Fastställande genuttryck profiler i C. elegans Använda Microarray och Real-time PCR

Biology
 

Summary

Microarray analys utfördes för att bestämma genetiska uttryck profiler

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Synapser består av en presynaptisk aktiv zon i signalering cellen och en postsynaptiska terminalen i målcellen. När det gäller kemiska synapser, är meddelanden som bärs av signalsubstanser frigörs från presynaptiska terminaler och tas emot av receptorer på postsynaptiska celler. Vår tidigare forskning inom Caenorhabditis elegans har visat att VSM-1 negativt reglerar exocytos. Dessutom visade analysen av synapser i VSM-1 mutanter att djur som saknade en fullt fungerande VSM-1 har ökat synaptisk anslutning. Baserat på dessa preliminära resultat, hypoteser vi att C. elegans VSM-1 kan spela en avgörande roll i synaptogenesis. För att testa denna hypotes, var dubbel-märkt microarray analys och genuttryck profiler fastställdes. Först total RNA var isolerade, omvänt transkriberas till cDNA och hybridiseras till DNA microarrays. Sedan avslöjade i silico-analys av fluorescerande probe hybridisering signifikant induktion av många gener som kodar för medlemmar av de stora spermier proteinet familj (MSP) i mutanter med ökad synaptogenesis. MSPs är den största delen av spermier i C. elegans och verkar signalen mognad nematod äggcell och ägglossning. I bananflugor visade Chai och kollegor 1 som MSP-liknande molekyler som reglerar presynaptiska Bouton antal och storlek i den neuromuskulära förbindelsen. Dessutom föreslås en analys med Tsuda och medarbetare två som MSPs kan verka som ligander för Ef receptorer och utlöser receptor tyrosinkinas signalering kaskader. Slutligen bekräftas i realtid PCR-analys att den gen som kodar för MSP-32 är induceras i VSM-1 (ok1468) mutanter. Sammantaget har forskning utförd av vårt laboratorium visat att VSM-1 mutanter har en betydande ökning av synaptisk densitet, vilket kan vara medierad av MSP-32-signalering.

Protocol

1. Isolering av Total RNA

  1. Friska synkroniserade nematoder skördades genom att tvätta tallrikar med rumstemperatur M9 medium, med 2-3 ml per platta. Återsuspenderade nematoder överfördes till 15 ml koniska rör och pelleterat ner genom centrifugering, 3200 g vid 4 ° C i 4 minuter. Skördade nematoder rensades från flöt bakterier genom resuspending pelleten med 7 ml av 0,1 M NaCl och 7 ml iskall 60% w / v sackaros. Den återsuspenderade blandningen inkuberades på is i 15 minuter och rena nematoder, som simmar upp genom sackaroslösning, samlades in efter centrifugering blandningen på 3200 g vid 4 ° C i 4 minuter. Bakterier utan maskar överfördes till ett nytt koniska rör med sterila pipetter och tvättas två gånger med upp till 15 ml RNase-fria vatten, följt av ett 3200 g centrifugering vid 4 ° C i 2 minuter. Den rena löst packad pellets överfördes till 1,5 ml mikrocentrifugrör och centrifugeras vid maximal hastighet (cirka 10.000 g) i 30 sekunder. Slutligen var mest RNas-fria vattnet bort och 10 volymer av RNAlater lades till pellets, och lagras vid 4 ° C tills den ska fortsätta.
  2. För att förbereda totala RNA prover, skördades nematoder centrifugeras vid maximal hastighet (cirka 10.000 g) i 4 minuter och RNAlater var kasseras. Då var en nypa molekylär Slipning Resin (G Bioscience) läggs till pelleten och blandningen frystes med hjälp av flytande kväve. Fryst mask fjädring var mals till ett fint pulver med mortel och flytande kväve lades till som behövs för att hålla pulvret kallt. Efter slipning extraktet var kvar på isen i 5 minuter och sedan blandas med 700 l RLT / BME (förhållandet 100 volym RLT: 1 del BME) (Qiagen) och 472 l 100% etanol.
  3. Total RNA isolerades med RNeasy Mini Kit (Qiagen) och enligt tillverkarens rekommenderade protokollet. Slutliga volymen av isolerade RNA var 60 l per biologiska prov.

2. DNA Matsmältning och RNA Cleanup

  1. 50 mikrogram av det totala RNA kan vara smittade med genomisk DNA kokas med DNase I (Qiagen). Digest reaktioner innehållande 0,1 U DNas / 1 mikrogram RNA och 1X buffert RDP inkuberades vid rumstemperatur i 10 minuter.
  2. RNA-prover som behandlats med DNas jag var städas upp med RNeasy MinElute Clean-Up Kit (Qiagen). Protokoll rekommenderas av tillverkaren följdes och 60 l sista elueras volym erhölls.

3. Kvalitativ och kvantitativ analys av RNA

  1. RNA-koncentrationen beräknades med UV-spektrofotometer Nanodrop (Thermo Scientific).
  2. Integritet av RNA prover utvärderades med hjälp av agaros elektrofores. Kortfattat var 1% RNase-fri agarosgeler prepareras med 1X norra Max Gly Gel Prep / löpning Buffer (Ambion), 1% RNas-fri agaros LE (Ambion) och 0,5 mikrogram / ml etidiumbromid. Medan gelen var polymerisation, var RNA-prover glyoxylated genom att tillsätta 5 ìl Glyoxyl Sample laddningsfärg / prov och inkuberas proverna vid 50 ° C i 30 minuter. RNA stege var också glyoxylated och lastas för storlek jämförelse.

4. cDNA syntes

  1. För varje syntes reaktion var 8,4 mikrogram RNA prov blandat med 1 l RT grundfärg (1 pmole / l). Ett prov (WT eller mutanter) fick Cy5 fånga RT primer, det andra provet fick Cy3 fånga RT grundfärg (medföljer Array 350 Märkning-Detection Kit, Genisphere). Exempel på blandningar värmdes vid 75-80 ° C i 10 minuter och överföras till is i 2-3 minuter.
  2. Medan RNA prover inkubera i mastermix (Genisphere) var beredd på följande sätt: För varje RT reaktion, tillsammans har vi 4 l 5X Reaktion buffert för RT, 1 l dNTP (10 mm vardera dATP, dCTP, dGTP, dTTP), 1 l Superase -I RNas-hämmare (medföljer Array 350 Märkning-Detection Kit, Genisphere), 1 l RT Enzyme (200 u / l). Senast var 7 ìl mastermix tillsätts varje RNA-prov, försiktigt blandas (använd inte virvel) och inkuberas 2 timmar vid 42 ° C.

5. RNA Nedbrytning och rening av cDNA prov

  1. cDNA syntes stoppades genom att tillsätta 3,5 l 0,5 M NaOH/50mM EDTA (slutlig koncentration) och inkuberas vid 65 ° C i 15 minuter. Då var reaktionerna neutraliseras med hjälp av 1M Tris-HCl, pH 8,0 för att nå en slutlig koncentration av 850 mM Tris-HCl. Slutligen har WT och muterade cDNAs kombineras till ett mikrocentrifugrör. Den tomma tuben var sköljs med 73 l 1X TE buffert och läggs till cDNA-rör, den sista volymen av den kombinerade cDNAs Röret var 130 l.
  2. Blandade cDNA renades efter tillverkarens protokollet och QIAquick PCR Purification Kit (Qiagen). Den resulterande elueras volymen av renade cDNA var 60 l.

6. Första Microarray Hybridisering

  1. C. elegans microarray slides som erhållits genom GCAT (Genome konsortiet för Active undervisning) var blockerad vidrumstemperatur under 1 timme med 0,1 mg / ml sonicated lax spermiens DNA i 3X SSC, 0,1% SDS. Blockerade diabilder var sköljas genom att doppa i ddH2O och centrifugeras genom att centrifugera i 1 minut vid 2000 gi 50 ml koniska rör med KimWipe i botten.
  2. Då var 2X formamid-baserade hybridisering buffert (Genisphere) inkuberades vid 55 ° C i 10 minuter, blandas väl att lösa upp kristaller och centrifugeras i 1 minut vid 10 tusen g. Därefter var 25 l cDNA prov försiktigt blandas snärta med 25 ìl av 2X formamid-baserade hybridisering buffert. Utspädd cDNA prov samlades in av Flash snurra i 15 sekunder och inkuberas vid 80 ° C i 10 minuter.
  3. Senast var cDNA hybridiseras till microarray bild genom att försiktigt pipettera hela uppvärmda cDNA prov utan att röra vid bilden. Urvalet var jämnt fördelad på microarray genom att försiktigt sänka ett täckglas med hjälp av en spruta nål. Innan locket glida var helt sänkt, var luckan glida dras tillbaka upp, då sänks med nålen igen, och tillåts falla försiktigt på plats, vilket minimerar bildandet av luftbubblor. Först hybridisering ställa upp var kulminerade genom att sätta bilden horisontellt i ett 50 ml koniskt rör med 50 l av DDH 2 O under bilden och inkuberas över natten vid 37 ° C.

7. Andra Hybridisering

  1. Hybridiseras microarrays spolades med 2X SSC vid olika temperaturer. Först var microarray slides överföras till koniska rör med rumstemperatur 2X Rymdbolaget och 0,2% SDS och plaskade försiktigt ta bort täckglas. Då var microarray slides överföras till koniska rör med 55 ° C 2X Rymdbolaget och 0,2% SDS och inkuberas vid 55 ° C i 15 minuter. Därefter har bilderna överförts till 2X SSC och inkuberas i rumstemperatur i 15 minuter och skaka försiktigt med jämna mellanrum. Senast var bilderna överförts till 0,2 X SSC och inkuberas i 15 minuter i rumstemperatur, skaka försiktigt med jämna mellanrum. Tvättade diabilder var centrifugeras genom att införa etikettsidan nedåt diabilder i 50 ml koniska rör med en KimWipe i botten och centrifugeras i 1 minut vid 2000 g.
  2. Nästa andra hybridisering blandning förbereddes med 2X formamid-baserade hybridisering buffert (Genisphere). Hybridisering buffert var inkuberas vid 55 ° C i 10 minuter och centrifugeras i 1 minut vid 10 tusen g. Capture fluorescerande reagenser (Cy3 och Cy5) och anti-fade reagens var tinade vid rumstemperatur och täckt med folie för att skydda reagenser från fotoblekning. Efter hybridisering steg utfördes i mörkret för att minimera ljus. 150 ìl 2X formamid-baserade hybridisering buffert kombinerades med 1,5 l anti-fade reagens för att göra anti-fade-behandlade hybridisering blandning.
  3. Fånga reagenser Cy3 och Cy5 var vortexed i 3 sekunder och centrifugeras i 15 sekunder, 10.000 g. Andra hybridisering blandningen var beredd att kombinera 75 l anti-fade-behandlade hybridisering mix, 60 l nukleasfritt vatten, 7,5 l Cy3 fånga reagens och 7,5 l Cy5 fånga reagens. Andra hybridisering mix var inkuberas under 10 minuter vid 75 ° C och 50 l av uppvärmd blandning var pipetteras mycket noga på den tvättas / torkas microarray bild. För jämnt fördelad provet på microarray, var en cover glida försiktigt sänks med en spruta nål. Innan locket glida var helt sänkt, var luckan glida dras tillbaka upp, då sänks med nålen igen, och tillåts falla försiktigt på plats, vilket minimerar bildandet av luftbubblor. Hybridisering microarray bild var placeras horisontellt i 50 ml koniska rör täckt med folie och 50 ìl DDH 2 O lades under bilden för att skapa en fuktig kammare. Andra hybridisering var inkuberas vid 37 ° C i 2-5 timmar.
  4. Andra hybridisering microarray spolades i mörker med rumstemperatur 2X SSC, 0,2% SDS, 1 mm DTT och plaskade försiktigt för att ta av locket halka. Då var microarray överfördes till säkerställda koniska rör innehållande 55 ° C 2X SSC, 0,2% SDS, 1 mm DTT och inkuberas i 15 minuter vid 55 ° C. Därefter skjuter överfördes till täckt koniska rör innehållande 2X SSC, 1 mm DTT och inkuberas i 15 minuter i rumstemperatur, skaka försiktigt med jämna mellanrum. Sist bilden överfördes till 0,2 X SSC, 1 mm DTT och inkuberas i rumstemperatur i 15 minuter och skaka försiktigt med jämna mellanrum. Microarray bild torkades genom att centrifugera i 1 minut, 2000 g, skjut etikettsidan nedåt i täckta 50 ml koniska rör med KimWipe i botten. Torr microarray slides söktes igenom med hjälp av GenePix Personlig 4100A skannermodell vid Davidson College.

8. Microarray analys

  1. Bilder som erhållits efter skanning analyserades med hjälp av MAGICTool Programvara som utvecklats vid Davidson College av Laurie Heyer och hennes studenter. Kortfattat, under "Projekt" fliken, var en "New Project" skapas och sparas. Under "Bygg Expression profil" på fliken "Load Image Pair" valts och den röda bildfil (_635.tif) har överförts som en "röd" och den gröna bildfil (_532.tif) laddades upp som "Green". Använd sedan "Bygg Expression profil"-fliken och "Ladda Gene List", en C. elegans gen listfil erhållas från GCAT webbplats upp.
  2. Microarray bild togs upp och inrutade med "Bygg Expression profil"-fliken och "Skapa / Redigera rutnät" alternativet. Den "Grid Setup" i dialogrutan redigerades med "48" för antalet nät ", 22 rader" och "22 kolumner" för varje nät, numrerade prickar "Vänster till Höger" och "uppifrån och ned". "Procent Kontrast Ändra" höjdes och zoomade in på nätet fram till enskilda platser var lätta att urskilja. Galler skapades genom att först välja "Set Top Left Spot" på den vänstra panelen. Sedan, mitt i det övre vänstra platsen var övre högra plats och nedre raden klickat på "Grid 1". Detta gridding procedur upprepades för varje 48 nät, fortsätter vänster till höger och uppifrån och ned. När gridding blev klar var det nuvarande nätet sparas under "File", "Save Current Grid som". När nätet har sparats på "Klar"-fliken valdes.
  3. Att eliminera eventuella orelaterade fläckar från analysen, var "Build Expression profil" fliken öppnas. Under "Ta Gridding" alternativ "Spot Flagga" valdes. Randiga fläckar eller bakgrundsfluorescens var flaggas och sparas genom att välja "Save Current flaggor som" under "File flik".
  4. Flaggad filer var segmenterade med "Bygg Expression profil"-fliken och välja "Fixed Radie" som segmentering metod att välja. Radien var satt till önskad storlek och "Uppdatera data" klickade. För att säkerställa att cirkeln håller sig inom den inrutade ytan (gul fyrkant) vi bläddrat uppifrån och ner och från vänster till höger och en gång kontrolleras "Skapa Expression profil" valdes.
  5. Under segmentering, programvaran beräknat Röd: grön fluorescens nyckeltal för de platser som kvarstod efter flaggning. Använda "Expression" fliken, "manipulera data", "Transform" valdes. En "Transform Data" i dialogrutan visades där "logb (x)" alternativet, och b = 2 ingicks. "Arbeta Expression File" undersöktes från "Expression"-fliken. För ett experiment där den vilda typen fick Cy3 (grön) fånga sekvens och den muterade fick Cy5 (röd) fånga sekvens, var värdet av de förvandlade loggen nyckeltal positiva för gener som var framkallade och negativa för undertryckta gener.
  6. Senast var gener inducerad eller förtryckta av en viss faktor analyseras välja "Utforska" under "Expression"-fliken. I "Exploring" i dialogrutan "hitta gener Matchande Kriterier" var inställd på att gener med en "Max. Värde> X (positivt tal för inducerad gener)" eller "Min. Värde <X (negativt värde för undertryckta gener)" i experiment som det beskrivs i # 5. Vik-uttryck var lika med 2x, där "x" är värdet på det numret i urvalskriterierna.

9. cDNA Syntes och realtids-PCR

  1. Total RNA var isolerad som tidigare beskrivits. När kvalitet och kvantitet av isolerade RNA var bestämd, var cDNA syntetiseras med iScript cDNA syntes Kit (BioRad), 500 ng / l total RNA isoleras från vildtyp och mutant, och tillverkaren rekommenderade protokoll.
  2. Real time PCR reaktioner sattes upp med hjälp av iQ SYBR Grön Supermix (BioRad), 100-500 nmoles gen specifika primers (tabell 1) och 4 l cDNAs produceras av föregående steg. 10 l reaktioner drivs enligt termocykler CFX96 Real-Time System (BioRad).
  3. Den termocykler var först värms till 95 ° C i 3 min. Detta följdes av ett steg vid 95 ° C i 5 sekunder och 58 ° C i 30 sekunder. Denna slinga slutfördes totalt fyrtio gånger, och en 65-95 ° C smälter kurva med en lutning på 0,5 grader var också in. ΔΔCT värden har beräknats med tre städning gener (agerar-1, CDC-42, och PMP-3) som kontroller.
GEN FRAMÅT PRIMER REVERSE PRIMER
GST-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
GST-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
MES-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tabell 1. Framåt och bakåt Primer sekvenser för realtids-PCR

10. Representativa resultat:

RNA-isolering och analys

Fusion av aktiva blåsor zon föregångare på presynaptiska platser är ett obligatoriskt steg under synaptogenesis (3). VSM-1, en nyligen identifierade v-FÖRSÅT mästare protein, föreslogs att hämma vesikelfusion i jäst och synaptogenesis i nematoder (se figur 1) genom en obestämd mekanism (4, och vårt opublicerat arbete). För att bättre förstå de molekylära väg underliggande VSM-1 reglering i nematoder och få lite ljus i synaptogenesis fältet, började vi en genomet bred skärm och bestämt att stora spermier protein gener (MSP) induceras i avsaknad av fullt fungerande VSM-1 .

För att undersöka de inducerade gener i VSM-1 (ok1468) mutant stam av C. elegans, genomförde vi en microarray gen analys. Detta gjordes genom att testa avskrifter isolerats från vilda typ och VSM-1 mutant stam och bestämma deras berikande. Specifikt isolerade vi först totala RNA från synkrona L4 och L3 vild typ och VSM-1 mutant nematoder larver. Sedan behandlade vi den totala RNA erhålls med DNas jag och undersökte kvaliteten på extraherat RNA med agarosgelelektrofores. I experimentet visas i figur 2, var en stege som används i första körfältet för att representera antalet baspar för standarder. Vildtyp prover förbehandlas och efter behandling med DNas jag lastades i filer 2 och 4 och VSM-1 mutant prover förbehandlas och efter behandling med DNas jag lastades i körfält 3 och 5, respektive. Analys av RNA gelelektrofores visade att vild typ och VSM-1 mutant RNA-proverna var intakt och av god kvalitet. Detta har bestämts genom att observera två band som representerade två subenheter av ribosomalt RNA.

Microarray hybridisering

När kvalitet av RNA var besluten, fortsatte vi med cDNA syntes. För att göra det omvända vi transkriberade mRNA och lagt till en fånga sekvens till svansen. Den producerade cDNAs innehåller fånga sekvenser för Cy3 och Cy5 var hybridiseras till microarray diabilder och skickas iväg för skanning. Microarray bilder har sedan ingått ett open source programvara som heter MAGICTool utvecklats vid Davidson College av Laurie Heyer och hennes studenter. Med denna mjukvara vi överlagrade Cy3 och Cy5 bilder, inrutade microarrays, och analyseras fluorescerande profiler (se figur 3). När gridding var fullständig vi sedan segmenterade varje enskild ruta att se det hela tryckt oligonukleotiden prövades. Sedan har vi analyserat de inducerade nyckeltal och skapade genetiska profil uttryck som visar att gener som kodar för MSP familjen är induceras i nematoder med ökad synaptogenesis. (Tabell 3).

Validering och kvantifiering av genuttryck med hjälp realtid PCR.

För att ytterligare förstå den genetiska profilen i VSM-1 mutant vi analyserat ett antal gener som kodar för medlemmar av MSP familj med realtid PCR. Först var total RNA isolerat från vilda typ och VSM-1 (ok1468) muterade stammar. RNA-prover har sedan omvänt transkriberas till cDNAs och användas för realtids PCR-analys. Utvärderingar av real time PCR uttryck profiler visade att en medlem av MSP familjen verkar vara induceras i VSM-1 (ok1468) mutanter. Dessutom validerar i realtid PCR uppgifter fyndfrån microarrays och begränsats sökningen till en MSP-gen kandidat (Figur 4).

Figur 1
Figur 1. A. UNC-17 immunfärgning avslöjade att VSM-1 mutanter uppvisar högre synaptisk densitet längs ryggens nerver sladden. Bilderna har analyserats vid 63x förstoring, bakre (höger) till vulva. B. Analys av WT och VSM-1 (ok1468) mutant synapser betecknas statistiskt signifikant ökad synaptisk densitet i VSM-1 mutant (** p <0,01). Tjugo nematoder fanns bilder för varje genotyp.

Figur 2
Figur 2. Kvaliteten av extraherat RNA bestämdes med agarosgelelektrofores. Närvaron av två intakta ribosomsubenheterna före och efter DNas jag behandlingen var påtaglig hos RNA ur vildtyp och VSM-1 (ok1468) prover.

Figur 3
Figur 3. A. Microarray bilden för ett experiment där kontrollen var märkt röd (Cy5) och VSM-1 mutant var märkt grön (Cy3). B. representant bild som visar 1 av 48 nät analyseras varje microarray. Varje liten ruta på ett rutnät är representativ för en tryckt enda oligonukleotid, och varje rutnät består av 22 rader och 22 kolumner.

Tabell 2
Tabell 2. Microarray analys av avskrifter isolerade från Larv 4 (A) och larver 3 (B) C. elegans nematoder visade att gener som kodar för de stora spermier proteiner induceras i mutanter med ökad synaptogenesis. Markerad gener visar inducerade gener i både Larver 3 och larver 4.

Figur 4
Figur 4. Realtids-PCR-analys visade att en medlem av MSP genfamiljen, MSP -32 var induceras i VSM-1 (ok1468) mutanter. Representant normaliserade gånger uttryck Diagrammet visar att VMS-1 är (ok1468) ΔΔCT värden för MSP-32 skiljer sig betydligt jämfört med vild typ (WT) och tre gener hushållning använt för normalisering (agerar-1, CDC-42, och PMP -3). Genomsnitt av tre kopior ritas + / - standardavvikelse.

Discussion

I denna studie har vi utvecklat ett enkelt, användarvänligt protokoll som kan användas för att bestämmas genuttrycksprofilerna bakom olika biologiska fenomen. I detta protokoll var totalt RNA först isoleras och behandlas med hjälp av DNas I. Vår metod för RNA-isolering har förenklats dramatiskt genom att utelämna fenol extraktioner och använda affinitet hartser för sanering 5,6. Kortfattat, C. elegans cuticule och cellmembran var spruckna öppna genom frysning nematoder med flytande kväve och slipning med molekylär harts. Därefter extraherade RNA behandlades med DNas jag innan cDNA syntes. Den senare steg inkom minimera ospecifik hybridizations, RNA-prover förorenade med genomiska DNA skulle kunna införa störningar och producera många falskt positiva. Då vild typ och VSM-1 (ok1468) mutant cDNAs var märkta med Cy3 och Cy5 sekvenser fånga och hybridiseras på C. elegans microarrays erhållits genom GCAT programmet. Detta system är mer känsliga än liknande produkter, och tvåfärgad design minskar antalet nödvändiga arrayer, vilket resulterar i mer tid och kostnadseffektivitet 7,8. Dessutom kräver detta system inte de specialiserade utrustning av andra liknande system, och därför kunde detta förfarande ske i någon standard laboratoriemiljö 7. Tredje, fluorescerande hybridiseras rad bilder analyserades med hjälp av öppen MAGICTool källkod, och genuttryck profiler skapades. MAGICTool är ett användarvänligt program som lätt utnyttjas av individer av alla erfarenheter nivåer, från grundutbildning till efter doktorsexamen. Kräver dock optimal prestanda stort minne tillgänglighet. Slutligen erhålls kandidatgener med hjälp av microarray-analys har validerats i realtid PCR.

Även om genomikaspekter är en effektiv metod för att studera biologiska fenomen, det finns vissa begränsningar man bör ta hänsyn till. Först, trots den särskilda karaktären hos denna microarray protokoll, avskrifter inom en familj är omöjliga att skilja från varandra, om den tryckta oligonukleotid är tagen från bevaras sekvenser. Realtids PCR kompenserar för likheterna inom en gen familj och kan även skilja mellan specifika isoformer av samma gen. Men med realtid PCR är det en utmaning att hitta sanna kontroller som uttrycks lika i hela organismens livslängd. På grund av detta kommer resultatet vara relativ. En proteomik tillvägagångssätt är ett alternativ till vår teknik. Enskilda proteiner kan isoleras med hjälp av 2D-gelelektrofores och identifieras med masspektrometri.

Våra studier visar just att många medlemmar i Major spermier Protein (MSP) familj är induceras i VSM-1 mutant nematoder med ökad synaptisk densitet. MSPs är unika till C. elegans och ansvarar för äggcellen mognad och ägglossningen. Chai 1 har visat att regleringen av presynaptiska Bouton antal och storlek i den neuromuskulära förbindelsen i bananflugor sannolikt styrs av molekyler som innehåller stora domäner Spermiernas Protein. Studier av Tsuda och kollegor 2 har visat Major Spermier Protein domäner kan tjäna som ligander för Ephrine receptorer utlöser receptor tyrosinkinas signalering kaskader. Dessutom i realtid PCR-analys valideras och minskat ner microarray resultat till en medlem av MSP familjen, MSP-32. Sammantaget representerar arbetet presenteras här en genomet hela analys av en central neurovetenskap dilemma liksom kraften i grundutbildningen forskning i den vetenskapliga strävan.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

Detta arbete utfördes av studenter vid sydvästra Oklahoma State University, Weatherford OK. Detta arbete stöddes av NSF Rui-0963258, NIH OK-INBRE 2P20RR016478, GCAT och OCAST HR09-137S.

Den vsm1 (ok1468) mutant isolerades från Oklahoma Gene Knockout Consortium.
Författarna tackar Dan Stefanovic och Tanner Wheeler för deras värdefulla hjälp under projektets genomförande.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics