Bestimmung genetischer Expressionsprofile in C. elegans Verwenden Microarray-und Real-time PCR

Biology
 

Summary

Microarray-Analyse wurde durchgeführt, um genetische Expression Profile in bestimmen

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Synapsen sind eines präsynaptischen aktiven Zone in die Signalisierung Zelle und einer postsynaptischen Terminals in die Zielzelle zusammen. Im Falle von chemischen Synapsen, werden die Nachrichten von Neurotransmittern aus präsynaptischen freigegeben und erhielt von Rezeptoren auf postsynaptische Zellen durchgeführt. Unsere bisherige Forschung in Caenorhabditis elegans hat gezeigt, dass VSM-1 negativ reguliert Exozytose. Darüber hinaus zeigte die Analyse der Synapsen in vsm-1-Mutanten, dass die Tiere fehlt eine voll funktionsfähige VSM-1 erhöht haben synaptischen Verbindungen. Basierend auf diesen vorläufigen Ergebnissen stellten wir die Hypothese, dass C. elegans VSM-1 kann eine entscheidende Rolle spielen in Synaptogenese. Um diese Hypothese zu testen, wurde doppelt markierten Mikroarray-Analyse durchgeführt, und Genexpressionsprofile wurden ermittelt. Erstens, Gesamt-RNA wurde isoliert, revers in cDNA transkribiert und auf einem DNA-Mikroarrays. Dann zeigte in-silico-Analyse von fluoreszierenden Sonden-Hybridisierung signifikante Induktion von vielen Genen, die für Mitglieder der großen Spermien-Protein-Familie (MSP) in Mutanten mit verbesserter Synaptogenese. MSPs sind der Hauptbestandteil von Spermien in C. elegans und scheinen Nematoden Eizellreifung und Ovulation Signal. In Fruchtfliegen nachgewiesen Chai und Kollegen 1, MSP-ähnliche Moleküle präsynaptischen Bouton Anzahl und Größe zu regulieren an der neuromuskulären Synapse. Darüber hinaus schlug Analyse von Tsuda und Mitarbeitern durchgeführt 2, dass MSPs können als Liganden für Eph-Rezeptoren und lösen Rezeptor-Tyrosin-Kinase-Signalkaskaden zu handeln. Schließlich bestätigt real time PCR-Analyse, dass das Gen für MSP-32 in vsm-1 (ok1468) Mutanten induziert wird. Zusammengenommen hat sich die Forschung in unserem Labor durchgeführt gezeigt, dass VSM-1-Mutanten eine signifikante Zunahme der synaptischen Dichte, die von MSP-32-Signalisierung vermittelt werden könnte.

Protocol

1. Isolierung von Gesamt-RNA

  1. Gesunde synchronisiert Nematoden wurden durch Waschen Platten mit Raumtemperatur-M9-Medium, mit 2-3 ml pro Platte geerntet. Resuspendiert Nematoden wurden zu 15 ml konische Röhrchen und pelletiert durch Zentrifugation, 3200 g bei 4 ° C für 4 Minuten übertragen. Geerntet Nematoden wurden aus schwamm Bakterien durch Resuspendieren des Pellets mit 7 ml 0,1 M NaCl und 7 ml eiskaltem 60% w / v Saccharose gereinigt. Die resuspendierten Mischung wurde auf Eis für 15 Minuten und sauber Nematoden inkubiert, die Swim-up durch die Saccharose-Lösung, wurden nach dem Zentrifugieren der Mischung bei 3200 g bei 4 ° C für 4 Minuten gesammelt. Bakterien-Würmer wurden zu einem neuen konischen Rohr mit sterilen Pipetten übertragen und zweimal mit bis zu 15 ml RNase-freiem Wasser von einem 3200 g Zentrifugation bei 4 ° C für 2 Minuten. Die saubere locker verdichtet Pellet wurde in 1,5 ml Mikrozentrifugenröhrchen überführt und zentrifugiert bei maximaler Geschwindigkeit (ca. 10.000 g) für 30 Sekunden. Schließlich wurde am RNase-freies Wasser entfernt und 10 Volumen RNAlater wurde das Pellet hinzugefügt, und bei 4 ° C bis bereit, um fortzufahren.
  2. Zur Vorbereitung der Gesamt-RNA-Proben wurden geerntet Nematoden bei maximaler Geschwindigkeit (ca. 10.000 g) für 4 Minuten zentrifugiert und RNAlater wurde verworfen. Dann wurde eine Prise Molecular Reibharzes (G bioscience) zum Pellet hinzugefügt und die Mischung wurde mit flüssigem Stickstoff eingefroren. Gefrorene Wurm Suspension wurde in ein feines Pulver mit Stößel und flüssigem Stickstoff gemahlen wurde als notwendig hinzugefügt, um das Pulver kalt. Nach dem Schleifen wurde der Extrakt auf Eis für 5 Minuten gehalten und dann mit 700 ul RLT / BME (Verhältnis 100 Volumen von RLT: 1 Volumen von BME) (Qiagen) und 472 ul 100% Ethanol.
  3. Gesamt-RNA wurde mit dem RNeasy Mini Kit (Qiagen) und folgenden vom Hersteller empfohlenen Protokoll. Das endgültige Volumen der isolierten RNA wurde 60 ul pro biologischen Probe.

2. DNA Verdauung und RNA Cleanup

  1. 50 ug Gesamt-RNA möglicherweise mit genomischer DNA kontaminiert wurde mit DNase I (Qiagen) verdaut. Digest Reaktionen mit 0,1 U DNase / 1 pg RNA und 1X Puffer RDP wurden bei Raumtemperatur für 10 Minuten inkubiert.
  2. RNA-Proben mit DNase I behandelt wurden gereinigt-up mit dem RNeasy MinElute Clean-Up Kit (Qiagen). Protokolle vom Hersteller empfohlen wurden verfolgt und 60 ul letzte eluierte Volumen erhalten wurde.

3. Qualitative und quantitative Analyse der RNA

  1. RNA-Konzentration wurde unter Verwendung des UV-Spektralphotometer Nanodrop (Thermo Scientific).
  2. Integrität der RNA-Proben wurden mittels eines Agarose-Elektrophorese. Kurz gesagt wurden 1% RNase-free Agarosegelen unter Verwendung 1X Northern Max Gly Gel Prep / Running Buffer (Ambion), 1% RNase-freies Agarose LE (Ambion) und 0,5 ug / ml Ethidiumbromid. Während das Gel polymerisiert wurden RNA-Proben durch Zugabe von 5 ul der Glyoxyl Beispiel Loading Dye / Probe und Inkubation Proben bei 50 ° C für 30 Minuten glyoxylierten. RNA Leiter war auch glyoxylierten geladen und zum Größenvergleich.

4. cDNA-Synthese

  1. Für jede Synthesereaktion, lag bei 8,4 pg RNA-Probe mit 1 ul RT Primer (1 pmol / ul) gemischt. Eine Probe (WT oder Mutanten) erhielt die Cy5 erfassen RT Primer, die andere Probe erhielt die Cy3 erfassen RT Primer (mit dem Array 350 Labeling-Detection Kit, Genisphere). Beispiel Mischungen wurden bei 75-80 ° C für 10 Minuten und auf Eis für 2-3 Minuten.
  2. Während die RNA-Proben inkubieren, die MasterMix (Genisphere) wurde wie folgt hergestellt: für jede RT-Reaktion, kombinierten wir 4 ul 5X Reaktionspuffer für RT, 1 ul dNTP (10 mM dATP, dCTP, dGTP, dTTP), 1 ul Superase -In RNase Inhibitor (mit dem Array 350 Labeling-Detection Kit, Genisphere), 1 ul RT-Enzym (200 U / ul). Zuletzt wurden 7 ul MasterMix jeder RNA-Probe zugegeben, vorsichtig gemischt (keine Wirbel) und inkubiert 2 Stunden bei 42 ° C.

5. RNA-Abbau und Reinigung von cDNA-Proben

  1. cDNA-Synthese wurde durch Zugabe von 3,5 ul 0,5 M NaOH/50mM EDTA (Endkonzentration) gestoppt und über Nacht bei 65 ° C für 15 Minuten. Dann wurden die Reaktionen neutralisiert mit 1 M Tris-HCl, pH 8,0 zu einer Endkonzentration von 850 mM Tris-HCl zu erreichen. Schließlich wurden WT und Mutante cDNAs in einem Mikrozentrifugenröhrchen kombiniert. Das leere Rohr wurde mit 73 ul 1X TE-Puffer gespült und in die cDNA mit Rohr, das endgültige Volumen der kombinierten cDNAs Rohr wurde 130 ul.
  2. Mixed cDNA wurde nach Protokoll des Herstellers und des QIAquick PCR Purification Kit (Qiagen) gereinigt. Die resultierenden eluierten Volumen des gereinigten cDNA wurde 60 ul.

6. Erste Microarray-Hybridisierung

  1. C. elegans Microarray Slides erhalten durch GCAT (Genome Consortium for Active Teaching) wurden blockiertRaumtemperatur für 1 Stunde mit 0,1 mg / ml beschallt Lachssperma-DNA in 3X SSC, 0,1% SDS. Blockierte Objektträger wurden durch Eintauchen in ddH2O und durch Zentrifugation für 1 Minute bei 2.000 g in 50 ml konische Röhrchen mit Kimwipe in unteren Spin-getrocknet.
  2. Dann wurde 2X Formamid-basierte Hybridisierungspuffer (Genisphere) bei 55 ° C für 10 Minuten, auch auf Kristalle auflösen gemischt und zentrifugiert für 1 Minute bei 10.000 g. inkubiert Anschließend wurde 25 ul cDNA Probe vorsichtig durch flicking mit 25 ul des 2X Formamid-basierte Hybridisierungspuffer gemischt. Das verwässerte cDNA-Probe wurde durch Flash-Spin für 15 Sekunden gesammelt und über Nacht bei 80 ° C für 10 Minuten.
  3. Zuletzt wurde cDNA hybridisiert zu rutschen durch vorsichtiges Pipettieren die gesamte beheizte cDNA-Probe, ohne das Bild Microarray. Die Probe wurde gleichmäßig auf dem Mikroarray durch leichtes Absenken eines Deckglases mit einer Spritze Nadel zu verbreiten. Vor dem Deckglas vollständig gesenkt wurde, wurde das Deckglas wieder auf, zog dann mit der Nadel wieder abgesenkt, und man ließ sie sanft fallen in Platz und minimiert die Bildung von Luftblasen. Erste Hybridisierung eingerichtet wurde, indem die Folie horizontal in einem 50 ml konischen Rohr mit 50 ul ddH 2 O unterhalb der Rutsche gipfelte und über Nacht bei 37 ° C.

7. Zweite Hybridisierung

  1. Hybridisierten Microarrays wurden mit 2X SSC bei verschiedenen Temperaturen gewaschen werden. Zunächst wurden Microarray-Slides zu konischen Röhrchen mit Raumtemperatur 2X SSC und 0,2% SDS übertragen und schwappte sanft auf Deckgläser entfernen. Dann wurden Microarray-Slides zu konischen Röhrchen mit 55 ° C 2X SSC und 0,2% SDS überführt und bei 55 ° C für 15 Minuten. Anschließend wurden die Objektträger übertragen SSC 2X und bei Raumtemperatur für 15 Minuten inkubiert, unter leichtem Schütteln in regelmäßigen Abständen. Zuletzt wurden die Objektträger bis 0.2X SSC überführt und für 15 Minuten bei Raumtemperatur unter leichtem Schütteln in regelmäßigen Abständen. Washed Objektträger wurden durch die Einführung der beschrifteten Seite nach unten gleitet in 50 ml konische Röhrchen mit einem Kimwipe in der unteren Spin-getrocknet und zentrifugiert für 1 Minute bei 2.000 g.
  2. Als nächstes zweite Hybridisierung Mischung wurde hergestellt unter Verwendung von 2X Formamid-basierte Hybridisierungspuffer (Genisphere). Hybridisierungspuffer bei 55 ° C für 10 Minuten inkubiert und zentrifugiert für 1 Minute bei 10.000 g. Erfassen fluoreszierender Reagenzien (Cy3 und Cy5) und die Anti-Fade-Reagenz wurden bei Raumtemperatur aufgetaut und mit Folie abgedeckt, um Reagenzien aus Ausbleichen zu schützen. Nach der Hybridisierung Schritte wurden im Dunkeln zu minimieren Belichtung durchgeführt. 150 ul 2X Formamid-basierte Hybridisierungspuffer wurde mit 1,5 ul Anti-Fade-Reagenz auf die anti-fade-behandelten Hybridisierungsgemisch machen kombiniert.
  3. Capture-Reagenzien Cy3 und Cy5 für 3 Sekunden gevortext und zentrifugiert wurden für 15 Sekunden, 10.000 g. Zweite Hybridisierung Mischung wurde hergestellt Kombination 75 ul Anti-Fade-behandelten Hybridisierung mischen, 60 ul Nuklease-freies Wasser, 7,5 ul Cy3 Fangreagenz und 7,5 ul Cy5 Fangreagenz. Zweite Hybridisierung Mischung wurde für 10 Minuten bei 75 ° C inkubiert und 50 ul erhitzten Mischung sehr sorgfältig auf die gewaschen / getrocknet Microarray schieben pipettiert. Um gleichmäßig verteilt die Probe auf dem Microarray wurde ein Deckglas sanft abgesenkt mit einer Spritze Nadel. Vor dem Deckglas vollständig abgesenkt wurde, wurde das Deckglas wieder auf, zog dann mit der Nadel wieder abgesenkt, und man ließ sie sanft fallen in Platz und minimiert die Bildung von Luftblasen. Hybridisierende Microarray Objektträger wurde horizontal in 50 ml konische Röhrchen mit Folie und 50 ul ddH 2 O abgedeckt platziert wurde unter der Folie, um eine feuchte Kammer zu schaffen aufgenommen. Zweite Hybridisierung wurde bei 37 ° C für 2-5 Stunden inkubiert.
  4. Zweite Hybridisierung Microarray wurde im Dunkeln mit Raumtemperatur 2X SSC, 0,2% SDS, 1 mM DTT gewaschen und schwappte sanft Deckglas entfernen. Dann wurde Microarray abgedeckt konischen Rohr mit 55 ° C 2X SSC, 0,2% SDS, 1 mM DTT überführt und für 15 Minuten bei 55 ° C. Als nächstes schieben wurde abgedeckt konische Röhrchen mit 2X SSC, 1 mM DTT resuspendiert und für 15 Minuten bei Raumtemperatur unter leichtem Schütteln in regelmäßigen Abständen übertragen. Last, Objektträger wurde auf 0,2 X SSC, 1 mM DTT überführt und bei Raumtemperatur für 15 Minuten unter leichtem Schütteln in regelmäßigen Abständen. Microarray Objektträger wurde durch Zentrifugation für 1 Minute, 2.000 g, Dia-Label-Seite nach unten in bedeckt 50 ml konische Röhrchen mit Kimwipe in den Boden getrocknet. Dry Microarray-Slides wurden gescannt mit GenePix Personal Scanner-Modell 4100A bei Davidson College.

8. Microarray-Analyse

  1. Bilder nach dem Scannen erhalten wurden unter Verwendung des MAGICTool Software am Davidson College von Laurie Heyer und ihre Studenten entwickelt. Kurz gesagt, unter dem "Project"-Reiter, sei ein "New Project" erstellt und gespeichert. Unter dem "Build Expression Profil", "Load Image Pair" ausgewählt wurde und das rote Bild-Datei (_635.tif) wurde als "Red" hochgeladen und die grüne Image-Datei (_532.tif) wurde als "Green" hochgeladen. Dann, mit dem "Build Expression Profil" und "Load Gene List", eine C elegans-Gen-List-Datei aus dem GCAT Website erhalten wurde hochgeladen.
  2. Microarray Bild wurde angesprochen und gerasterten mit dem "Build Expression Profil" und "Create / Edit Grid"-Option. Die "Grid Setup" Dialogfeld bearbeitet wurde mit "48" für die Anzahl der Netze, "22 Zeilen" und "22 Säulen" für jedes Netz, nummeriert spots "von links nach rechts" und "von oben nach unten". "Percent Kontrast Change" wurde erhöht und vergrößert in der Startaufstellung bis einzelne Spots wurden leicht unterscheidbar. Grids wurden, indem Sie zuerst "Set Top Left Spot" auf dem linken Feld erzeugt. Dann wird die Mitte der oberen linken Punkt waren top richtigen Stelle und untere Reihe zum Thema "Grid 1" geklickt haben. Diese Rasterung Verfahren wurde für jeden der 48 Gitter wiederholt, ausgehend von links nach rechts und oben nach unten. Wenn gridding abgeschlossen war, wurde die aktuelle Grid unter "File" "Save Current Grid As" gespeichert. Wenn das Raster erfolgreich gespeichert wurde die "Finished"-Registerkarte ausgewählt wurde.
  3. Zur Beseitigung einer unabhängigen Stellen aus der Analyse wurde das "Build Expression Profile" Tab geöffnet. Unter dem "Addressing Gridding" Option "Spot Kennzeichnen" gewählt wurde. Streaked Flecken oder Hintergrundfluoreszenz wurden markiert und gespeichert, indem Sie "Save Current Flags As" im "Datei Tab".
  4. Markierte Dateien wurden segmentiert mit dem "Build Expression Profil" und wählen Sie "Fixed Radius", wie die Segmentierung Methode der Wahl. Der Radius wurde auf die gewünschte Größe eingestellt und "Daten aktualisieren" angeklickt wurde. Um sicherzustellen, dass der Kreis innerhalb der gerasterten Fläche (gelbes Quadrat) Aufenthalte, die wir gescrollt oben nach unten und von links nach rechts und einmal überprüft "Create Expression Profile" ausgewählt wurde.
  5. Grüne Fluoreszenz-Verhältnisse für jeden der Punkte, die nach dem Markieren geblieben: Während der Segmentierung, die Software des Roten berechnet. Mit der "Expression"-Reiter "Bearbeiten von Daten", "Transform" gewählt wurde. A "Daten transformieren" Dialogfeld angezeigt, wo "logb (x)"-Option, und b = 2 eingegeben wurde. "Working Expression File" wurde von der "Expression"-Reiter erkundet. Für ein Experiment, in dem der Wildtyp erhielt die Cy3 (grün) Aufnahmesequenz und die Mutante erhielt den Cy5 (rot) zu erfassen Sequenz wurden der Wert der log verwandelt Verhältnisse positiv für Gene, die induziert und waren negativ für unterdrückte Gene.
  6. Zuletzt wurden Gene induziert oder um einen bestimmten Faktor unterdrückt analysiert die Auswahl von "Explore" unter der "Expression"-Registerkarte. In der "Exploring" im Dialogfeld "Find Genes Matching Criteria" war es, Gene mit "Max. Wert> X (positive Zahl für induzierte Gene)" oder "Min. Wert <X (negative Zahl für Gene unterdrückt)" in Satz Experimente wie die in # 5 beschrieben. Fold-Expression wurde gleich 2x, wobei 'x' den Wert der Zahl in den Auswahlkriterien eingegeben wird.

9. cDNA-Synthese und Real-Time PCR

  1. Gesamt-RNA wurde wie zuvor beschrieben. Sobald die Qualität und Quantität der isolierten RNA bestimmt wurde, wurde cDNA synthetisiert mit dem iScript cDNA Synthesis Kit (BioRad), 500 ng / ul Gesamt-RNA aus dem Wildtyp und Mutante und Hersteller empfohlenen Protokollen isoliert.
  2. Echtzeit-PCR-Reaktionen wurden mit dem iQ SYBR Green Supermix (BioRad), 100-500 nmol genspezifischen Primer (Tabelle 1) und 4 ul cDNAs durch den vorherigen Schritt erzeugte Set-up. 10 pl Reaktionen wurden unter Verwendung der Thermocycler CFX96 Real-Time System (BioRad).
  3. Der Thermocycler wurde auf 95 ° C für 3 min. Dies wurde durch eine bei 95 ° C für 5 Sekunden und 58 ° C für 30 Sekunden. Diese Schleife wurde insgesamt vierzig Mal abgeschlossen, und ein 65-95 ° C schmelzen Kurve mit einer Steigung von 0,5 Grad war auch eingefügt. ΔΔCT Werte wurden mit Hilfe von drei Housekeeping-Gene (act-1, CDC-42, und PMP-3) als Kontrollen.
GENE Vorwärts-Primer Reverse-Primer
gst-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
gst-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
mes-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
msp-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
msp-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
msp-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
msp-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
msp-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
msp-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tabelle 1. Forward-und Reverse Primer-Sequenzen für die Real-Time PCR

10. Repräsentative Ergebnisse:

RNA-Isolierung und Analyse

Fusion der aktiven Zone Vorläufer Bläschen an präsynaptischen Seiten ist ein obligatorischer Schritt bei der Synaptogenese (3). VSM-1, ein kürzlich identifiziertes v-SNARE-Master-Protein, wurde vorgeschlagen, Vesikelfusion in Hefe und Synaptogenese in Nematoden (siehe Abbildung 1) durch eine unbestimmte Mechanismus (4, und unsere unveröffentlichte Arbeit) zu hemmen. Zum besseren Verständnis der molekularen Signalweg zugrunde liegenden VSM-1 Regulation in Nematoden und bringen etwas Licht in die Synaptogenese Bereich haben wir begonnen, eine genomweite Bildschirm und festgestellt, dass große Sperma-Protein-Genen (msp) in Abwesenheit von voll funktionsfähigen VSM-1 induziert werden .

Um die induzierten Gene in der VSM-1 (ok1468) Mutante von C. untersuchen elegans, führten wir eine Microarray-Gen-Analyse. Dies wurde durch Tests Transkripte aus dem Wildtyp isoliert und die VSM-1 Mutante und der Bestimmung ihrer Bereicherung getan. Konkret haben wir zunächst Gesamt-RNA aus synchronen L4 und L3-Wildtyp und VSM-1 Mutante Larven Nematoden isoliert. Dann behandelten wir die Gesamt-RNA mit DNase I erhalten und untersucht die Qualität der extrahierten RNA mittels Agarose-Gelelektrophorese. In dem Experiment in Abbildung 2 gezeigt, wurde eine Leiter in die erste Gasse benutzt, um die Zahl der Basenpaare für die Standards darstellen. Wildtyp-Proben vorbehandelt und mit DNase nachbehandelt ich waren in den Bahnen 2 und 4 geladen, und VSM-1 Mutante Proben vorbehandelt und mit DNase nachbehandelt ich in den Spuren 3 und 5 waren geladen, jeweils. Die Analyse der RNA-Gelelektrophorese zeigte, dass Wildtyp-und VSM-1-Mutanten-RNA-Proben waren intakt und von guter Qualität. Dies wurde durch die Beobachtung zwei Bands, die die beiden Untereinheiten der ribosomalen RNA vertreten bestimmt.

Microarray-Hybridisierung

Sobald die Qualität der RNA bestimmt wurde, gingen wir mit der cDNA-Synthese. Dazu kehren wir transkribiert die mRNA und fügte hinzu, eine Capture-Sequenz bis zum Schwanz. Die erzeugten cDNAs mit Capture-Sequenzen für Cy3 und Cy5 wurden hybridisiert Dias Microarray und schickte zum Scannen. Microarray Bilder wurden dann in eine Open-Source-Software-Programm namens MAGICTool am Davidson College von Laurie Heyer und ihre Studenten entwickelt eingetragen. Mit dieser Software haben wir überlagert Cy3 und Cy5 Bilder mit Raster-Microarrays, und analysiert fluoreszierenden Profile (siehe Abbildung 3). Sobald gridding abgeschlossen war wir dann segmentiert jedes einzelne Quadrat machen, dass die gesamte gedruckte Oligonukleotid geprüft werde. Dann analysierten wir die induzierte Verhältnisse und erstellt genetische Profil Ausdrücke zeigen, dass Gene, die für die MSP-Familie in Nematoden mit erhöhter Synaptogenese induziert werden. (Tabelle 3).

Validierung und Quantifizierung der Genexpression mittels real time PCR.

Damit Sie verstehen, das genetische Profil in der VSM-1 Mutante analysierten wir eine Reihe von Genen, die für Mitglieder der MSP-Familie mit real time PCR. Zunächst wurde Gesamt-RNA aus Wildtyp und VSM-1 (ok1468) Mutanten isoliert. RNA Proben wurden dann umgekehrt in cDNAs umgeschrieben und für die Echtzeit-PCR-Analyse. Auswertungen von real time PCR Expressionsprofile gezeigt, dass ein Mitglied der MSP Familie in vsm-1 (ok1468) Mutanten induziert werden scheint. Darüber hinaus bestätigt real time PCR Daten Erkenntnissevon Microarrays und verengt die Suche auf eine MSP-Gen-Kandidaten (Abbildung 4).

Abbildung 1
Abbildung 1. A. UNC-17 Immunfärbung zeigte, dass VSM-1-Mutanten höhere synaptische Dichte aufweisen entlang der dorsalen Nervenstrang. Die Bilder wurden bei 63x Vergrößerung, posterior (rechts), um die Vulva analysiert. B. Analyse von WT und VSM-1 (ok1468)-Mutante Synapsen bezeichnet statistisch signifikant verbesserten synaptischen Dichte in der VSM-1-Mutante (** p <0,01). Zwanzig Nematoden wurden Bilder für jeden Genotyp.

Abbildung 2
Abbildung 2. Die Qualität der extrahierten RNA wurde mittels Agarosegelelektrophorese. Das Vorhandensein von zwei intakten ribosomalen Untereinheiten vor und nach DNase I-Behandlung wurde in RNA deutlich extrahiert aus dem Wildtyp und VSM-1 (ok1468) Proben.

Abbildung 3
Abbildung 3. A. Microarray Bild für ein Experiment, wo die Kontrolle rot markiert (Cy5) wurde und der VSM-1-Mutante wurde beschriftet grün (Cy3). B. Repräsentative Bild zeigt 1 von 48 Raster pro Microarray analysiert. Jedes kleine Quadrat auf einem Raster ist repräsentativ für eine einzelne gedruckte Oligonukleotid, und jedes Netz wird durch 22 Reihen und 22 Spalten.

Tabelle 2
Tabelle 2. Microarray-Analyse von Transkripten aus Larven 4 (A) und Larven 3 (B) C isoliert elegans Nematoden zeigten, dass Gene, die für die großen Spermien Proteine ​​in Mutanten mit verbesserter Synaptogenese induziert werden. Hervorgehoben Gene zeigt induzierten Gene in beiden Larven 3 und 4 Larven.

Abbildung 4
Abbildung 4. Real-Time PCR Analyse zeigte, dass ein Mitglied der MSP-Genfamilie, msp -32 in vsm-1 (ok1468) Mutanten induziert wurde. Vertreter normalisiert fache Expression-Kurve zeigt, dass die vms-1 (ok1468) ΔΔCT Werte für MSP-32 unterscheiden sich deutlich, wenn zum Wildtyp (WT) und drei Housekeeping-Gene im Vergleich zur Normalisierung eingesetzt (act-1, CDC-42 und pmp -3). Standardabweichung - im Durchschnitt drei Repliken sind + / aufgetragen.

Discussion

In dieser Studie entwickelten wir eine einfache, benutzerfreundliche Protokoll, das bestimmt Genexpressionsprofile zugrunde liegenden verschiedenen biologischen Phänomenen verwendet werden können. In diesem Protokoll wurde Gesamt-RNA zunächst isoliert und behandelt mit DNase I. Unsere Methode der RNA-Isolierung hat sich dramatisch durch Weglassen Phenolextraktionen und mit Affinität Harze für aufzuräumen 5,6 vereinfacht. Kurz, C. elegans Kutikula und die Zellmembranen wurden geknackt offen durch Einfrieren Nematoden mit flüssigen Stickstoff und Mahlen mit molekularen Harz. Anschließend extrahierte RNA wurde mit DNase I vor cDNA-Synthese behandelt. Die späteren Schritt wurde hinzugefügt, um unspezifische Hybridisierungen zu minimieren; RNA-Proben mit genomischer DNA kontaminiert sein könnten Störungen führen und produzieren viele False-Positives. Dann Wildtyp und VSM-1 (ok1468) mutierten cDNAs wurden mit Cy3 und Cy5 Capture-Sequenzen markiert und hybridisiert auf C. elegans-Microarrays durch die GCAT Programm erhalten. Dieses System ist empfindlicher als vergleichbare Produkte, und die Zwei-Farben-Design nimmt die Anzahl der Arrays benötigt, was zu einer größeren Zeit-und Kosteneffizienz 7,8. Darüber hinaus wird dieses System nicht die Spezialausrüstung von anderen ähnlichen Systemen, daher könnte dieses Verfahren in jedem Standard-Labor-Stufe 7 erreicht werden. Drittens fluoreszierenden hybridisierten Array Bilder wurden unter Verwendung des Open-Source-Software MAGICTool und Genexpressionsprofile erstellt wurden. MAGICTool ist ein benutzerfreundliches Programm, das leicht von Einzelpersonen aller Erfahrungsstufen verwendet wird, aus dem Grundstudium auf die Post-doc. Allerdings erfordert eine optimale Leistung großer Speicher vorhanden. Schließlich erhalten Kandidatengene mittels Microarray-Analyse wurden mit real time PCR validiert.

Obwohl der genomischen Ansatz ist eine effiziente Methode für die Untersuchung biologischer Phänomene, gibt es einige Einschränkungen man in Betracht ziehen sollten. Erstens: Trotz der Besonderheit dieses Microarray-Protokoll sind Transkripte innerhalb einer Familie nicht voneinander, wenn die gedruckte Oligonukleotid aus konservierten Sequenzen genommen wird. Real-time PCR kompensiert Ähnlichkeiten innerhalb einer Genfamilie und kann sogar zwischen einzelnen Isoformen des gleichen Gens unterscheiden. Doch mit real time PCR ist eine Herausforderung für wahre Steuerelemente, die gleichmäßig über einen Organismus die Lebensdauer zum Ausdruck zu finden. Aus diesem Grund werden die Ergebnisse relativ sein. Ein Proteom-Ansatz ist eine Alternative zu unserer Technik. Individuelle Proteine ​​isoliert mittels 2D-Gelelektrophorese und identifizierte sich mit der Massenspektrometrie werden.

Unsere Studien zeigen, dass speziell viele Mitglieder der Major Sperm Protein (MSP) Familie in vsm-1 Mutante Nematoden mit erhöhter Synapsendichte induziert werden. MSPs sind einzigartig für C. elegans und sind verantwortlich für Eizellreifung und Ovulation. Chai 1 hat gezeigt, dass die Regulierung der präsynaptischen Bouton Anzahl und Größe an der neuromuskulären Synapse in Fruchtfliegen wahrscheinlich durch Moleküle, die Große Sperm Protein-Domänen gesteuert. Studien von Tsuda und Kollegen 2 haben gezeigt, Große Sperm Protein-Domänen können als Liganden für Ephrine Rezeptoren dienen, Auslösung Rezeptor-Tyrosin-Kinase-Signalkaskaden. Darüber hinaus validiert real time PCR-Analyse und ab Microarray-Ergebnisse zu einem Mitglied der MSP-Familie, MSP-32 verengt. Zusammengenommen stellt die hier vorgestellte Arbeit eine genomweite Analyse eines zentralen Neurowissenschaften Dilemma sowie die Macht der Bachelor-Forschung in der wissenschaftlichen Arbeit.

Disclosures

Keine Interessenskonflikte erklärt.

Acknowledgments

Diese Arbeit wurde von Studenten im Südwesten Oklahoma State University, Weatherford OK durchgeführt. Diese Arbeit wurde von der NSF RUI-0963258, NIH OK-INBRE 2P20RR016478, GCAT und OCAST HR09-137S unterstützt.

Die vsm1 (ok1468)-Mutante wurde von der Oklahoma Gene Knockout Consortium isoliert.
Die Autoren danken Dan Stefanovic und Tanner Wheeler für ihre wertvolle Hilfe bei der Projektabwicklung.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics