קביעת פרופילים ביטוי גנטיים ג elegans שימוש microarray בזמן אמת PCR

Biology
 

Summary

ניתוח microarray נערך כדי לקבוע פרופילים של ביטוי גנטי

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

סינפסות מורכבים אזור פעיל presynaptic בתא איתות מסוף postsynaptic בתא היעד. במקרה של סינפסות כימיות, המסרים מועברים על ידי העצביים המשוחררים מן מסופי presynaptic וקיבל על ידי רצפטורים על תאים postsynaptic. מחקרים קודמים שלנו Caenorhabditis elegans הראו כי VSM-1 שלילי מסדיר exocytosis. בנוסף, ניתוח של הסינפסות VSM-1 הראו כי מוטנטים בעלי חיים חסרי קישוריות מתפקדת במלואה הסינפטי VSM-1 הגדילו. בהתבסס על הממצאים הראשוניים, שיערנו כי ג elegans VSM-1 עשוי לשחק תפקיד מכריע synaptogenesis. כדי לבחון סברה זו, ניתוח פעמיים שכותרתו microarray בוצעה, וביטוי פרופילים גן נקבעו. ראשית, RNA הכולל היה מבודד, עיבד reversely ל cDNA ו הכלאה של microarrays DNA. ואז, ב-סיליקו ניתוח של הכלאה בדיקה ניאון חשף אינדוקציה משמעותית של גנים רבים קידוד עבור בני המשפחה חלבון מרכזי זרע (MSP) ב מוטנטים עם synaptogenesis משופרת. MSPS הם המרכיב העיקרי של הזרע ג elegans מופיעים כדי לאותת הביצית הבשלה נמטודות ואת הביוץ. אצל זבובי פירות, הפגינו חי ועמיתיו 1 כי MSP כמו מולקולות להסדיר מספר באוטון גודל presynaptic ו בצומת neuromuscular. יתר על כן, הניתוח מבוצע על ידי Tsuda ועמיתים לעבודה 2 הציע MSPS יכול לשמש ligands לרצפטורים יבצע אפרים את גזר ואת ההדק קולטן טירוזין קינאז מפלי איתות. לבסוף, זמן אמת ניתוח PCR אומת כי הגן המקודד MSP-32 הוא המושרה VSM-1 (ok1468) מוטנטים. יחדיו, מחקר שבוצע על ידי המעבדה שלנו הראה כי VSM-1 מוטציות יש עלייה משמעותית בצפיפות הסינפטית, אשר יכול להיות מתווכת על ידי איתות MSP-32.

Protocol

1. בידוד של רנ"א סך הכל

  1. נמטודות מסונכרן בריא נקצרו על ידי שטיפת צלחות עם המדיום M9 בטמפרטורת החדר, באמצעות 2-3 מ"ל לכל צלחת. נמטודות Resuspended הועברו 15 מ"ל צינורות חרוטי ומטה pelleted ידי צנטריפוגה, 3200 גרם ב 4 מעלות צלזיוס למשך 4 דקות. נמטודות שנקטפו נוקו מן החיידקים צף על ידי resuspending גלולה עם 7 מ"ל של 0.1M NaCl ו - 7 מ"ל סוכרוז קרח קר w / v 60%. התערובת resuspended הודגר על קרח במשך 15 דקות ו נמטודות נקי, אשר לשחות למעלה דרך הפתרון סוכרוז, נאספו לאחר centrifuging את התערובת על 3200 גרם ב 4 מעלות צלזיוס למשך 4 דקות. חיידקים ללא תולעים הועברו צינור חרוטי חדש באמצעות טפטפות סטרילי ורחץ פעמיים עם מים עד 15 RNase ללא מ"ל ואחריו צנטריפוגה 3200 גרם ב 4 מעלות צלזיוס למשך 2 דקות. גלולה נדחס רופף נקי הועבר צינור 1.5 microcentrifuge מ"ל ו centrifuged במהירות המרבית (כ -10,000 ז) למשך 30 שניות. לבסוף, רוב RNase ללא מים הוסר 10 כרכים של RNAlater נוספה גלולה, ומאוחסן על 4 מעלות צלזיוס עד מוכן להמשיך.
  2. כדי להכין הכולל דגימות רנ"א, נמטודות שנקטפו היו centrifuged במהירות המרבית (כ -10,000 ז) עבור 4 דקות RNAlater נמחקה. ואז, קמצוץ של שרף גריסה מולקולרית (G במדעי החיים) נוספה גלולה תערובת הוקפא באמצעות חנקן נוזלי. ההשעיה תולעת קפוא היה grinded לאבקה דקה עם חנקן נוזלי העלי ו נוספה ככל שיידרש כדי לשמור על האבקה קר. לאחר שחיקה, לחלץ את הוחזק על קרח למשך 5 דקות ולאחר מכן מעורבב עם 700 RLT μl / BME (יחס נפח של 100 RLT: 1 נפח של BME) (Qiagen) ו 472 μl 100% אתנול.
  3. RNA סה"כ היה מבודד באמצעות ערכת RNeasy מיני (Qiagen) ובעקבות פרוטוקול יצרן מומלץ. נפח סופי של RNA בודד היה 60 μl לדגימה ביולוגיים.

2. ה-DNA העיכול ניקוי RNA

  1. 50 מיקרוגרם של רנ"א סך מזוהמים עם הדנ"א הגנומי היה מתעכל עם DNase אני (Qiagen). התגובות תקציר המכיל 0.1 U DNase / 1 מיקרוגרם רנ"א 1X הצפת RDP הודגרו בטמפרטורת החדר למשך 10 דקות.
  2. דגימות רנ"א שטופלו DNase אני נוקו-up באמצעות ערכת RNeasy MinElute לנקות (Qiagen). הפרוטוקולים המומלץ על ידי היצרן היו אחריו 60 μl נפח eluted הסופי הושג.

3. ניתוח איכותי וכמותי של רנ"א

  1. ריכוז RNA נקבע באמצעות Nanodrop ספקטרופוטומטר UV (Thermo Scientific).
  2. תקינות של דגימות רנ"א הוערך באמצעות אלקטרופורזה agarose. בקצרה, 1% RNase ללא ג'ל agarose הוכנו באמצעות 1X הצפון מקס גלאי ג'ל Prep / הצפת ריצה (Ambion), 1% RNase ללא agarose LE (Ambion) ו 0.5 מיקרוגרם / מ"ל ​​ethidium ברומיד. בעוד ג'ל היה polymerizing, דגימות רנ"א היו glyoxylated ידי הוספת 5 μl מדגם Glyoxyl טוען דיי / מדגם דגימות דוגרים על 50 מעלות צלזיוס במשך 30 דקות. סולם RNA היה glyoxylated גם טעון לשם השוואה גודל.

4. cDNA סינתזה

  1. עבור כל תגובה סינתזה, 8.4 מדגם RNA מיקרוגרם היה מעורב עם פריימר 1 RT μl (1 pmole / μl). דגימה אחת (WT או מוטציה) קיבל את פריימר Cy5 RT ללכוד; המדגם השנייה קיבלה Cy3 ללכוד RT פריימר (המסופק עם ערכת 350 תיוג-מערך איתור, Genisphere). תערובות המדגמים היו מחומם על 75-80 מעלות צלזיוס למשך 10 דקות והועבר קרח למשך 2-3 דקות.
  2. בעוד דגימות רנ"א דגירה, MasterMix (Genisphere) הוכן כדלקמן: עבור כל תגובה RT, אנו משולב 4 תגובת μl הצפת 5X עבור RT, 1 dNTP μl (10 mM כל dATP, dCTP, dGTP, dTTP), 1 Superase μl ב-RNase אינהיביטור (המסופק עם ערכת 350 תיוג-מערך איתור, Genisphere), 1 μl RT אנזימים (200 u / μl). אחרונה, 7 μl של MasterMix נוסף מדגם זה RNA, מעורב בעדינות (לא להשתמש מערבולת) ו מודגרות 2 שעות ב 42 ° C.

5. RNA השפלה טיהור דוגמאות cDNA

  1. סינתזה cDNA הופסק על ידי הוספת 3.5 μl 0.5m NaOH/50mM EDTA (ריכוז סופי) ו מודגרות על 65 מעלות צלזיוס במשך 15 דקות. לאחר מכן, תגובות נוטרלו באמצעות טריס-1M HCl, pH 8.0 להגיע הריכוז הסופי של mM 850 טריס-HCl. לבסוף, WT ו cDNAs מוטציה שולבו הגליל האחד microcentrifuge. שפופרת ריק היה לשטוף עם 73 חיץ μl TE 1X והוסיף שפופרת המכילה cDNA; נפח הסופי של הצינור cDNAs בשילוב היה 130 μl.
  2. CDNA היה מעורב מטוהרים פרוטוקול היצרן הבאים ערכת ה-PCR QIAquick טיהור (Qiagen). נפח eluted כתוצאה של מטוהרים cDNA היה 60 μl.

6. הכלאה ראשונה microarray

  1. סי אלגנס microarray שקופיות שהושג באמצעות GCAT (קונסורציום הגנום להוראת פעילים) נחסמו עלטמפרטורת החדר למשך שעה 1 באמצעות 0.1 מ"ג / מ"ל ​​סלמון sonicated זרע דנ"א 3X SSC, 0.1% SDS. השקופיות היו חסומים על ידי שטף טבילה ddH2O ו ספין יבשים ידי centrifuging דקה 1 ב 2000 גרם ב 50 צינורות חרוטי מ"ל עם KimWipe בתחתית.
  2. ואז, חיץ 2X לפוראמיד מבוססי הכלאה (Genisphere) הודגר על 55 מעלות צלזיוס למשך 10 דקות, מעורב גם לפזר קריסטלים centrifuged דקה 1 ב 10,000 g. בשלב הבא, 25 מדגם cDNA μl היה מעורב על ידי מצליף בעדינות עם 25 μl של למאגר לפוראמיד מבוססי 2X הכלאה. מדגם cDNA מדולל נאסף על ידי ספין פלאש למשך 15 שניות וטופחו על 80 מעלות צלזיוס למשך 10 דקות.
  3. לאחרונה, היה הכלאה cDNA microarray כדי להחליק על ידי בקפידה pipetting המדגם כולו cDNA מחומם בלי לגעת שקופיות. המדגם היה להתפשט באופן אחיד על ידי בעדינות הפחתת פליטת לכסות באמצעות מחט המזרק על microarray. לפני להחליק לכסות הונמך לחלוטין, להחליק את מכסה היה אסוף למעלה, ואז הוריד עם המחט שוב, מותר ליפול בעדינות למקומה, מזעור היווצרות של בועות אוויר. ההכלאה הראשונה היתה להקים הגיעה לשיאה על ידי הצבת את השקופית אופקית צינור חרוטי 50 מ"ל עם 50 μl של DDH 2 O מתחת לשקופית ו מודגרות לילה בשעה 37 ° C.

7. שנית הכלאה

  1. Microarrays הכלאה נשטפו עם 2X SSC בטמפרטורות שונות. ראשית, שקופיות microarray הועברו צינורות חרוטי המכיל בטמפרטורת החדר 2X SSC ו SDS 0.2% ו שתוי בעדינות כדי להסיר את מכסה מחליק. ואז, מגלשות microarray הועברו צינורות חרוטי המכיל 55 ° C 2X SSC ו SDS 0.2% ו מודגרות על 55 מעלות צלזיוס במשך 15 דקות. בשלב הבא, שקופיות הועברו 2X SSC ו מודגרות בטמפרטורת החדר למשך 15 דקות, רועד קלות מעת לעת. לאחרונה, מגלשות הועברו 0.2X SSC וטופחו במשך 15 דקות בטמפרטורת החדר, רועד קלות מעת לעת. מגלשות שטף היו ספין מיובש על ידי החדרת התווית בצד למטה שקופיות 50 צינורות חרוטי מ"ל עם KimWipe בתחתית ו centrifuged דקה 1 ב 2000 g.
  2. תערובת הבא, הכלאה השני היה מוכן באמצעות חיץ 2X לפוראמיד מבוססי הכלאה (Genisphere). חיץ הכלאה הודגר ב 55 מעלות צלזיוס למשך 10 דקות ו centrifuged דקה 1 ב 10,000 g. לכידת ריאגנטים ניאון (Cy3 ו Cy5) ו מגיב נגד לדעוך היו מופשרים בטמפרטורת החדר מכוסה בנייר כסף כדי להגן על ריאגנטים מ photobleaching. צעדים בעקבות הכלאה בוצעו בחושך חשיפה לאור ממוזער. 150 μl של חיץ לפוראמיד מבוססי 2X הכלאה היה בשילוב עם מגיב 1.5 אנטי לדעוך μl כדי להפוך את התערובת אנטי לדעוך שטופלו הכלאה.
  3. לכידת ריאגנטים Cy3 ו Cy5 היו vortexed למשך 3 שניות ו centrifuged למשך 15 שניות, 10,000 g. תערובת הכלאה השנייה הוכן תמהיל המשלב 75 μl אנטי לדעוך שטופלו הכלאה, 60 μl מים nuclease חינם, 7.5 מגיב μl Cy3 ללכוד, ו -7.5 מגיב μl Cy5 ללכוד. לערבב הכלאה השנייה הודגר במשך 10 דקות ב 75 ° C ו 50 μl של תערובת מחוממת היה pipetted בזהירות רבה לשקופית שטף / יבשים microarray. כדי להתפשט באופן אחיד את המדגם על microarray, להחליק כיסוי הונמך בעדינות באמצעות מחט המזרק. לפני להחליק לכסות הונמך לחלוטין, להחליק את מכסה היה אסוף למעלה, ואז הוריד עם המחט שוב, מותר ליפול בעדינות למקומה, מזעור היווצרות של בועות אוויר. והכלאה שקופיות microarray הונח אופקית צינור חרוטי 50 מ"ל מכוסה בנייר כסף ו 50 μl של DDH 2 O נוספה מתחת לשקופית כדי ליצור תא לח. הכלאה השנייה הודגר על 37 מעלות צלזיוס במשך 2-5 שעות.
  4. Microarray והכלאה השנייה נשטף בחושך באמצעות בטמפרטורת החדר 2X SSC, 0.2% SDS, 1 mM DTT ו שתוי בעדינות כדי להסיר את כיסוי להחליק. ואז, microarray הועבר צינור חרוטי מכוסה המכיל 55 ° C 2X SSC, 0.2% SDS, DTT 1 מ"מ מודגרות במשך 15 דקות על 55 ° C. השקופית הבאה, הועבר צינור חרוטי מכוסה המכיל 2X SSC, DTT 1 מ"מ מודגרות למשך 15 דקות בטמפרטורת החדר, רועד קלות מעת לעת. שקופית אחרונה, הועבר 0.2X SSC, DTT 1 מ"מ מודגרות בטמפרטורת החדר למשך 15 דקות, רועד קלות מעת לעת. שקופית microarray היה מיובש על ידי centrifuging עבור 1 דקה, 2000 גרם, שקופיות התווית בצד למטה בצינור מכוסה חרוטי 50 מ"ל עם KimWipe בתחתית. מגלשות microarray יבש נסרקו באמצעות GenePix 4100A אישי מודל סורק בבית דוידסון קולג'.

8. ניתוח microarray

  1. תמונות שהושגו לאחר סריקה נותחו באמצעות תוכנה שפותחה MAGICTool דוידסון קולג' על ידי לורי Heyer וסטודנטים לתואר ראשון שלה. בקצרה, תחת הלשונית "פרויקט", "פרוייקט חדש" נוצר ונשמר. תחת "בניית פרופיל הביטוי" הכרטיסייה, "תמונה זוג טען" נבחר את קובץ התמונה אדום (_635.tif) הועלתה כמו "אדום" ואת קובץ התמונה ירוק (_532.tif) הועלתה כמו "ירוק". לאחר מכן, באמצעות "בניית פרופיל הביטוי" כרטיסייה "ג'ין טען רשימה", ג רשימת elegans גן הקובץ המתקבל באתר GCAT היה נטען.
  2. תמונה microarray טופלה ו gridded באמצעות "בניית פרופיל הביטוי" כרטיסייה "יצירת / עריכת טבלה" אפשרות. "הגדרת רשת" תיבת הדו שיח נערך באמצעות "48" למספר רשתות, "22 שורות" ו "22 העמודים" עבור כל רשת, כתמים ספורים "מימין לשמאל" וגם "מלמעלה למטה". "ניגודיות אחוזי שינוי" היתה מוגברת התמקדה הרשת עד מקומות מסוימים ניתן להבחין בקלות. רשתות נוצרו על ידי הראשון ובחירת "הגדר ספוט שמאל למעלה" בלוח השמאלי. ואז, במרכזו של כתם השמאלית העליונה, במקום הנכון העליון בשורה התחתונה היו לוחצים על "רשת" 1. הליך זה חזר על עצמו gridding עבור כל אחד 48 רשתות, הליך מימין לשמאל ומלמעלה למטה. כאשר gridding הושלמה, הרשת הנוכחי נשמר תחת "קובץ" "שמור גריד הנוכחי". כאשר רשת ניצל בהצלחה את הכרטיסיה "סיום" נבחר.
  3. כדי לחסל את כל הנקודות שאינן קשורות מניתוח, "בניית פרופיל הביטוי" הכרטיסייה נפתח. תחת "בהתייחסו Gridding" אפשרות "ספוט שהסימון" נבחר. כתמים מרוחים או פלואורסצנטי ברקע היו מסומנים ונשמר על ידי בחירת "שמור דגלים הנוכחי" תחת "Tab קובץ".
  4. קבצים דגל היו מפולח באמצעות "בניית פרופיל הביטוי" הכרטיסייה ובחירת "רדיוס קבוע" כשיטת פילוח של בחירה. רדיוס הוקמה לגודל הרצוי, "עדכון נתונים" היה נקש. כדי לוודא המעגל נשאר בתחום gridded (ריבוע צהוב) אנו scrolled מלמעלה למטה ומשמאל לימין ובדק פעם "יצירת פרופיל הביטוי" נבחר.
  5. במהלך פילוח, התוכנה מחושב האדום: יחסי פלואורסצנטי ירוק עבור כל הנקודות שנותרו לאחר סימון. באמצעות "ביטוי" הכרטיסייה, "לנתונים" "המרה" נבחר. "המרה נתונים" תיבת הדו שיח הופיע שם "logb (x)" אפשרות, ו b = 2 היה נכנס. "קובץ הביטוי עבודה" היה חקר מתוך הכרטיסייה "הביטוי". לצורך ניסוי שבו סוג בר קיבל את רצף (ירוק) Cy3 ללכוד מוטציה קיבל את Cy5 (אדום) רצף ללכוד, את הערך של יחס יומן שינה היו חיוביות עבור הגנים היו המושרה ושלילי עבור גנים מודחקים.
  6. לאחרונה, גנים המושרה או מודחקים בפקטור מסוים נותחו בחירת "חקור" תחת הלשונית "הביטוי". בתיבת "היכרות" שיח ", מצא את הגנים המתאימים לקריטריונים" היה מוגדר גנים עם "ערך. מקס> X (מספר חיובי עבור גנים המושרה)" או "Min. ערך <X (מספר שלילי עבור גנים מודחק)" ב ניסויים כמו זה המתואר # 5. מקפלים ביטוי שווה 2x, שבו "x" הוא הערך של מספר להזין את קריטריוני הבחירה.

9. סינתזה cDNA ו Real-Time PCR

  1. RNA סה"כ היה מבודד כפי שתואר לעיל. לאחר האיכות והכמות של RNA בודד נקבע, cDNA היה מסונתז באמצעות ערכת iScript סינתזה cDNA (BioRad), 500 RNA סך ng / μl מבודד סוג בר מוטציה, ופרוטוקולים יצרן מומלץ.
  2. בזמן אמת PCR תגובות היו הגדרת באמצעות SYBR IQ גרין Supermix (BioRad), 100-500 nmoles primers גן מסוים (טבלה 1) ו 4 cDNAs μl המיוצר על ידי בשלב הקודם. 10 תגובות μl נוהלו באמצעות CFX96 thermocycler Real-Time System (BioRad).
  3. Thermocycler היה מחומם הראשון 95 מעלות צלזיוס במשך 3 דקות. זאת בעקבות צעד ב 95 מעלות צלזיוס למשך 5 שניות ו 58 מעלות צלזיוס למשך 30 שניות. לולאה זו הושלמה בסך הכל ארבעים פעם, ועוד 65-95 ° C עקומת להמיס עם שיפוע של 0.5 מעלות, הוכנס גם. ערכים ΔΔCT חושבו באמצעות שלושה גנים משק בית (מעשה-1, ה-CDC-42, ו-PMP-3) כפקדי.
צנה קדימה פריימר פריימר הפוכה
GST-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
GST-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
LPR-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
mes-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
msp-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
msp-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
msp-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
msp-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
msp-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
msp-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

טבלה 1. פורוורד הפוך רצפים פריימר עבור Real-Time PCR

10. נציג תוצאות:

RNA בידוד ניתוח

Fusion של פעיל מבשר שלפוחית ​​אזור באתרים presynaptic היא צעד הכרחי במהלך synaptogenesis (3). VSM-1, זיהו באחרונה חלבון v-Snare הורים, הוצע לעכב איחוי שלפוחית ​​ב שמרים synaptogenesis של נמטודות (ראה איור 1) על ידי מנגנון מוגדר (4, והעבודה שלנו לא פורסם). כדי להבין טוב יותר את מסלול המולקולריים שבבסיס VSM-1 הרגולציה נמטודות ולהביא קצת אור לתוך השדה synaptogenesis, התחלנו מסך הגנום כולו וקבע כי החלבון העיקרי זרע גנים (msp) הם המושרה בהעדר מתפקדת במלואה VSM-1 .

כדי לחקור את הגנים המושרה זן VSM-1 (ok1468) מוטציה של ג elegans, ערכנו ניתוח גנטי microarray. הדבר נעשה על ידי בדיקה תמלילי מבודד סוג בר VSM-1 זן מוטנטי וקביעת העשרה שלהם. באופן ספציפי, אנחנו בודד לראשונה RNA הכולל סינכרוני L4 ו L3 סוג בר VSM-1 נמטודות הזחלים מוטציה. לאחר מכן, אנו התייחסו RNA הכולל שהושג עם DNase אני ובחן את איכות RNA חילוץ באמצעות ג'ל אלקטרופורזה agarose. בניסוי שמוצג באיור 2, סולם ששימש בנתיב הראשון מייצגים את מספר זוגות בסיסים עבור התקנים. דוגמאות לסוג Wild טרום טיפול שלאחר שטופלו DNase אני הועמסו במסלולים 2 ו - 4, VSM-1 דגימות מוטציה טרום טיפול שלאחר שטופלו DNase אני הועמסו במסלולים 3 ו -5 בהתאמה. ניתוח של ג'ל אלקטרופורזה RNA הראה כי סוג בר VSM-1 מוטציה דגימות רנ"א היו שלמים באיכות טובה. זה נקבע על ידי התבוננות שתי להקות אשר ייצגו שתי יחידות משנה של רנ"א ריבוזומלי.

Microarray הכלאה

לאחר באיכות של רנ"א נקבע, המשכנו עם סינתזה cDNA. לשם כך, אנו להפוך את ה-mRNA עיבד והוסיף רצף ללכוד את הזנב. CDNAs המיוצר המכיל רצפים ללכוד עבור Cy3 ו Cy5 היו הכלאה כדי microarray שקופיות ונשלחו לסריקה. תמונות microarray נכנסו מכן לתוך תוכנה במחשב מקור פתוח שנקרא MAGICTool שפותחה על ידי מכללת דוידסון לורי Heyer וסטודנטים לתואר ראשון שלה. באמצעות תוכנה זו אנו מעולף Cy3 ו Cy5 תמונות, microarrays gridded, ופרופילים פלורסנט ניתחו (ראה איור 3). לאחר gridding הושלם אנו מפולח אז כל ריבוע הפרט ולוודא oligonucleotide מודפס כולו נבדקות. ואז ניתחנו את יחסי המושרה ויצרו הבעות הפרופיל הגנטי מראה כי גנים קידוד עבור המשפחה MSP הם המושרה נמטודות עם synaptogenesis משופרת. (לוח 3).

אימות וכימות של ביטוי גנים באמצעות PCR בזמן אמת.

כדי להמשיך ולהבין את הפרופיל הגנטי של מוטציה 1-VSM ניתחנו מספר גנים קוד עבור בני המשפחה MSP באמצעות PCR בזמן אמת. ראשית, בסך הכל היה RNA שבודד סוג בר VSM-1 (ok1468) זנים מוטנטים. דגימות רנ"א היו אז עיבד reversely לתוך cDNAs ומשמש לניתוח בזמן אמת PCR. הערכות בזמן אמת פרופילים PCR ביטוי הראו כי אחד מבני המשפחה MSP נראה המושרה VSM-1 (ok1468) מוטנטים. יתר על כן, בזמן אמת PCR נתונים מאמת ממצאיםמ microarrays ו הצטמצם החיפוש למועמד msp גן אחד (איור 4).

איור 1
איור 1 א. UNC-17 Immunostaining גילה כי VSM-1 מוטנטים התערוכה צפיפות הסינפטי גבוה לאורך חוט העצב הגבי. תמונות נותחו בהגדלה 63x, אחורית (מימין) על הפות. ניתוח ב 'של WT ו VSM-1 (ok1468) סינפסות מוטציה מצוין משמעותי מבחינה סטטיסטית בצפיפות הסינפטית משופרת ב VSM-1 מוטציה (** p <0.01). עשרים נמטודות היו תמונות עבור כל גנוטיפ.

איור 2
איור 2. איכות RNA שחולצו נקבע באמצעות ג'ל אלקטרופורזה agarose. הנוכחות של שתי יחידות משנה ריבוזומלי שלם לפני ואחרי הטיפול אני DNase באה לידי ביטוי RNA המופק סוג Wild דגימות VSM-1 (ok1468).

איור 3
איור 3 א. תמונה microarray עבור ניסוי שבו השליטה סומן אדום (Cy5) ואת VSM-1 מוטציה סומן ירוק (Cy3). ב תמונה נציג מציג 1 מתוך 48 רשתות ניתח לכל microarray. כל ריבוע קטן על רשת הוא נציג של oligonucleotide מודפס יחיד, כל רשת מורכבת של 22 שורות ו 22 עמודות.

טבלה 2
2. טבלה microarray ניתוח תמלילי מבודד הזחלים 4 (א) וזחלים 3 (ב) ג נמטודות elegans הראו כי גנים קידוד החלבונים זרע העיקריים הם המושרה מוטנטים עם synaptogenesis משופרת. גנים מודגש מציין גנים המושרה 3 ו 4 הן הזחלים הזחלים.

איור 4
איור 4. Real-Time PCR הניתוח הראו כי אחד מבני המשפחה את הגן msp, msp -32 הושרה VSM-1 (ok1468) מוטנטים. גרף נציג מנורמל ביטוי לקפל מראה כי VMS-1 (ok1468) ערכים ΔΔCT עבור msp-32 הם שונים באופן משמעותי בהשוואה סוג בר (WT) ושלושה גנים משק משמשים נורמליזציה (מעשה-1, ה-CDC-42, ו-PMP -3). ממוצע של שלושה העתקים הם זממו + / - סטיית התקן.

Discussion

במחקר זה פיתחנו פרוטוקול קל, ידידותי למשתמש, שניתן להשתמש בהם כדי נקבע ביטוי הגן פרופילים הבסיסית תופעות ביולוגיות שונות. בפרוטוקול זה, הכולל RNA בודד לראשונה וטופלו באמצעות DNase I. השיטה שלנו של בידוד RNA הופשטה באופן דרמטי על ידי השמטת עקירות פנול באמצעות שרפים זיקה לנקות 5,6. בקצרה, C. elegans cuticule הקרומים של התא היו סדוקים פתוח נמטודות על ידי הקפאה עם חנקן נוזלי וטחינה עם שרף מולקולרית. בשלב הבא, RNA חילוץ טופלה DNase אני לפני סינתזה cDNA. בשלב מאוחר יותר נוספה כדי למזער הכלאות נוקבים; דגימות רנ"א מזוהמים הדנ"א הגנומי יכול להציג התערבות לייצר הרבה false-positives. לאחר מכן, הקלד בר VSM-1 (ok1468) cDNAs מוטציה תויגו עם Cy3 ו Cy5 רצפים ללכוד הכלאה על C. microarrays elegans להשיג באמצעות תוכנית GCAT. מערכת זו היא יותר רגישה מוצרים דומים, ועיצוב שני הצבעים שלה מקטין את מספר מערכים הצורך, וכתוצאה מכך זמן רב יותר ויעילות כלכלית 7,8. בנוסף, מערכת זו אינה דורשת ציוד מיוחד של מערכות דומות אחרות, ולכן הליך זה יכול להתבצע בכל סביבה מעבדה סטנדרטיים 7. שלישית, תמונות פלורסנט מערך הכלאה נותחו באמצעות MAGICTool תוכנות קוד פתוח, וביטוי גנים פרופילים שנוצרו. MAGICTool היא תוכנית ידידותי למשתמש כי הוא מנוצל בקלות על ידי אנשים מכל הרמות ניסיון, מן ראשון עד שלישי שלאחר. עם זאת, ביצועים מיטביים דורש זמינות זיכרון גדול. לבסוף, גנים מועמדים שהתקבלו באמצעות ניתוח microarray אומתו עם הזמן PCR אמיתי.

למרות גישה גנומית היא שיטה יעילה ללימוד תופעות ביולוגיות, ישנן כמה מגבלות שצריך לקחת בחשבון. ראשית, למרות הספציפיות של פרוטוקול זה microarray, תעתיקים בתוך המשפחה הם נבדלים אחד מהשני אם oligonucleotide מודפס נלקח רצפים שימור. זמן PCR נדל מפצה על הדמיון בתוך המשפחה גן ואף עשויה להבחין בין isoforms ספציפי של אותו גן. עם זאת, עם הזמן PCR אמיתי זה אתגר למצוא שולטת נכון באים לידי ביטוי באופן שווה לאורך כל חיי האורגניזם. בגלל זה, התוצאות יהיו יחסית. גישה proteomic הוא אחד חלופה הטכניקה שלנו. חלבונים בודדים עשויים להיות מבודדים באמצעות ג'ל אלקטרופורזה 2D and המזוהה עם ספקטרומטריית מסה.

המחקרים שלנו מראים כי באופן ספציפי רבים מבני המשפחה סרן חלבון (MSP) הזרע הם המושרה VSM-1 נמטודות מוטציה עם צפיפות הסינפטי משופרת. MSPS ייחודיים ג elegans ואחראים על התבגרות הביצית ואת הביוץ. חי 1 הוכיחה כי תקנה מספר באוטון גודל presynaptic ו בצומת neuromuscular אצל זבובי פירות נשלטת סביר על ידי מולקולות המכילות חלבון תחומים עיקריים זרע. מחקרים של Tsuda ועמיתיו הוכיחו 2 תחומים עיקריים חלבון הזרע יכול לשמש ligands לרצפטורים Ephrine, מפעילה טירוזין קינאז רצפטור מפלי איתות. יתר על כן, אמיתי ניתוח PCR זמן תוקף הצטמצם תוצאות microarray לאחד מבני המשפחה msp, msp-32. יחדיו, את העבודה המוצגת כאן מהווה ניתוח גנום רחב של דילמה מרכזית במדעי המוח, כמו גם את כוחו של מחקר ראשון העשייה המדעית.

Disclosures

אין ניגודי אינטרסים הכריז.

Acknowledgments

עבודה זו בוצעה על ידי סטודנטים לתואר ראשון ב Southwestern אוקלהומה סטייט, אישור Weatherford. עבודה זו נתמכה על ידי רוי NSF-0963258, NIH-OK INBRE 2P20RR016478, GCAT ו OCAST HR09-137S.

(Ok1468) vsm1 מוטציה היתה מבודדת על ידי קונסורציום נוק ג'ין אוקלהומה.
המחברים מודים דן Stefanovic וטאנר וילר לעזרה יקר שלהם במהלך ביצוע הפרויקט.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics