Determinar perfis de expressão genética em C. elegans Usando Microarray e PCR em tempo real

Biology
 

Summary

Análise de microarrays foi conduzido para determinar perfis de expressão genética em

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sinapses são compostos de uma zona de pré-sináptica ativa na sinalização celular e um terminal pós-sináptico na célula-alvo. No caso de sinapses químicas, as mensagens são transportadas por neurotransmissores liberados a partir de terminais pré-sinápticos e recebidos por receptores nas células pós-sináptica. Nossa pesquisa anterior, em Caenorhabditis elegans tem mostrado que VSM-1 regula negativamente exocitose. Além disso, a análise das sinapses no VSM-1 mostraram que os animais mutantes faltando um completamente funcional conectividade VSM-1 aumentaram sináptica. Com base nestes resultados preliminares, que a hipótese de que C. elegans VSM-1 pode desempenhar um papel crucial na sinaptogênese. Para testar essa hipótese, duplo-rotulados análise microarray foi realizada, e os perfis de expressão gênica foram determinados. Primeiro, RNA total foi isolado, transcritas reversamente para cDNA e hibridizadas à microarrays de DNA. Então, em silico-análise de hibridização da sonda fluorescente revelou indução significativa de muitos genes que codificam membros da família maiores de esperma proteína (MSP) em mutantes com a sinaptogênese reforçada. MSPs são o principal componente do esperma em C. elegans e aparecem para sinalizar a maturação do oócito ea ovulação nematóide. Em moscas de frutas, Chai e seus colegas demonstraram que uma MSP-como moléculas regulam número bouton pré-sináptico e tamanho na junção neuromuscular. Além disso, a análise realizada por Tsuda e colegas de trabalho sugeriu que dois MSPs podem atuar como ligantes para os receptores e desencadear Ef receptor tirosina quinase cascatas de sinalização. Por último, análise em tempo real PCR confirmaram que o gene que codifica para a MSP-32 é induzida em vsm-1 (ok1468) mutantes. Tomados em conjunto, a pesquisa realizada por nosso laboratório demonstraram que vsm-1 mutantes têm um aumento significativo na densidade sináptica, o que poderia ser mediada por MSP-32 sinalização.

Protocol

1. Isolamento do RNA total

  1. Saudável nematóides sincronizado foram colhidas por lavagem placas com temperatura ambiente média M9, ​​com 2-3 ml por placa. Ressuspenso nematóides foram transferidos para tubos de 15 ml cônico e para baixo peletizada por centrifugação, 3200 g a 4 ° C por 4 minutos. Nematódeos colhidos foram limpados para fora a partir de bactérias flutuando pela ressuspensão do pellet com 7 ml de NaCl 0,1 M e 7 ml de gelado de 60% de sacarose w / v. A mistura foi incubada ressuspenso em gelo por 15 minutos e nematóides limpa, que swim-up através da solução de sacarose, foram coletadas após centrifugação da mistura a 3200 g a 4 ° C por 4 minutos. Livre de bactérias worms foram transferidos para um novo tubo cônico com pipetas estéreis e lavadas duas vezes com até 15 ml de água livre de RNase seguido por uma centrifugação g 3200 a 4 ° C por 2 minutos. O pellet limpa frouxamente compactada foi transferido para tubo de microcentrífuga 1,5 ml e centrifugado a velocidade máxima (cerca de 10.000 g) por 30 segundos. Por fim, mais água livre de RNase foi removido e 10 volumes de RNAlater foi adicionado ao sedimento, e armazenados a 4 ° C até que esteja pronto para prosseguir.
  2. Para preparar amostras de RNA total, nematóides colhidas foram centrifugadas a velocidade máxima (cerca de 10.000 g) por 4 minutos e RNAlater foi descartada. Então, uma pitada de resina Grinding Molecular (G biociência) foi adicionado ao sedimento ea mistura foi congelada com nitrogênio líquido. Suspensão verme congelado foi triturado em um pó fino com nitrogênio líquido pilão e foi adicionado como necessário para manter o pó frio. Após a moagem, o extrato foi mantido em gelo durante 5 minutos e depois misturado com 700 mL RLT / BME (razão volume de 100 RLT: 1 volume de BME) (Qiagen) e 472 mL de etanol 100%.
  3. RNA total foi isolado utilizando o Kit Mini RNeasy (Qiagen) e seguindo o protocolo do fabricante recomenda. Volume final de RNA isolado foi de 60 mL por amostra biológica.

2. Digestão de DNA e RNA de Limpeza

  1. 50 mg de RNA total potencialmente contaminados com DNA genômico foi digerido com DNase I (Qiagen). Reações Digest contendo 0,1 U DNase / 1 mg RNA e 1X tampão de RDP foram incubadas em temperatura ambiente por 10 minutos.
  2. Amostras de RNA tratados com DNase I foram limpos-up usando o RNeasy Kit Clean-Up MinElute (Qiagen). Protocolos recomendados pelo fabricante foram seguidas e 60 mL eluídos volume final foi obtido.

3. Análise qualitativa e quantitativa de RNA

  1. Concentração de RNA foi determinada usando o espectrofotômetro UV Nanodrop (Thermo Scientific).
  2. Integridade das amostras de RNA foi avaliada através de eletroforese de agarose. Resumidamente, 1% gels RNase agarose foram preparadas utilizando 1X Norte Max Gly Gel Prep / tampão de corrida (Ambion), 1% RNase Agarose LE (Ambion) e 0,5 mcg / ml brometo de etídio. Enquanto o gel foi polimerização, as amostras de RNA foram glyoxylated pela adição de 5 mL da amostra Glyoxyl Loading Dye / amostra e as amostras de incubação a 50 ° C por 30 minutos. Escada de RNA também foi glyoxylated e carregado para comparação de tamanho.

4. Síntese de cDNA

  1. Para cada reação de síntese, 8,4 mg de amostra de RNA foi misturado com 1 mL de primer RT (1 pmole / mL). Uma amostra (WT ou mutantes) recebeu o Cy5 capturar cartilha RT; outra amostra recebeu o Cy3 capturar cartilha RT (fornecido com o Kit de Detecção de Etiquetagem de Array 350, Genisphere). Misturas de amostra foram aquecidas a 75-80 ° C por 10 minutos e transferidos para o gelo por 2-3 minutos.
  2. Enquanto o RNA amostras incubar, o MasterMix (Genisphere) foi preparada como segue: para cada reação RT, combinamos 4 mL Tampão de reacção de 5X RT, 1 mL dNTP (10 mM cada dATP, dCTP, dGTP, dTTP), 1 mL Superase -In RNase Inibidor (fornecido com o Kit de Detecção de Etiquetagem de Array 350, Genisphere), 1 ml RT Enzyme (200 u / mL). Última, 7 mL de MasterMix foi adicionado em cada amostra de RNA, gentilmente misturados (não use vortex) e incubadas 2 horas a 42 ° C.

5. RNA Degradação e purificação de amostras de cDNA

  1. síntese de cDNA foi interrompida pela adição de 3,5 mL 0,5 M NaOH/50mM EDTA (concentração final) e incubados a 65 ° C por 15 minutos. Então, as reações foram neutralizados usando 1M Tris-HCl, pH 8,0 para atingir uma concentração final de 850 mM Tris-HCl. Por último, WT e cDNAs mutantes foram combinadas em um tubo de microcentrífuga. O tubo vazio foi lavado com 73 mL tampão TE 1X e adicionado ao tubo contendo cDNA, o volume final do tubo de cDNAs combinado foi de 130 mL.
  2. CDNA mista foi purificada protocolo do fabricante e após o Kit de Purificação QIAquick PCR (Qiagen). O volume resultante eluída de cDNA purificado foi de 60 mL.

6. Hibridação Microarray primeiro

  1. C. elegans microarray slides obtidos através GCAT (Genome Consortium para o Ensino Active) foram bloqueados emtemperatura ambiente por 1 hora utilizando 0,1 mg / ml de DNA de esperma de salmão em 3X sonicado SSC, 0,1% SDS. Slides bloqueados foram lavadas por imersão em ddH2O e spin-secas por centrifugação por 1 minuto a 2.000 g em 50 ml tubos cônicos com KimWipe no fundo.
  2. Então, tampão de hibridação 2X formamida-based (Genisphere) foi incubada a 55 ° C por 10 minutos, misturando bem para dissolver cristais e centrifugados por 1 min a 10.000 g. Em seguida, 25 mL de amostra cDNA foi gentilmente mixado por flicking com 25 l do tampão de hibridização 2X formamida-based. Amostra de cDNA diluído foi coletado por centrifugação flash para 15 segundos e incubados a 80 ° C por 10 minutos.
  3. Passado, foi cDNA hibridizado com microarray deslize com cuidado pipetagem da amostra aquecida todo cDNA sem tocar no slide. A amostra foi uniformemente espalhado no microarray delicadamente abaixar uma lamínula usando uma agulha de seringa. Antes da lamínula foi totalmente abaixado, a lamínula foi puxado para cima, depois baixou com a agulha de novo, e deixar-se cair suavemente no lugar, minimizando a formação de bolhas de ar. Hibridização primeiro set up foi culminou por colocar o slide na horizontal em um tubo de 50 ml com 50 ul de DDH 2 O abaixo do slide e incubadas overnight a 37 ° C.

7. Hibridação segunda

  1. Microarrays hibridizadas foram lavadas com 2X SSC a diferentes temperaturas. Primeiro, microarray slides foram transferidas para tubos cônicos contendo temperatura ambiente 2X SSC e SDS 0,2% e sloshed suavemente para remover lamínulas. Então, slides microarray foram transferidas para tubos cônicos contendo 55 ° C 2X SSC e SDS 0,2% e incubados a 55 ° C por 15 minutos. Em seguida, as lâminas foram transferidas para 2X SSC e incubadas em temperatura ambiente por 15 minutos, agitando suavemente periodicamente. Passado, as lâminas foram transferidas para 0,2 X SSC e incubados por 15 minutos à temperatura ambiente, agitando suavemente periodicamente. Slides foram lavados spin-secos através da introdução de etiqueta voltada para baixo slides em 50 ml tubos cônicos com um KimWipe no fundo e centrifugado por 1 minuto a 2000 g.
  2. Em seguida, mistura de hibridização segundo foi preparado com tampão de hibridação 2X formamida-based (Genisphere). Tampão de hibridação foi incubada a 55 ° C por 10 minutos e centrifugados por 1 min a 10.000 g. Captura de reagentes fluorescentes (Cy3 e Cy5) e do reagente anti-fade foram descongelados em temperatura ambiente e coberto com papel alumínio para proteger reagentes de fotodegradação. Passos seguintes a hibridização foram realizados no escuro para a exposição à luz minimizado. 150 mL de tampão de hibridação 2X formamida baseado foi combinado com 1,5 reagente anti-fade mL para fazer a mistura de hibridização anti-fade-tratada.
  3. Captura de reagentes Cy3 e Cy5 foram agitadas por 3 segundos e centrifugados por 15 segundos, 10.000 g. Mistura de hibridização segunda foi preparado combinando 75 mix de hibridização mL anti-fade-tratados, 60 de água livre de nuclease mL, 7,5 mL de reagente de captura Cy3, e 7,5 mL de reagente de captura Cy5. Mix de hibridização segunda foi incubada por 10 minutos a 75 ° C e 50 ul de mistura aquecida foi pipetado com muito cuidado para o slide microarray lavado / seco. Para se espalhar uniformemente a amostra no microarray, uma lamínula foi gentilmente baixou usando uma agulha de seringa. Antes da lamínula foi totalmente abaixado, a lamínula foi puxado para cima, depois baixou com a agulha de novo, e deixar-se cair suavemente no lugar, minimizando a formação de bolhas de ar. Hibridação slides microarray era colocada horizontalmente em 50 ml tubo cônico coberto com papel alumínio e 50 ul de DDH 2 O foi adicionado abaixo do slide para criar uma câmara úmida. Hibridização segunda foi incubada a 37 ° C por 2-5 horas.
  4. Microarray hybridizing segunda foi lavado no escuro usando temperatura ambiente 2X SSC, 0,2% SDS, 1 mM DTT e sloshed suavemente para remover lamínula. Então, microarray foi transferido para tubo cônico coberto contendo 55 ° C 2X SSC, 0,2% SDS, 1 mM DTT e incubado por 15 minutos a 55 ° C. Slide, seguinte foi transferido para tubo cônico contendo cobertos 2X SSC, 1 mM DTT e incubados por 15 minutos à temperatura ambiente, agitando suavemente periodicamente. Slide, última foi transferido para 0,2 X SSC, 1 mM DTT e incubadas em temperatura ambiente por 15 minutos, agitando suavemente periodicamente. Slides Microarray foi seca por centrifugação por 1 minuto, 2.000 g, slide etiqueta voltada para baixo no tubo de 50 ml coberto cônico com KimWipe no fundo. Slides microarray seca foram digitalizados utilizando GenePix 4100A modelo pessoais Scanner no Davidson College.

8. Análise de Microarray

  1. Imagens obtidas após a digitalização foram analisados ​​através do Software MAGICTool desenvolvido no Davidson College por Laurie Heyer e seus alunos de graduação. Brevemente, no âmbito do "Projeto" guia, um "New Project" foi criado e salvo. Sob o "Build Expressão Perfil" guia, "Par Load Image" foi selecionado eo arquivo de imagem vermelho (_635.tif) foi carregada como "Red" eo arquivo de imagem verde (_532.tif) foi carregada como "Verde". Então, usando o "Build Expression Profile" guia e "Lista de Gene Load", um C. elegans arquivo de lista de genes obtidos no site GCAT foi carregado.
  2. Imagem Microarray foi abordado e em grade usando o "Build Expression Profile" guia e "Criar / Editar Grid" opção. O "Grid Setup" caixa de diálogo foi editado com "48" para o número de grades, "22 linhas" e "22 colunas" para cada grid, spots numeradas "Esquerda à Direita" e "De cima para baixo". "Alterar Contraste Percent" foi aumentada e ampliada no grid até spots individuais eram facilmente distinguíveis. Grades foram criadas selecionando primeiro "Set Top Spot Esquerda" no painel da esquerda. Então, o centro do ponto superior esquerdo, spot canto superior direito e linha de baixo foram clicados em "Grid 1". Este procedimento foi repetido para gridding cada um dos 48 grades, procedendo da esquerda para a direita e de cima para baixo. Quando gridding foi concluída, a rede atual foi salvo em "Arquivo" "Salvar grade atual como". Quando a grade foi salvo com sucesso na guia "Finished" foi selecionado.
  3. Para eliminar todos os pontos relacionados a partir da análise, o "Build Expression Profile" guia foi aberto. Sob o "Enfrentar Gridding" opção "Spot embandeirar" foi selecionado. Manchas listradas ou fluorescência de fundo foram sinalizadas e salvo, selecionando "Save Flags atual como" sob o "Tab File".
  4. Arquivos sinalizados foram segmentados usando o "Build Expression Profile" guia e selecionando "Raio Fixo" como o método de segmentação de escolha. O raio foi definido para o tamanho desejado, e "Data Update" foi clicado. Para se certificar de que o círculo fica dentro da área de grade (quadrado amarelo) que rolaram para cima para baixo e da esquerda para a direita e uma vez verificada "Criar perfil de expressão" foi selecionado.
  5. Durante a segmentação, o software calculou a Red: Green razões de fluorescência para cada um dos pontos que permaneceram após a sinalização. Usando o "Expressão" guia, "Manipular dados" "Transform" foi selecionado. A "Transform Data" caixa de diálogo onde apareceu "logb (x)" opção, e b = 2 foi digitado. "Arquivo Expressão de Trabalho" foi explorado a partir da "Expressão" guia. Para um experimento no qual o tipo selvagem recebeu o Cy3 seqüência de captura (verde) eo mutante recebeu o Cy5 seqüência de captura (vermelho), o valor dos rácios de log transformados foram positivos para genes que foram induzidos e negativos para os genes reprimidos.
  6. Passado, genes induzidos ou reprimidos por um fator especificado foram analisados ​​selecionando "Explorar", sob a "Expressão" guia. Na caixa de diálogo "Explorando", "encontrar genes que correspondem aos critérios" foi definido como genes com um "Max valor.> X (número positivo para genes induzidos)" ou "Min valor. <X (número negativo para genes reprimidos)" em experimentos como o descrito no n º 5. Dobre-expressão foi igual a 2x, onde 'x' é o valor do número de inscritos no critério de seleção.

9. Síntese de cDNA e PCR em Tempo Real

  1. RNA total foi isolado como descrito anteriormente. Uma vez que a qualidade ea quantidade de RNA isolado foi determinada, cDNA foi sintetizado utilizando o Kit Síntese iScript cDNA (BioRad), 500 ng / mL de RNA total isolado do tipo selvagem e mutante, protocolos e fabricante recomenda.
  2. Reações de PCR em tempo real foram set-up usando o iQ SYBR Green Supermix (BioRad), 100-500 primers nmoles gene específico (tabela 1) e 4 mL cDNAs produzidos pela etapa anterior. 10 mL reações foram executados usando o termociclador CFX96 Sistema Real-Time (BioRad).
  3. O termociclador foi aquecida a 95 ° C por 3 min. Isto foi seguido por uma etapa a 95 ° C por 5 segundos e 58 ° C por 30 segundos. Este ciclo foi concluído um total de quarenta vezes, e uma curva de 65-95 ° C derreter com um gradiente de 0,5 graus também foi inserido. ΔΔCT valores foram calculados com três genes housekeeping (ato-1, CDC-42, e pmp-3) como controle.
GENE PRIMER FRENTE PRIMER REVERSE
gst-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
gst-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
mes-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
msp-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
msp-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
msp-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
msp-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
msp-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
msp-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tabela 1. Forward e Reverse Sequências Primer para Real-Time PCR

10. Resultados representativos:

RNA de isolamento e análise

Fusão de vesículas zona ativa precursor em locais pré-sináptica é um passo obrigatório durante a sinaptogênese (3). VSM-1, um recém-identificado v-SNARE proteína mestre, foi proposta para inibir a fusão das vesículas em leveduras e sinaptogênese em nematóides (ver Figura 1) por um mecanismo indeterminado (4, e nosso trabalho não publicado). Para entender melhor o caminho molecular subjacente VSM-1 na regulação nematóides e trazer alguma luz no campo sinaptogênese, começamos uma tela genome-wide e determinou que os genes do esperma principais proteínas (msp) são induzidos na ausência de totalmente funcional VSM-1 .

Para investigar os genes induzidos na cepa vsm-1 (ok1468) mutantes de C. elegans, realizamos uma análise gene microarray. Isto foi feito por meio de testes transcrições isoladas de tipo selvagem e do VSM-1 cepa mutante e determinar o seu enriquecimento. Especificamente, isolado pela primeira vez a partir de RNA total síncrona L4 e L3 tipo selvagem e VSM-1 larvas nematóides mutantes. Então, nós tratamos do RNA total obtido com DNase I e examinou a qualidade do RNA extraído usando eletroforese em gel de agarose. No experimento mostrado na figura 2, uma escada foi usada na pista primeiro para representar o número de pares de base para as normas. Amostras do tipo selvagem pré-tratados e pós-tratados com DNase I foram carregados em pistas 2 e 4, e VSM-1 amostras mutantes pré-tratados e pós-tratados com DNase I foram carregados em pistas 3 e 5, respectivamente. Análise de eletroforese em gel de RNA mostraram que o tipo selvagem e VSM-1 amostras de RNA mutante estavam intactos e de boa qualidade. Esta foi determinada pela observação duas bandas que representavam as duas subunidades do RNA ribossomal.

Hibridização de microarranjos

Uma vez que a qualidade do RNA foi determinado, procedeu-se com a síntese de cDNA. Para isso, nós revertemos o mRNA transcrito e acrescentou uma seqüência de captura para a cauda. Os cDNAs produzidos contendo seqüências de captura para Cy3 e Cy5 foram hibridizados para microarray slides e enviados para a digitalização. Imagens de microarray foram, então, entrou em um programa de software open source de computador chamado MAGICTool desenvolvido no Davidson College por Laurie Heyer e seus alunos de graduação. Usando este software que cobriu Cy3 e Cy5 imagens, microarrays em grade, e analisados ​​perfis fluorescente (ver Figura 3). Uma vez estava completo gridding nós então segmentado cada quadrado individuais certificando-se o oligonucleotídeo todo impresso estava sendo examinado. Em seguida, analisamos as relações induzidas e criou expressões perfil genético mostra que os genes que codificam a família MSP são induzidos em nematóides com a sinaptogênese reforçada. (Tabela 3).

Validação e quantificação da expressão gênica usando PCR em tempo real.

Para entender melhor o perfil genético da VSM-1 mutante analisamos uma série de genes que codificam membros da família MSP usando PCR em tempo real. Primeiro, RNA total foi isolado de tipo selvagem e tensões vsm-1 (ok1468) mutantes. Amostras de RNA foram então transcritas reversamente em cDNAs e usadas para real time PCR análise. Avaliações de perfis de expressão em tempo real PCR demonstrou que um membro da família MSP parece ser induzida em vsm-1 (ok1468) mutantes. Além disso, PCR em tempo real de dados valida descobertasde microarrays e reduzir a procura de um candidato gene msp (Figura 4).

Figura 1
Figura 1. A. UNC-17 imunocoloração revelou que vsm-1 mutantes apresentam maior densidade sináptica ao longo do cordão nervoso dorsal. Imagens foram analisadas com ampliação de 63x, posterior (direita) para a vulva. B. Análise de WT e VSM-1 (ok1468) sinapses mutante denotado estatisticamente significativa densidade sináptica maior no mutante vsm-1 (** p <0,01). Vinte nematóides foram imagens para cada genótipo.

Figura 2
Figura 2. A qualidade do RNA extraído foi determinada utilizando eletroforese em gel de agarose. A presença de duas subunidades ribossômicas intacta antes e depois do tratamento DNase I foi aparente em RNA extraído de amostras do tipo selvagem e vsm-1 (ok1468).

Figura 3
Figura 3. A. Microarray imagem para um experimento onde o controle foi marcado vermelho (Cy5) eo mutante vsm-1 foi marcado verde (Cy3). B. Representante imagem mostrando um de 48 grades analisadas por microarray. Cada pequeno quadrado em uma grade é representante de um oligonucleotídeo única impressa, e cada grade é composta por 22 linhas e 22 colunas.

Tabela 2
Tabela 2. Microarray análise de transcrições isoladas de larvas 4 (A) e larvas de 3 (B) C. nematóides elegans mostraram que genes que codificam as proteínas do esperma principais são induzidos em mutantes com a sinaptogênese reforçada. Genes destaque indica genes induzidos em ambos os 3 e 4 larvas As larvas.

Figura 4
Figura 4. Real-Time PCR demonstrou que um membro da família do gene msp, msp -32 foi induzida em vsm-1 (ok1468) mutantes. Gráfico expressão representativa normalizado vezes mostra que o vms-1 (ok1468) valores ΔΔCT para msp-32 são significativamente diferentes quando comparados ao tipo selvagem (WT) e três genes são usados ​​para limpeza de normalização (ato-1, CDC-42, e pmp -3). Média de três réplicas são plotados + / - desvio padrão.

Discussion

Neste estudo nós desenvolvemos um protocolo de utilização fácil, amigável que pode ser usado para perfis gene determinada expressão subjacente vários fenômenos biológicos. Neste protocolo, o RNA total foi isolado pela primeira vez e tratados com DNase I. Nosso método de isolamento de RNA foi drasticamente simplificada omitindo extrações fenol e utilizam resinas afinidade para limpar 5,6. Resumidamente, C. membranas elegans cutícula e células estavam rachados aberto por nematóides congelamento com nitrogênio líquido e moagem com resina molecular. Em seguida, o RNA extraído foi tratado com DNase I antes da síntese de cDNA. A etapa posterior foi adicionado para minimizar hibridizações inespecíficas; amostras de RNA contaminados com DNA genômico poderia introduzir interferências e produzem muitos falsos positivos. Em seguida, digite, selvagem e vsm-1 (ok1468) cDNAs mutantes foram marcados com Cy3 e Cy5 seqüências de captura e hibridizado em C. microarrays elegans obtidas através do programa GCAT. Este sistema é mais sensível do que produtos similares, e seu design de duas cores diminui o número de matrizes necessários, resultando em maior tempo e eficiência de custos 7,8. Além disso, este sistema não requer o equipamento especializado de outros sistemas similares, portanto, este procedimento poderia ser realizado em qualquer configuração padrão de laboratório 7. Terceiro, imagens fluorescentes série hibridizadas foram analisados ​​utilizando o software open source MAGICTool, e perfis de expressão gênica foram criados. MAGICTool é um programa fácil de usar que pode ser facilmente utilizado por indivíduos de todos os níveis de experiência, a partir da graduação ao pós-doutorado. No entanto, o desempenho ideal requer disponibilidade de memória de grande porte. Por último, genes candidatos obtidos pela análise microarray foram validados com PCR em tempo real.

Embora a abordagem genômica é um método eficiente para o estudo de fenômenos biológicos, existem algumas limitações deve-se levar em consideração. Primeiro, apesar da especificidade deste protocolo de microarray, transcrições dentro de uma família são indistinguíveis uma da outra se o oligonucleotídeo impresso é retirado de sequências conservadas. PCR em tempo real compensa semelhanças dentro de uma família de genes e pode até mesmo distinguir entre isoformas específicas do mesmo gene. No entanto, com PCR em tempo real é um desafio para encontrar controles verdade que são expressos igualmente em todo tempo de vida de um organismo. Devido a isso, os resultados serão relativos. Uma abordagem proteômica é uma alternativa para a nossa técnica. Proteínas individuais podem ser isoladas por meio de eletroforese em gel 2D e identificado com espectrometria de massa.

Nossos estudos mostram que especificamente muitos membros da família de proteínas do esperma Major (MSP) são induzidos em vsm-1 nematóides mutantes com maior densidade sináptica. MSPs são exclusivas para C. elegans e são responsáveis ​​pela maturação do oócito ea ovulação. Chai 1 tem demonstrado que a regulação do número e tamanho bouton pré-sináptica na junção neuromuscular em moscas de frutas é provável controlado por moléculas contendo domínios principal proteína do esperma. Estudos realizados por Tsuda e seus colegas demonstraram dois domínios principal proteína do esperma pode servir como ligantes para receptores Ephrine, desencadeando cascatas de sinalização do receptor tirosina quinase. Além disso, análise em tempo real PCR validados e reduzida resultados microarray para um membro da família msp, msp-32. Tomados em conjunto, o trabalho aqui apresentado representa uma análise do genoma de um dilema neurociência central, bem como o poder de iniciação científica no esforço científico.

Disclosures

Não há conflitos de interesse declarados.

Acknowledgments

Este trabalho foi realizado pelos alunos de graduação em Southwestern Oklahoma State University, OK Weatherford. Este trabalho foi financiado pela NSF RUI-0963258, NIH OK-INBRE 2P20RR016478, GCAT e OCAST HR09-137S.

O vsm1 (ok1468) mutantes foi isolado pelo Consórcio Knockout Gene Oklahoma.
Os autores agradecem Dan Stefanovic e Tanner Wheeler por sua valiosa ajuda durante a execução do projeto.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics