लिए वीएसएम 1 नेमाटोड में विनियमन और synaptogenesis क्षेत्र में कुछ प्रकाश लाने के लिए, हम एक जीनोम चौड़ा स्क्रीन शुरू हुआ और निर्धारित किया है कि प्रमुख शुक्राणु प्रोटीन जीन (एमएसपी) को पूरी तरह कार्यात्मक वीएसएम-1 के अभाव में प्रेरित कर रहे हैं .

सी. के वीएसएम (ok1468) एक उत्परिवर्ती तनाव में प्रेरित जीनों की जांच एलिगेंस, हम एक जीन माइक्रोएरे विश्लेषण का आयोजन किया. यह जंगली प्रकार से अलग टेप और VSM-1 उत्परिवर्ती तनाव परीक्षण और उनके संवर्धन निर्धारण किया गया था. विशेष रूप से, हम पहले तुल्यकालिक L4 और L3 जंगली प्रकार और VSM एक उत्परिवर्ती लार्वा नेमाटोड से कुल शाही सेना अलग. तो, हम कुल DNase मैं के साथ प्राप्त की शाही सेना का इलाज किया और निकाले agarose जेल वैद्युतकणसंचलन का उपयोग शाही सेना के गुणवत्ता की जांच की. आंकड़ा 2 में दिखाया गया है प्रयोग में एक सीढ़ी पहली गली में इस्तेमाल किया गया था मानकों के लिए बेस जोड़े की संख्या का प्रतिनिधित्व करते हैं. जंगली प्रकार के नमूने पूर्व इलाज और DNase साथ पोस्ट का इलाज मैं 2 और 4 गलियों में भरी हुई थी, और VSM-1 उत्परिवर्ती नमूने पूर्व और इलाज के बाद इलाज DNase साथ मैं गलियों 3 और 5 में भरी हुई थी, क्रमशः . आरएनए जेल वैद्युतकणसंचलन का विश्लेषण है कि जंगली प्रकार और VSM-1 उत्परिवर्ती आरएनए नमूने दिखाया बरकरार है और अच्छी गुणवत्ता के थे . यह दो बैंड है जो ribosomal शाही सेना की दो यूनिटों का प्रतिनिधित्व देख द्वारा निर्धारित किया गया था.

माइक्रोएरे संकरण

एक बार शाही सेना की गुणवत्ता निर्धारित किया गया था, हम सीडीएनए संश्लेषण के साथ रवाना हुए. ऐसा करने के लिए, हम रिवर्स mRNA लिखित और पूंछ के लिए एक पर कब्जा अनुक्रम जोड़ा. उत्पादन Cy3 और Cy5 के लिए कब्जा दृश्यों से युक्त cDNAs स्लाइड्स माइक्रोएरे संकरित थे और स्कैनिंग के लिए भेज दिया. माइक्रोएरे चित्र तो एक खुला स्रोत कंप्यूटर सॉफ्टवेयर प्रोग्राम MAGICTool बुलाया डेविडसन कॉलेज में लॉरी हेयर और उसके स्नातक छात्रों द्वारा विकसित में प्रवेश कर रहे थे. इस सॉफ्टवेयर का उपयोग हम Cy3 और Cy5 छवियों, gridded प्रोटीन, और विश्लेषण फ्लोरोसेंट प्रोफाइल (चित्रा 3 देखें) मढ़ा. एक बार gridding हम तो खंडों पूरा किया गया था प्रत्येक व्यक्ति वर्ग बनाने यकीन है कि पूरे मुद्रित oligonucleotide जांच की जा रही थी. तो हम प्रेरित अनुपात का विश्लेषण किया और आनुवंशिक प्रोफ़ाइल दिखा कि एमएसपी परिवार के लिए जीन कोडिंग को बढ़ाया synaptogenesis साथ नेमाटोड में प्रेरित कर रहे हैं अभिव्यक्ति बनाया. (3 टेबल).

मान्यता और जीन अभिव्यक्ति की मात्रा का ठहराव वास्तविक समय पीसीआर का उपयोग.

हम आगे VSM-1 उत्परिवर्ती में आनुवंशिक प्रोफ़ाइल समझ जीनों के एक नंबर का विश्लेषण है कि एमएसपी परिवार के सदस्यों के लिए कोड वास्तविक समय पीसीआर का उपयोग. सबसे पहले, कुल शाही सेना जंगली प्रकार और वीएसएम (ok1468) एक उत्परिवर्ती उपभेदों से पृथक किया गया . आरएनए नमूने तो विपरीत थे cDNAs में लिखित और वास्तविक समय पीसीआर विश्लेषण के लिए इस्तेमाल किया. वास्तविक समय पीसीआर अभिव्यक्ति प्रोफाइल के मूल्यांकन दिखा दिया कि एमएसपी परिवार के एक सदस्य (ok1468) VSM-1 म्यूटेंट में प्रेरित किया जा रहा है. इसके अलावा, वास्तविक समय पीसीआर डेटा निष्कर्षों की पुष्टिप्रोटीन से और नीचे एक msp जीन उम्मीदवार (चित्रा 4) के लिए खोज संकुचित.

चित्रा 1
चित्रा 1 ए. 17-UNC Immunostaining पता चला कि-1 VSM म्यूटेंट पृष्ठीय तंत्रिका कॉर्ड के साथ और उच्च synaptic घनत्व प्रदर्शन. छवियाँ 63x बढ़ाई, योनी पीछे (सही) पर विश्लेषण किया गया. WT और VSM-1 (ok1468) बी विश्लेषण उत्परिवर्ती synapses VSM-1 उत्परिवर्ती (** पी 0.01 <) में सांख्यिकीय महत्वपूर्ण बढ़ाया synaptic घनत्व चिह्नित. बीस नेमाटोड प्रत्येक जीनोटाइप के लिए छवियों थे.

चित्रा 2
चित्रा 2. निकाले शाही सेना की गुणवत्ता agarose जेल वैद्युतकणसंचलन का उपयोग करके निर्धारित किया गया था. DNase मैं उपचार के पहले और बाद में दो बरकरार ribosomal सब यूनिटों की उपस्थिति शाही सेना में स्पष्ट किया गया था जंगली प्रकार और वीएसएम (ok1468) एक नमूने से निकाले .

चित्रा 3
चित्रा 3 ए. एक प्रयोग है जहाँ नियंत्रण लाल (Cy5) चिह्नित किया गया और VSM-1 एक उत्परिवर्ती के लिए माइक्रोएरे छवि हरे (Cy3) चिह्नित किया गया. बी प्रतिनिधि छवि 1 48 माइक्रोएरे प्रति विश्लेषण ग्रिड के बाहर दिखा. एक ग्रिड पर प्रत्येक छोटे वर्ग एक एकल मुद्रित oligonucleotide के प्रतिनिधि है, और प्रत्येक ग्रिड 22 पंक्तियों और 22 स्तंभों द्वारा रचित है.

तालिका 2
टेबल 2 लार्वा 4 (ए) और लार्वा 3 सी. (बी) से अलग टेप के माइक्रोएरे विश्लेषण एलिगेंस नेमाटोड से पता चला है कि प्रमुख शुक्राणु प्रोटीन के लिए कोडिंग के जीन बढ़ाया synaptogenesis साथ म्यूटेंट में प्रेरित कर रहे हैं. प्रकाश डाला जीन दोनों लार्वा 3 और 4 लार्वा में प्रेरित जीन को इंगित करता है.

चित्रा 4
चित्रा 4 वास्तविक समय पीसीआर दिखा दिया कि msp जीन परिवार, msp -32 के एक सदस्य (ok1468) VSM-1 म्यूटेंट में प्रेरित किया गया था विश्लेषण. प्रतिनिधि सामान्यीकृत गुना अभिव्यक्ति ग्राफ दिखाता है कि वीएमएस 1 (ok1468) msp-32 के लिए ΔΔCT मूल्यों में काफी अलग हैं जब जंगली प्रकार (WT) और तीन गृह व्यवस्था जीन की तुलना में सामान्य के लिए उपयोग किया जाता है (अधिनियम-1, सीडीसी- 42, और pmp -3). मानक विचलन - तीन प्रतिकृतियां के औसत + / प्लॉट किए जाते हैं.

Discussion

इस अध्ययन में हम एक आसान, उपयोगकर्ता के अनुकूल प्रोटोकॉल है कि निर्धारित जीन की अभिव्यक्ति प्रोफाइल अंतर्निहित विभिन्न जैविक घटना के लिए इस्तेमाल किया जा सकता है विकसित की है. इस प्रोटोकॉल में, पहले कुल शाही सेना और अलग था DNase मैं का उपयोग कर आरएनए अलगाव की हमारी विधि नाटकीय रूप से फिनोल extractions omitting और 5,6 साफ आत्मीयता रेजिन का उपयोग करके सरल किया गया है इलाज. संक्षेप सी. एलिगेंस cuticule और कोशिका झिल्ली तरल नाइट्रोजन और आणविक राल के साथ पीसने के साथ ठंड नेमाटोड से टूट खुले थे . अगला, निकाले आरएनए DNase मैं के साथ सीडीएनए संश्लेषण से पहले इलाज किया गया था. बाद में एक चरण unspecific hybridizations को कम करने के लिए जोड़ा गया है, शाही सेना जीनोमिक डीएनए के साथ दूषित नमूनों हस्तक्षेप परिचय और कई झूठी सकारात्मक का उत्पादन कर सकता है. फिर, जंगली प्रकार और VSM 1 (ok1468) उत्परिवर्ती cDNAs Cy3 और Cy5 कब्जा दृश्यों के साथ टैग किए गए थे और सी. पर संकरित एलिगेंस प्रोटीन GCAT कार्यक्रम के माध्यम से प्राप्त की. इस प्रणाली के इसी तरह के उत्पादों की तुलना में अधिक संवेदनशील है, और अपने दो रंग डिजाइन की जरूरत सरणियों की संख्या घट जाती है, अधिक समय और लागत दक्षता 7,8 में जिसके परिणामस्वरूप. इसके अतिरिक्त, इस प्रणाली के अन्य समान सिस्टम के विशेष उपकरणों की आवश्यकता नहीं करता, इसलिए, इस प्रक्रिया को किसी भी मानक प्रयोगशाला 7 स्थापित करने में पूरा किया जा सकता है. तीसरा, फ्लोरोसेंट संकरित सरणी छवियों खुला स्रोत सॉफ्टवेयर MAGICTool का उपयोग विश्लेषण किया गया, और जीन की अभिव्यक्ति प्रोफाइल बनाया गया. MAGICTool कि आसानी से सब अनुभव के स्तर के व्यक्तियों द्वारा उपयोग किया जाता है एक उपयोगकर्ता के अनुकूल कार्यक्रम है स्नातक से के बाद डॉक्टर की उपाधि. हालांकि, अनुकूलतम प्रदर्शन के बड़े स्मृति की उपलब्धता की आवश्यकता है. अन्त में, उम्मीदवार जीन माइक्रोएरे विश्लेषण का उपयोग कर वास्तविक समय पीसीआर के साथ मान्य थे प्राप्त किया.

हालांकि जीनोमिक दृष्टिकोण जैविक घटना के अध्ययन के लिए एक कारगर तरीका है, वहाँ कुछ सीमाएँ एक ध्यान में रखना चाहिए रहे हैं. सबसे पहले, इस माइक्रोएरे प्रोटोकॉल की विशिष्टता के बावजूद एक परिवार के भीतर टेप एक दूसरे से अप्रभेद्य हैं अगर मुद्रित oligonucleotide संरक्षित दृश्यों से लिया है. वास्तविक समय पीसीआर एक जीन परिवार के भीतर समानता के लिए क्षतिपूर्ति और यहां तक ​​कि एक ही जीन की विशिष्ट isoforms के बीच भेद कर सकते हैं. हालांकि, वास्तविक समय पीसीआर के साथ यह सच नियंत्रण है कि एक जीव उम्र भर में समान रूप से व्यक्त कर रहे हैं खोजने के लिए एक चुनौती है. इस वजह से, परिणाम रिश्तेदार हो जाएगा. एक प्रोटिओमिक हमारे तकनीक के लिए वैकल्पिक दृष्टिकोण है. व्यक्तिगत प्रोटीन 2D जेल वैद्युतकणसंचलन और मास स्पेक्ट्रोमेट्री के साथ की पहचान का उपयोग कर अलग किया जा सकता है.

हमारे अध्ययन विशेष रूप से पता चलता है कि मेजर शुक्राणु प्रोटीन (एमएसपी) परिवार के कई सदस्यों VSM 1 बढ़ाया synaptic घनत्व के साथ उत्परिवर्ती नेमाटोड में प्रेरित कर रहे हैं. MSPS सी. के लिए अद्वितीय हैं एलिगेंस और oocyte परिपक्वता और ovulation के लिए जिम्मेदार हैं . एक चाय का प्रदर्शन किया है कि presynaptic bouton और फल मक्खियों में neuromuscular जंक्शन पर संख्या और आकार के विनियमन की संभावना मेजर शुक्राणु प्रोटीन डोमेन वाले अणुओं द्वारा नियंत्रित किया जाता है . Tsuda और उनके सहयोगियों द्वारा अध्ययन दो मेजर शुक्राणु प्रोटीन डोमेन Ephrine रिसेप्टर्स के लिए ligands के रूप में सेवा, रिसेप्टर tyrosine kinase cascades संकेत ट्रिगर हो सकता है प्रदर्शन किया है. इसके अलावा, वास्तविक समय पीसीआर विश्लेषण मान्य और नीचे संकुचित msp परिवार, msp-32 के एक सदस्य के लिए माइक्रोएरे परिणाम है. साथ में ले ली है, यहाँ प्रस्तुत काम एक केंद्रीय तंत्रिका विज्ञान दुविधा के एक जीनोम चौड़ा विश्लेषण के रूप में के रूप में अच्छी तरह से वैज्ञानिक प्रयास में स्नातक अनुसंधान की शक्ति का प्रतिनिधित्व करता है.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

यह काम पश्चिमी ओकलाहोमा स्टेट यूनिवर्सिटी, Weatherford ठीक है पर स्नातक छात्रों द्वारा किया गया था. इस काम NSF RUI - 0963258, एनआईएच ठीक INBRE 2P20RR016478, GCAT और OCAST HR09-137S द्वारा समर्थित किया गया था.

vsm1 उत्परिवर्ती (ok1468) ओकलाहोमा जीन नॉकआउट कंसोर्टियम द्वारा पृथक किया गया.
लेखकों परियोजना के निष्पादन के दौरान उनके बहुमूल्य मदद के लिए दान Stefanovic और टान्नर व्हीलर धन्यवाद.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics