Détermination des profils d'expression génétique dans les C. elegans Utilisation microréseaux et PCR en temps réel

Biology
 

Summary

L'analyse par microréseau a été menée pour déterminer les profils d'expression génétique dans

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les synapses sont composées d'une zone présynaptique actif dans la signalisation cellulaire et un terminal postsynaptique dans la cellule cible. Dans le cas des synapses chimiques, les messages sont transportés par des neurotransmetteurs libérés à partir de terminaux présynaptiques et reçus par des récepteurs sur les cellules post-synaptiques. Nos recherches précédentes chez Caenorhabditis elegans ont montré que VSM-1 régule négativement l'exocytose. De plus, l'analyse de synapses dans VSM-1 mutants montré que les animaux manquent entièrement fonctionnelle connectivité VSM-1 ont augmenté synaptique. Basé sur ces résultats préliminaires, nous avons émis l'hypothèse que C. elegans VSM-1 peut jouer un rôle crucial dans la synaptogenèse. Pour tester cette hypothèse, doublement marquée analyse microarray a été réalisée, et les profils d'expression génique ont été déterminés. Premièrement, l'ARN total a été isolé, inversement transcrit en ADNc et hybridé à l'puces à ADN. Ensuite, l'analyse in silico de l'hybridation sonde fluorescente a révélé induction significative de nombreux gènes codant pour des membres de la famille des protéines du sperme majeure (MSP) en mutants avec synaptogenèse améliorée. MSP sont le principal composant du sperme en C. elegans et semblent signal de maturation ovocytaire et l'ovulation nématodes. Dans les mouches à fruits, Chai et ses collègues ont démontré que 1 MSP-molécules réguler le numéro de bouton présynaptique et la taille à la jonction neuromusculaire. Par ailleurs, l'analyse effectuée par Tsuda et ses collègues suggère que deux MSP peuvent agir comme des ligands de récepteurs Eph et déclencher des récepteurs tyrosine kinase cascades de signalisation. Enfin, l'analyse PCR en temps réel corroboré que le gène codant pour MSP-32 est induite dans VSM-1 (ok1468) mutants. Pris ensemble, les recherches effectuées par notre laboratoire a montré que VSM-1 mutants ont une augmentation significative de la densité synaptique, qui pourraient être médiés par MSP-32 de signalisation.

Protocol

1. L'isolement de l'ARN total

  1. Healthy nématodes synchronisées ont été récoltés par lavage de plaques avec la température ambiante du milieu M9, en utilisant 2-3 ml par plaque. Nématodes en suspension ont été transférés à des tubes de 15 ml conique et le bas en culot par centrifugation, 3200 g à 4 ° C pendant 4 minutes. Nématodes récoltés ont été nettoyés par des bactéries flottait par remise en suspension le culot avec 7 ml de NaCl 0,1 et 7 ml de glace froid 60% p / v de saccharose. Le mélange a été incubé sur resuspendues glace pendant 15 minutes et les nématodes propre, qui nagent en place grâce à la solution de saccharose, ont été recueillis après centrifugation du mélange à 3200 g à 4 ° C pendant 4 minutes. Les bactéries sans les vers ont été transférés dans un nouveau tube conique en utilisant des pipettes stériles et lavé deux fois avec 15 ml d'eau sans RNase suivie d'une centrifugation 3200 g à 4 ° C pendant 2 minutes. Le nettoyage granulés vaguement compacté a été transférée à 1,5 microtube ml et centrifugé à vitesse maximale (environ 10 000 g) pendant 30 secondes. Enfin, la plupart sans RNase eau a été enlevée et 10 volumes de RNAlater a été ajouté au culot, et conservés à 4 ° C jusqu'au moment de procéder.
  2. Pour préparer les échantillons d'ARN totaux, les nématodes récoltés ont été centrifugés à vitesse maximale (environ 10 000 g) pendant 4 minutes et RNAlater a été écartée. Ensuite, une pincée de résine de broyage moléculaire (biosciences G) a été ajouté au culot et le mélange a été gelé à l'aide d'azote liquide. La suspension a été broyé ver congelés en une fine poudre avec de l'azote liquide et un pilon a été ajouté comme nécessaires pour maintenir la poudre à froid. Après le broyage, l'extrait a été gardé sur la glace pendant 5 minutes et ensuite mélangés avec 700 ul RLT / BME (rapport volume de 100 de RLT: 1 volume de BME) (Qiagen) et 472 ul d'éthanol à 100%.
  3. L'ARN total a été isolé en utilisant le kit RNeasy Mini (Qiagen) et suivant le protocole recommandé par le fabricant. Le volume final des ARN isolé a été de 60 ul par échantillon biologique.

2. Digestion de l'ADN et l'ARN de nettoyage

  1. 50 ug d'ARN total potentiellement contaminés par l'ADN génomique a été digéré avec la DNase I (Qiagen). Réactions Digest contenant 0,1 U de DNase / 1 ug d'ARN et 1X tampon RDP ont été incubées à température ambiante pendant 10 minutes.
  2. Les échantillons d'ARN traités à la DNase I ont été nettoyés à l'aide du RNeasy MinElute Clean-Up Kit (Qiagen). Protocoles recommandés par le fabricant ont été suivies et 60 pl volume final élue a été obtenu.

3. Analyse qualitative et quantitative de l'ARN

  1. Concentration d'ARN a été déterminée en utilisant le spectrophotomètre UV Nanodrop (Thermo Scientific).
  2. Intégrité des échantillons d'ARN a été évaluée en utilisant l'électrophorèse d'agarose. Brièvement, 1% sans RNase gels d'agarose ont été préparés en utilisant 1X Nord Max Gly gel Prep / tampon de migration (Ambion), 1% sans RNase agarose LE (Ambion) et 0,5 ug / ml de bromure d'éthidium. Alors que le gel a été polymérisation, les échantillons d'ARN ont été glyoxylé en ajoutant 5 pi d'échantillon Glyoxyl colorant de charge / échantillon et les échantillons d'incubation à 50 ° C pendant 30 minutes. Échelle de l'ARN a également été glyoxylé et chargée pour comparaison de taille.

4. Synthèse d'ADNc

  1. Pour chaque réaction de synthèse, 8,4 mg d'ARN de l'échantillon a été mélangé avec une RT primaire ul (1 pmole / ul). Un échantillon (WT ou mutants), a reçu le Cy5 capture RT amorce; l'autre échantillon reçu le Cy3 capture RT amorce (fourni avec le tableau 350 Etiquetage-Kit de détection, Genisphere). Mélanges d'échantillons ont été chauffés à 75-80 ° C pendant 10 minutes et transféré à la glace pendant 2-3 minutes.
  2. Alors que l'ARN des échantillons incuber, l'MasterMix (Genisphere) a été préparé comme suit: pour chaque réaction de RT, nous avons combiné 4 pi de tampon de réaction 5X pour RT, 1 ul de dNTP (10 mM de chaque dATP, dCTP, dGTP, dTTP), 1 ul Superase -Dans inhibiteur de RNase (fourni avec le tableau 350 Etiquetage-Kit de détection, Genisphere), 1 pl RT Enzyme (200 u / ul). Dernier, 7 pl d'MasterMix a été ajouté à chaque échantillon d'ARN, mélanger doucement (ne pas utiliser de vortex) et incubé 2 heures à 42 ° C.

5. Dégradation de l'ARN et purification des échantillons d'ADNc

  1. synthèse de l'ADNc a été arrêtée en ajoutant 3,5 ul 0.5M NaOH/50mM EDTA (concentration finale) et incubés à 65 ° C pendant 15 minutes. Ensuite, les réactions ont été neutralisés en utilisant Tris-HCl 1M, pH 8,0 pour atteindre une concentration finale de 850 mM Tris-HCl. Enfin, WT et ADNc mutant ont été combinés dans un tube à centrifuger. Le tube vide a été rincé avec 73 pi de tampon 1X TE et ajouté dans le tube contenant l'ADNc; le volume final du tube a été combinée ADNc 130 pi.
  2. ADNc mixte a été purifié suivant le protocole du fabricant et le QIAquick PCR Purification (Qiagen). Le volume élué résultante d'ADNc a été purifiée 60 pl.

6. Premièrement hybridation Microarray

  1. C. elegans biopuces diapositives obtenues par GCAT (Genome Consortium pour la pédagogie active) ont été bloqués àtempérature ambiante pendant 1 heure en utilisant 0,1 mg / ml d'ADN de sperme de saumon soniqué en 3X SSC, 0,1% SDS. Bloqué diapositives ont été rincés par trempage dans ddH2O et essoré par centrifugation pendant 1 minute à 2000 g dans 50 ml tubes coniques avec Kimwipe en bas.
  2. Puis, 2X tampon d'hybridation à base de formamide (Genisphere) a été incubé à 55 ° C pendant 10 minutes, bien mélangée pour dissoudre les cristaux et centrifugé pendant 1 minute à 10 000 g. Ensuite, un échantillon de 25 ul d'ADNc a été délicatement mélangés en feuilletant avec 25 ul du tampon d'hybridation à base de formamide 2X. Échantillon d'ADNc dilué a été recueilli par centrifugation éclair de 15 secondes et incubées à 80 ° C pendant 10 minutes.
  3. Dernière, l'ADNc a été hybridé à puces glisser en prenant soin de pipetage l'ensemble de l'échantillon d'ADNc chauffée sans toucher la lame. L'échantillon a été réparti uniformément sur la puce par un léger abaissement d'une lamelle en utilisant une aiguille de seringue. Avant la lamelle a été complètement abaissé, la lamelle a été tirée de sauvegarder, puis abaissé avec l'aiguille de nouveau, et laisser tomber doucement en place, en minimisant la formation de bulles d'air. Première hybridation a été mis en place a culminé en mettant le glisser horizontalement dans un tube conique de 50 ml avec 50 ul de DDH 2 O-dessous de la lame et incubé pendant une nuit à 37 ° C.

7. Seconde hybridation

  1. Microarrays hybridés ont été lavées avec 2X SSC à différentes températures. Tout d'abord, diapositives microréseaux ont été transférés dans des tubes coniques contenant température ambiante SSC 2X et 0,2% de SDS et sloshed doucement pour enlever des lamelles. Puis, diapositives microréseaux ont été transférés dans des tubes coniques contenant 55 ° C SSC 2X et SDS 0,2% et incubées à 55 ° C pendant 15 minutes. Ensuite, les lames ont été transférés à SSC 2X et incubés à température ambiante pendant 15 minutes, en agitant doucement périodiquement. Dernière, diapositives ont été transférés à 0,2 x SSC et incubé pendant 15 minutes à température ambiante, en agitant doucement périodiquement. Diapositives ont été lavés essoré par l'introduction d'étiquette vers le bas glisse dans 50 ml tubes coniques avec un Kimwipe dans le fond et centrifugé pendant 1 minute à 2000 g.
  2. Ensuite, mélange d'hybridation a été préparé en utilisant seconde 2X tampon d'hybridation à base de formamide (Genisphere). Tampon d'hybridation a été incubé à 55 ° C pendant 10 minutes et centrifugé pendant 1 minute à 10 000 g. Capturez réactifs fluorescents (Cy3 et Cy5) et le réactif anti-fade ont été décongelés à température ambiante et recouvert d'une feuille afin de protéger les réactifs de photoblanchiment. Étapes d'hybridation suivantes ont été réalisées dans l'obscurité pour exposition à la lumière minimisés. 150 pi de tampon d'hybridation 2X formamide à base a été combiné avec 1,5 ul anti-fade réactif pour faire le mélange d'hybridation anti-fade-traitée.
  3. Capturez réactifs Cy3 et Cy5 ont été vortexés pendant 3 secondes et centrifugé pendant 15 secondes, 10 000 g. Deuxième mélange d'hybridation a été préparé combinant 75 ul mélange hybridation anti-fade-traitée, 60 pl eau sans nucléase, 7,5 ul Cy3 réactif de capture et 7,5 ul Cy5 réactif de capture. Mélange d'hybridation Seconde incubé pendant 10 minutes à 75 ° C et 50 pl de mélange chauffé a été très soigneusement pipette sur la lame biopuces lavé / séché. Pour uniformément répartie l'échantillon sur la puce, une lamelle a été abaissée doucement en utilisant une aiguille de seringue. Avant la lamelle a été complètement abaissé, la lamelle a été tirée de sauvegarder, puis abaissé avec l'aiguille de nouveau, et laisser tomber doucement en place, en minimisant la formation de bulles d'air. Hybridation glisser biopuces a été placé horizontalement dans un tube conique de 50 ml recouverts d'une feuille et 50 pi de DDH 2 O a été ajouté sous la diapositive pour créer une chambre humide. Deuxième hybridation a été incubées à 37 ° C pendant 2-5 heures.
  4. Deuxième puce hybridation a été lavé dans l'obscurité en utilisant la température ambiante SSC 2X, SDS 0,2%, DTT 1 mM et sloshed doucement pour enlever lamelle. Puis, biopuces a été transféré à tube conique couverte à 55 ° C contenant du SSC 2X, SDS 0,2%, DTT 1 mM et on incube pendant 15 minutes à 55 ° C. Ensuite, glissez a été transféré à tube conique couverte contenant du SSC 2X, DTT 1 mM et on incube pendant 15 minutes à température ambiante, en agitant doucement périodiquement. Dernier, a été transféré à glisser de 0,2 x SSC, 1 mM de DTT et incubés à température ambiante pendant 15 minutes, en agitant doucement périodiquement. Glisser biopuces a été séché par centrifugation pendant 1 minute, 2 000 g, faites glisser l'étiquette vers le bas dans le tube conique couverte de 50 ml avec Kimwipe dans le fond. Diapositives biopuces à sec ont été numérisées à l'aide GenePix 4100A personnels modèle de scanner au Davidson College.

8. Analyse de Microarray

  1. Les images obtenues ont été analysées après la numérisation en utilisant le logiciel MAGICTool développés au Davidson College par Laurie Heyer et ses étudiants de premier cycle. En bref, sous l'onglet "Projet", un "New Project" a été créé et enregistré. Sous la rubrique «Construire le profil d'expression" onglet ", Paire Load Image" a été sélectionnée et le fichier image rouge (_635.tif) a été téléchargé en tant que "Rouge" et le fichier image verte (_532.tif) a été téléchargé en tant que «vert». Puis, en utilisant le "Build profil d'expression" onglet et "Liste Gene Load", un C. fichier elegans liste de gènes obtenus à partir du site Web GCAT a été téléchargé.
  2. L'image biopuces a été abordée et quadrillées à l'aide de la "Build profil d'expression" onglet et "Créer / Modifier la grille" option. Le «Paramètres de la grille" boîte de dialogue a été édité en utilisant «48» pour le nombre de grilles, "22 lignes" et "22 colonnes" pour chaque grille, des taches numérotées "de gauche à droite» et «de haut en bas". "Changer le contraste Pourcentage" a été augmenté et zoomé sur la grille jusqu'à taches individuelles étaient facilement reconnaissables. Grilles ont été créées en sélectionnant d'abord «Set Top Spot gauche" sur le panneau de gauche. Ensuite, le centre de la tache supérieure gauche, en haut au bon endroit et la rangée du bas ont été cliqué sur "Grille 1". Cette procédure de maillage a été répété pour chacun des 48 réseaux, en procédant de gauche à droite et de haut en bas. Lorsque le maillage a été achevée, la grille actuelle a été enregistré sous "Fichier" "Enregistrer la grille actuelle comme". Lorsque la grille a été enregistré avec succès les "finis" onglet a été sélectionné.
  3. Afin d'éliminer toutes les taches sans rapport de l'analyse, le «profil Construire expression" onglet a été ouverte. Sous la rubrique «S'attaquer Maillage" option "spot de repérage" a été sélectionné. Taches ou de fluorescence de fond strié étaient signalées et enregistrées en sélectionnant «Enregistrer Drapeaux actuelle comme" sous l'onglet «Fichier».
  4. Fichiers marqués ont été segmentés en utilisant le "Construire le profil d'expression" et en sélectionnant l'onglet «rayon fixe" comme la méthode de segmentation de son choix. Le rayon a été fixé à la taille désirée, et «Données Mise à jour" a été cliqué. Pour s'assurer que le cercle reste dans la partie quadrillée (carré jaune), nous défiler de haut en bas et de gauche à droite et une fois coché la case «Créer un profil d'expression" a été sélectionné.
  5. Pendant la segmentation, le logiciel calcule la Croix-Rouge: Vert ratios de fluorescence pour chacun des spots qui sont restés après la courbe. Utilisation de la "Expression" onglet "Manipuler des données" "Transform" a été sélectionné. Une "transformation de données" boîte de dialogue apparaît où "logb (x)" option, et b = 2 a été conclu. "Fichier Expression de travail" a été explorée à partir du "Expression" onglet. Pour une expérience dans laquelle le type sauvage a reçu la séquence de capture Cy3 (vert) et le mutant a reçu la séquence Cy5 capture (rouge), la valeur des ratios log transformées ont été positifs pour les gènes qui ont été induits et négatif pour les gènes réprimés.
  6. Enfin, les gènes induits ou réprimés par un facteur spécifié ont été analysés en sélectionnant "Explorer" sous la rubrique «Expression» onglet. Dans la boîte de dialogue «Explorer», «trouver des gènes correspondant aux critères» a été mis à des gènes d'une "valeur max.> X (nombre positif pour les gènes induits)" ou "Min. Valeur <X (nombre négatif pour les gènes réprimés)" dans expériences comme celle décrite dans le n ° 5. Pliez-expression a été égal à 2x, où 'x' est la valeur du nombre inscrit dans les critères de sélection.

9. Synthèse d'ADNc et PCR en temps réel

  1. L'ARN total a été isolé comme décrit précédemment. Une fois la qualité et la quantité d'ARN isolé a été déterminé, ADNc a été synthétisé en utilisant le kit de synthèse d'ADNc iScript (BioRad), 500 ng / ul d'ARN total isolé du type sauvage et mutant, fabricant et les protocoles recommandés.
  2. En temps réel les réactions PCR ont été mis en place en utilisant l'iQ SYBR Green Supermix (BioRad), 100-500 amorces nmoles gène spécifique (tableau 1) et 4 ADNc ul produite par l'étape précédente. 10 réactions ul ont été exécutées à l'aide du thermocycleur CFX96 système en temps réel (BioRad).
  3. Le thermocycleur est d'abord chauffé à 95 ° C pendant 3 min. Ceci a été suivi par une étape à 95 ° C pendant 5 secondes et 58 ° C pendant 30 secondes. Cette boucle a été complété un total de quarante fois, et une courbe de 65 à 95 ° C fondre avec un gradient de 0,5 degrés a également été insérée. Les valeurs ont été calculées en utilisant ΔΔCT trois gènes de ménage (ACT-1, CDC-42, et PMP-3) comme témoins.
GENE Amorce sens Amorce antisens
TPS-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
TPS-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
mes-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tableau 1. Avance et retour des séquences d'amorces pour la PCR en temps réel

10. Les résultats représentatifs:

Isolement de l'ARN et l'analyse

Fusion des vésicules actives précurseur de la zone des sites présynaptiques est une étape obligatoire pendant synaptogenèse (3). VSM-1, a été récemment identifié la protéine v-SNARE maître, a été proposé pour inhiber la fusion des vésicules dans la levure et la synaptogenèse dans les nématodes (voir figure 1) par un mécanisme non déterminé (4, et notre travail non publié). Afin de mieux comprendre la voie moléculaire qui sous-tendent la réglementation VSM-1 chez les nématodes et apporter un peu de lumière dans le domaine de la synaptogenèse, nous avons commencé un écran l'ensemble du génome et déterminé que les principaux gènes de protéines du sperme (MSP) sont induits en l'absence de pleinement fonctionnel VSM-1 .

Pour étudier les gènes induits dans la souche VSM-1 (ok1468) mutant de C. elegans, nous avons mené une analyse génétique de biopuces. Cela a été fait en testant les transcriptions isolées de type sauvage et le VSM-1 souche mutante et la détermination de leur enrichissement. Plus précisément, nous avons d'abord isolés à partir d'ARN total synchrones L3 et L4 de type sauvage et VSM-1 nématodes larves mutantes. Ensuite, nous avons traité de l'ARN total obtenu à la DNase I et a examiné la qualité de l'ARN extrait en utilisant électrophorèse sur gel. Dans l'expérience le montre la figure 2, une échelle a été utilisée dans la première voie pour représenter le nombre de paires de bases pour les normes. Échantillons de type sauvage pré-traitées et post-traités à la DNase I ont été chargés dans les couloirs 2 et 4, et VSM-1 échantillons mutant pré-traitées et post-traités à la DNase I ont été chargés dans les voies 3 et 5, respectivement. L'analyse de l'ARN électrophorèse sur gel ont montré que le type sauvage et VSM-1 mutant échantillons d'ARN étaient intacts et de bonne qualité. Cela a été déterminé par l'observation de deux bandes qui a représenté les deux sous-unités de l'ARN ribosomal.

L'hybridation Microarray

Une fois la qualité de l'ARN a été déterminée, nous avons procédé à la synthèse de l'ADNc. Pour ce faire, nous avons une transcription inverse de l'ARNm et ajouté une séquence de capture à la queue. Les ADNc produit contenant des séquences de capture pour Cy3 et Cy5 ont été hybridées à puces diapositives et envoyé pour la numérisation. Images Microarray ont ensuite conclu un programme de logiciel à code source ouvert appelé MAGICTool informatique développé au Davidson College par Laurie Heyer et ses étudiants de premier cycle. L'utilisation de ce logiciel, nous superposées Cy3 et Cy5 images, puces quadrillées, et analysé les profils fluorescents (voir figure 3). Une fois le maillage était complet nous avons ensuite segmenté chaque carré individuelles en s'assurant que les oligonucléotides toute imprimée a été examiné. Ensuite nous avons analysé les ratios induits et créés expressions profil génétique montrant que les gènes codant pour la famille MSP sont induits chez les nématodes avec synaptogenèse améliorée. (Tableau 3).

Validation et la quantification de l'expression des gènes en utilisant PCR en temps réel.

Pour mieux comprendre le profil génétique dans le VSM-1 mutants, nous avons analysé un certain nombre de gènes qui codent pour des membres de la famille MSP utilisant PCR en temps réel. Premièrement, l'ARN total a été isolé à partir des souches de type sauvage et VSM-1 (ok1468) mutant. Les échantillons d'ARN ont ensuite été inversement transcrit en ADNc et utilisées pour l'analyse en temps réel de PCR. Les évaluations des profils d'expression en temps réel de PCR a démontré que l'un des membres de la famille MSP semble être induite dans VSM-1 (ok1468) mutants. Par ailleurs, PCR en temps réel de données valide les résultatsà partir de puces à ADN et limité le recherche d'un candidat du gène MSP (figure 4).

Figure 1
Figure 1. A. UNC-17 a révélé que Immunocoloration VSM-1 mutants présentent plus grande densité de synapses le long de la moelle épinière dorsale. Les images ont été analysées à un grossissement de 63x, postérieure (à droite) à la vulve. B. Analyse des WT et VSM-1 (ok1468) synapses mutant noté statistiquement significative la densité synaptique améliorée dans le mutant VSM-1 (** p <0,01). Vingt nématodes sont des images pour chaque génotype.

Figure 2
Figure 2. La qualité de l'ARN extrait a été déterminée en utilisant électrophorèse sur gel. La présence de deux sous-unités ribosomales intacte avant et après le traitement DNase I était apparente dans l'ARN extrait de type sauvage et des échantillons de VSM-1 (ok1468).

Figure 3
Figure 3. A. L'image biopuces pour une expérience où le contrôle a été étiqueté rouge (Cy5) et le mutant VSM-1 a été étiqueté vert (Cy3). Représentant l'image B. affichant 1 sur 48 grilles analysés par microarray. Chaque petit carré sur une grille est représentatif d'un oligonucléotide imprimé unique, et chaque grille est composée de 22 lignes et 22 colonnes.

Tableau 2
Tableau 2. Analyse des microréseaux de transcriptions isolées de larves 4 (A) et des larves de 3 (B) C. nématodes elegans ont montré que les gènes codant pour les protéines du sperme majeurs sont induits dans mutants avec synaptogenèse améliorée. Gènes en surbrillance indique gènes induits en 3 fois et 4 larves Les larves.

Figure 4
Figure 4. Analyse en temps réel de PCR a démontré que l'un des membres de la famille des gènes MSP, MSP -32 a été induite chez VSM-1 (ok1468) mutants. Représentant graphe normalisé l'expression fois montre que le VMS-1 (ok1468) valeurs ΔΔCT pour MSP-32 sont significativement différents par rapport au type sauvage (WT) et trois gènes de ménage sont utilisés pour la normalisation (ACT-1, CDC-42, et PMP -3). Moyenne de trois répliques sont tracées + / - écart-type.

Discussion

Dans cette étude, nous avons développé un protocole simple à utiliser, convivial qui peut être utilisé pour déterminer les profils d'expression génique qui sous-tendent divers phénomènes biologiques. Dans ce protocole, l'ARN total a été isolé et traité en utilisant la DNase I. Notre méthode d'isolement d'ARN a été considérablement simplifiée par l'omission des extractions phénol et en utilisant des résines d'affinité pour nettoyer 5,6. Brièvement, C. elegans membranes cellulaires et la cuticule ont été fissurés par les nématodes ouvert la congélation à l'azote liquide et le broyage de la résine moléculaire. Ensuite, l'ARN extrait a été traité à la DNase I avant la synthèse d'ADNc. L'étape ultérieure a été ajouté afin de minimiser les hybridations non spécifiques; échantillons d'ARN contaminés par l'ADN génomique pourrait introduire des interférences et de produire de nombreux faux positifs. Puis, de type sauvage et VSM-1 (ok1468) ADNc mutant ont été marqués avec Cy3 et Cy5 séquences de capture et hybridé sur C. microarrays elegans obtenus par le programme GCAT. Ce système est plus sensible que des produits similaires, et ses deux couleurs de conception diminue le nombre de tableaux nécessaires, résultant en plus de temps et 7,8 coût-efficacité. De plus, ce système ne nécessite pas l'équipement spécialisé d'autres systèmes similaires, par conséquent, cette procédure pourrait être accompli dans n'importe quel environnement de laboratoire standard 7. Troisièmement, les images fluorescentes array hybrides ont été analysés en utilisant le logiciel open source MAGICTool, et les profils d'expression génique ont été créés. MAGICTool est un programme convivial qui est facilement utilisée par des personnes de tous niveaux d'expérience, du baccalauréat au post-doctorat. Toutefois, la performance optimale nécessite la disponibilité de mémoire importante. Enfin, les gènes candidats obtenus en utilisant l'analyse des microréseaux ont été validés avec PCR en temps réel.

Bien que l'approche génomique est une méthode efficace pour étudier des phénomènes biologiques, il ya quelques limitations on devrait prendre en considération. Premièrement, en dépit de la spécificité de ce protocole biopuces, les transcriptions sein d'une famille sont indiscernables les uns des autres si l'oligonucléotide imprimée est tirée de séquences conservées. PCR en temps réel compense les similitudes au sein d'une famille de gènes et peut même distinguer entre les isoformes spécifiques d'un même gène. Cependant, avec PCR en temps réel est un défi de trouver des contrôles vrai que s'expriment aussi à travers la durée de vie d'un organisme. Pour cette raison, les résultats seront relatives. Une approche protéomique est une alternative à notre technique. Protéines individuelles peuvent être isolées par électrophorèse en gel 2D et identifiés par spectrométrie de masse.

Nos études montrent que spécifiquement nombreux membres de la protéine du sperme Major (MSP) de la famille sont induits dans VSM-1 nématodes mutants avec la densité synaptique accrue. MSP sont uniques à C. elegans et sont responsables de la maturation ovocytaire et l'ovulation. Chai 1 a démontré que la régulation du nombre et la taille de bouton présynaptique de la jonction neuromusculaire chez la drosophile est probable contrôlées par des molécules contenant des domaines majeurs protéine du sperme. Des études menées par Tsuda et ses collègues ont démontré deux principaux domaines de protéine du sperme peut servir de ligands de récepteurs Ephrine, déclenchant des cascades de signalisation du récepteur tyrosine kinase. Par ailleurs, l'analyse PCR en temps réel validé et rétrécie vers le bas les résultats de microréseaux pour un membre de la famille des MSP, MSP-32. Pris ensemble, le travail présenté ici constitue une analyse du génome entier d'un dilemme central des neurosciences ainsi que la puissance de recherche de premier cycle dans l'entreprise scientifique.

Disclosures

Aucun conflit d'intérêt déclaré.

Acknowledgments

Ce travail a été réalisé par des étudiants de premier cycle à l'Université d'Oklahoma du sud-ouest d'Etat, OK Weatherford. Ce travail a été soutenu par la NSF RUI-0963258, le NIH OK INBRE 2P20RR016478, GCAT et OCAST HR09-137S.

Le vsm1 (ok1468) mutant a été isolé par le Consortium d'Oklahoma inactivation du gène.
Les auteurs remercient Dan Stefanovic et Tanner Wheeler pour leur aide précieuse lors de l'exécution du projet.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics