Выделение вирусной репликации отсек обогащенных субъядерных фракций из аденовируса-инфицированных клетках человека нормальный

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Аденовирусы содержат геном двухцепочечной ДНК, который воспроизводит в ядре зараженной клетки. Когда вирусная ДНК проникает в ядро, она локализуется рядом с ПМЛ ядерных тел 1. После вирусной экспрессии генов раннего, ядерная архитектура резко реорганизована, вызывая образование вирусных микросреды, называется вирусной репликации Отсеки (RC) 2. Так аденовирус (объявление) RC сайты, где репликации вирусного генома и экспрессия вирусных генов конце происходят, они обеспечивают среду для вербовки всех необходимых вирусных и клеточных факторов, участвующих в этих процессах. Интересно, что различные клеточные белки, ответственные за сотовой противовирусной реакции, такие как реакции повреждения ДНК, врожденного иммунного ответа и подавление опухоли кооптированы этих вирусных сайтов 2. Следовательно, Объявление RC можно считать нормативные концентраторы, которые способствуют эффективной репликации вируса в то время как одновременно, регулирующихсотовая противовирусный ответ, указывая, что эти структуры являются ключевыми для понимания взаимодействий вирус-клеток-хозяев. Тем не менее, молекулярные механизмы формирования RC, их состав и связанные с ними мероприятия, плохо понимал.

Аденовирусный RC, а также RC от других вирусов ДНК, которые реплицируются в ядре не связаны с мембранами, в отличие от цитоплазматического RC 3. Кроме того, эти вирус-индуцированные структуры, вероятно, будут полностью состоит из белков и нуклеиновых кислот. RC формируется в клетках, инфицированных РНК-содержащих вирусов (обычно называют вирусные фабрики) были выделены, пользуясь их цитоплазматической локализации и мембраной статуса, который способствовал их детальное морфологическое, функциональное и биохимических характеристик 4.

По нашим сведениям, ядерным вирусная RC не были выделены, возможно, из-за сложности ядерной архитектуры и отсутствии внутри- мembranes, которые будут способствовать их изоляции. Их исследование опирается вместо этого на иммунофлюоресценции микроскопии, рыбы и просвечивающей электронной микроскопии. Тем не менее, несмотря на осложнения, присущие изоляции субъядерных структуры, другие ядерные домены, такие как ядрышек и Cajal органов были выделены, прежде чем 5,6. Так ядрышек и RC оба состоят из белков и нуклеиновых кислот, и имеют диаметр от 0,5 до 5 мкм -, мы предположили, что RC также должны быть пригодны для изоляции. Поэтому, для того, чтобы более точно охарактеризовать молекулярный состав и функции, связанные с дистанционным управлением, мы установили новый способ, чтобы изолировать субъядерных Фракции, обогащенные с дистанционным. Для этого мы подготовили суб-ядерным фракции, используя градиенты скорости и сахарозы подушки, подобные процедуры, используемые, чтобы изолировать ядрышки 7 или другие ядерные домены 6 и создана система бесклеточной, что позволяет изучение молекулярного состава и связанные деятельностьRC. Таким образом, этот метод следует улучшить понимание взаимодействия вирус-хозяин клеток и представляет собой мощный инструмент, который также должно способствовать детальный анализ RC от других вирусов, которые воспроизводят в ядре и вызвать образование репликации отсеков подобных размеров, чтобы те, которые образуются в adenovirus- инфицированных-клетки, такие как, вирусы герпеса, папилломы или polyomaviruses.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF клеточной культуре и Ad-инфекции

  1. Propagate вирус Ad5 WT в монослоев клеток НЕК-293 и титра, люминесцентных единиц (ФФУ) по HFF клеток, как описано ранее 8.
  2. Выращивают фибробласты крайней плоти человека (HFF) в 10 мл DMEM / 10% фетальной бычьей сыворотки (FBS), в стерильной культуральной 100 мм чашках при 37 ° С и 5% СО 2 в увлажненном инкубаторе. Определить количество клеток с помощью камеры Neubauer в подсчетом клеток в четырех 16-квадратных наборов. Число клеток на мл получают путем вычисления среднего количества клеток в четырех 16-квадратных наборов и умножения этого числа на 10 4. Для каждого периода времени после инфекции, включенной в шаге 1.3, используют 1 х 10 7 клеток HFF.
  3. Макет Infect или заразить HFF клеток аденовируса типа 5 (Ad5) дикого типа (WT) (H5pg4100 8) в 100 мм чашках для тканевых культур с использованием 1 мл Ad5 в DMEM на чашку на МВД 30 Фокус формовочным блоком, или ФФУ , на ячейку. Выдержите в течение 2 часов в ахumidified клеточной культуры инкубатор при 37 ° С и 5% СО 2, тщательно качалки посуду каждые 15 мин, чтобы обеспечить равномерное распределение вируса инокулята над клетками. По истечении этого времени, удалить носитель и добавить свежий DMEM с добавлением 10% FBS и инкубировали в течение 16, 24 или 36 ч в увлажненной клеточной культуры инкубатор при 37? С и 5% СО 2. Перейдите к шагу 2.1.

2. Подготовка субъядерных фракций Обогащенный аденовируса RC

  1. Урожай Ad5-инфицированных или макет-инфицированных HFF клеток с клеточной скребка и сбора клеток в стерильных центрифужные пробирки. Определить количество клеток, как на стадии 1.2. Используйте 1 х 10 7 клеток для каждого времени после заражения, указанных в пункте 1.3.
  2. Центрифуга клетки при 220 мкг, 4 ° С в течение 5 мин.
  3. Ресуспендируют осадок клеток в ледяной PBS (137 мм NaCl, KCl 2,7 мм, 10 мМ Na 2 HPO 4 и 1,8 мм КН 2 РО 4). Вымойте осадок клетокс 3 раза с использованием 5 мл охлажденного льдом PBS на каждую промывку. С этой целью центрифуги клетки при 220 мкг, 4 ° С в течение 5 мин, после декантации и отбросить супернатант (SN), и ресуспендируют осадок клеток осторожно пипеткой.
  4. Чтобы разрушить клеточную мембрану, ресуспендируют осадок клеток в 700 мкл ледяного гипотонического буфера (10 мМ HEPES, рН 7,9, 10 мМ КСl, 1,5 мМ MgCl 2, 0,5 мМ ДТТ, 20 μ г / мл фенилметилсульфонилфторида (ФМСФ) , смесь цистеина, серина, треонина и аспартил-протеазы ингибиторов, включая 10 мкг / мл бычьего панкреатического трипсина, ингибитор 10 μ г / мл пепстатина А и 10 мкг / мл N-ацетил-L-лейцил-L-лейцил-L -argininal) и пусть клетки набухают на льду в течение 3 ч.
  5. Лизировать клетки с помощью гомогенизатора с рыхлой облегающие A Тип тефлоновым пестиком. Выполните 80 Dounce инсультов и образцов монитора каждые 20 ударов по ярким микроскопии обеспечить, чтобы все клетки были лизированы, но ядра имеют нOT были повреждены или разорваны.
  6. Центрифуга клеточного гомогената при 300 х г, 4 ° С в течение 5 мин. Хранить SN как цитоплазматической фракции при -20 ° С в центрифужную пробирку.
  7. Для удаления остатков клеток от ядер, ресуспендируют осадок в 750 μ л раствора 1 (S1) (0,25 М сахарозы, 10 мМ MgCl 2 20 мкг / мл PMSF, смесь цистеин, серин, треонин и аспартил-протеазы ингибиторов в том числе 10 μ г / мл бычьего панкреатического ингибитора трипсина, 10 μ г / мл пепстатина А и 10 μ г / мл N-ацетил-L-лейцил-L-лейцил-L-argininal) и слой над равный объем раствора 2 (S2) (0,35 М сахарозы, 0,5 мМ MgCl 2, 20 μ г / мл ФМСФ, смесь цистеин, серин, треонин и аспартил-протеазы ингибиторов, включая 10 μ г / мл бычьего панкреатического ингибитора трипсина, 10 μ г / мл пепстатина А и 10 мкм г / мл N-ацетил-L-лейцил-L-лейцил-L-argininal). Центрifuge в 1400 мкг, 4 ° С в течение 5 мин.
  8. Откажитесь от SN, используя микропипетку. Избегайте нарушая гранул.
  9. Ресуспендируют осадок, содержащий изолированные ядра в 750 μ л S2.
  10. Чтобы изолировать субъядерных фракции, обогащенные аденовируса RC (RCF), ультразвук ресуспендировали ядра с ультразвуковой ванне, с помощью двух импульсов 5 мин, или до тех пор, пока все ядра лизируют как это наблюдается ярко микроскопии. Использование льда в ультразвуковой ванне в случае необходимости, чтобы сохранить образцы на уровне или ниже 4 ° С.
  11. Слой ультразвуком в течение ядра равным объемом раствора 3 (S3) (0,88 М сахарозы, 0,5 мМ MgCl 2) и центрифугируют при 3000 х г, 4 ° С в течение 10 мин. Храните супернатант 1,5 мл в качестве нуклеоплазме фракции (NPL) при -70 ° C. Ресуспендируют осадок в 700 μ л S2 и магазин как RCF при -70 ° С.

3. вестерн-блот анализ РШФ

ПРИМЕЧАНИЕ: Для вестерн-блот анализа NPL и RCF фракций сET сторону 640 мкл для NPL и 300 μ л для RCF от общего объема, полученного на стадии 2.11.

  1. Смешайте 15 μ л каждого субъядерной фракции в буфере Лэммли 2x (4% SDS, 20% глицерина, 10% 2-меркаптоэтанола, 0,004% бромфеноловый синий, 0,125 М трис-HCl рН 6,8) и варить при 95 ° С в течение 5 мин. Загрузка образцов в электрофореза в 10% додецилсульфата натрия-полиакриламидном геле (SDS-PAGE) денатурирующем геле и отдельные белки в течение 1,5 ч, при 20 мА (мА).
  2. Передача белков проводили электроблоттинг в течение 1,5 ч при 400 мА на поливинилиденфторид (ПВДФ) мембраны.
  3. Блок мембраны в течение 2 ч при комнатной температуре с помощью 3% Обезжиренное сухое молоко в PBS.
  4. Инкубируйте O / N при 4 ° С с первичным антителом против вирусной ДНК E2A-связывающего белка (B6-8) в 9 в разведении 1: 500 в PBS / 0,3% обезжиренного сухого молока.
  5. Промыть 3 раза мембраны с PBS / 0,1% Твин 20 в течение 10 мин.
  6. Выдержите мембрану мыши анти IgG вторичного апtibody соединен с пероксидазой хрена (HRP) в разведении 1: 10000 в PBS в течение 2 ч при комнатной температуре.
  7. Промыть мембраны 3 раза ЗФР / 0,1% Твин 20 в течение 10 мин.
  8. Разработка мембраны, используя усиленной хемилюминесценции и рентгеновские снимки.

4. Вирусный Обнаружение ДНК в RCF

ПРИМЕЧАНИЕ: Для выделения ДНК из обоих NPL и RCF фракций, используйте 210 μ л для NPL и 100 μ л для RCF от общего объема, полученного на стадии 2.11.

  1. Инкубируйте субъядерных фракций в течение 1 ч при 55 ° С с 1 мг / мл протеиназы К и 0,5% Tween 20.
  2. Деактивировать протеиназы К путем инкубации образцов в течение 10 мин при 95 ° С.
  3. Центрифуга образцов при 20000 х г, при комнатной температуре в течение 2 мин.
  4. Соберите SN. Осадок ДНК с 1/10 объема 3 М ацетата натрия и один объем изопропанола, O / N при 4 ° С.
  5. Центрифуга образцов при 20000 х г, при комнатной температуре в течение 10 мин.
  6. Откажитесь от U SNпеть микропипетку. Промыть гранулу с 70% этанола и центрифугируют при 20000 х г, 4 ° С в течение 5 мин.
  7. Ресуспендируют ДНК в 10 μ л 10 мМ Трис-HCl, рН 7,4
  8. Количественно ДНК с помощью спектрофотометра путем измерения оптической плотности (ОП) при 260 нм.
  9. Для усиления вирусной ДНК, используют 100 нг ДНК из каждого субъядерной фракции в стандартной реакции ПЦР с использованием полимеразы Taq ДНК-в 25 μ л реакционного объема с использованием праймеров, которые позволяют амплификацию области в рамках основных блока поздний транскрипции, от нуклеотида 7273 до нуклеотид 7353 (81 б.п.) (Fw: GAGCGAGGTGTGGGTGAGC; Откр: GGATGCGACGACACTGACTTCA). Используйте следующие условия цикла: первоначальной денатурации в течение 3 мин при 95 ° С, затем 20 циклов амплификации (1 мин при 95 ° С, отжиг в течение 1 мин при 62 ° С и расширением в течение 30 сек при 72 ° С) и конечная стадия удлинения для 3 мин при 72 ° С.
  10. Запустите продукт ПЦР в 2% агарозном геле, в 90 В. красителей этидияметила на 0,5 μ г / мл конечная концентрация и визуализировать ДНК, чтобы подтвердить обогащение вирусной ДНК в RCF. Ручка бромид этидия с особой осторожностью и всегда убедитесь, что носить перчатки, так как это соединение является мощным мутагенным. Утилизировать этидия бромид соответствии с установленными руководящими принципами.

5. В конце вирусной мРНК обнаружения в RCF

ПРИМЕЧАНИЕ: Для выделения РНК из обеих NPL и RCF фракций, используйте 640 μ л для NPL и 300 μ л для RCF от общего объема, полученного на стадии 2.11.

  1. Изолировать РНК из субатомных фракций с помощью Trizol по инструкции завода-изготовителя. Ресуспендируют РНК в 50 μ л DEPC (diethilpyrocarbonate) -обработанной воды.
  2. Количественная РНК с использованием спектрофотометра для измерения оптической плотности при 260 нм (приблизительно 3 г μ получены). Храните РНК в 50 нг / мкл аликвоты при -70 ° С.
  3. Проверьте очищенной РНКна отсутствие загрязнения ДНК путем выполнения управления ПЦР в отсутствие обратной транскриптазы (RT), с использованием 5 нг общей РНК и условия цикла, описанного в пункте 4.9.
    1. Если загрязнение ДНК отсутствует нет ампликона не должно быть произведено. Если загрязнение ДНК присутствует, инкубировать образцы с 10 U ДНКазы I, 10 ед ингибитора РНКазы из, 0,1 М Трис-HCl рН 8,3, 0,5 М KCl и 15 мМ MgCl 2 в течение 30 мин при 37 ° С. Продолжать повторно выделения РНК, как на стадии 5.1.
  4. Для анализа вирусной мРНК, связанную с RCF, усиливать 100 нг РНК из каждой фракции субъядерной ОТ-ПЦР с использованием праймеров, сконструированных для обнаружения аденовируса конце мРНК из различных семейств генов (таблица 1).
    1. Для обратной транскрипции (RT), используют 100 нг РНК, из каждой фракции субъядерной в стандартной реакции RT с помощью М-MuLV RT фермент в 20 μ л реакционного объема в течение 1 ч при 42 ° С и 10 мин при 70 ° С.
    2. Для усиления, используйте 1μ л кДНК в реакции ПЦР, как в шаге 4.9. Используйте следующие условия цикла: первоначальной денатурации в течение 3 мин при 95 ° С, затем 25 циклов амплификации (1 мин при 95 ° С, отжиг в течение 1 минуты при температуре, указанной в таблице 1 и на расширение в течение 30 сек при 72 ° С) и Заключительный этап расширения в течение 3 мин при 72 ° С.
  5. Запуск продукты-ПЦР в 2% агарозном геле при 90 В. Stain гелей с бромистым этидием при 0,5 μ г / мл конечной концентрации и визуализации для подтверждения вирусной мРНК в конце ассоциации с RCF. Ручка бромид этидия, как указано в шаге 4.10.

6. Иммунофлуоресценции Визуализация RCF

ПРИМЕЧАНИЕ: Carry-эту процедуру под шкафом ламинарного потока, чтобы избежать загрязнения образцов с любыми частицами пыли, и фильтровать все решения перед использованием.

  1. Пятно 5 мкл фракции RCF, полученного на стадии 2.10 тяжелымctly на силана покрытием слайда.
  2. Пусть пятна высохнуть в течение приблизительно 5 мин при комнатной температуре.
  3. Re-гидрата, медленно и косвенно пипетки 500 мкл PBS в капле рядом месте RCF и позволяя ей течь, наклоняя телефон. Слить лишнюю PBS со стороны.
  4. Блок путем покрытия образца с 500 μ л PBS / 5% альбумина бычьей сыворотки (BSA) в течение 2 ч при комнатной температуре.
  5. Вымойте слайд 3 раза осторожно и косвенно пипетки 500 мкл PBS на образец. Наклоните слайд слить лишнюю PBS.
  6. Инкубируйте образца с первичными антителами против вирусных E2A ДНК-связывающего белка (B6-8) в 9 в разведении 1: 500 в PBS в течение 2 ч при комнатной температуре. Накройте пятнистый образец с 20 μ л раствора антител и инкубировать во влажной камере, чтобы избежать высыхания.
  7. Промыть образец 3 раза ФБР / 0,02% Твин-20, осторожно пипеткой и косвенно 500 μ л PBS на образец. Наклоните слайд стечь эксналог промывочного раствора.
  8. Инкубируйте образцы с мышиного антитела IgG вторичного антитела, соединенного с флуорофором, который возбуждается при 488 нм при разведении 1: 2000 в PBS, в течение 1 часа при 4 ° С. Накройте пятнистый образец с 20 μ л раствора антител и инкубировать во влажной камере, чтобы избежать высыхания.
  9. Промыть образец 3 раза ФБР / 0,02% Твин-20, осторожно пипеткой и косвенно 500 μ л PBS на образец. Наклоните слайд слить лишнюю промывочного раствора.
  10. Накройте пятнистый образец на слайде с помощью покровного стекла 2 μ л PBS / 10% глицерина в качестве крепления среду. Печать с ясно лак для ногтей и магазина аль -20 ºC.
  11. Анализ образцов с использованием флуоресцентного микроскопа, с целью 63x и 1,4 числовая апертура, (Na) на длине волны 488 нм.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Так вирусные отсеки репликации (RC) являются субъядерных вирусные индуцированной структуры, состоящие из белков и нуклеиновых кислот, подобных других ядерных областей, они оказались пригодны для изоляции от градиентов скорости на основе биохимических особенностей. Критические шаги в протоколе фракционирования представлены на рисунке 1. На каждом шаге образцы должны быть проверены ярко микроскопии для обеспечения целостности различных субклеточных фракций. Например, когда отек клеток, время инкубации в гипотонического буфера должен быть стандартизирован, чтобы набухать в цитоплазму избежать повреждения ядер. После гомогенизации клеток, целые ядра, свободной от цитоплазматических компонентов, включая эндоплазматического ретикулума мембраны, должны быть получены. Кроме того, время обработки ультразвуком должен быть стандартизирован для того, чтобы привести к разрыву ядерную мембрану всех ячеек, не нарушая RC.

После получения суб-ядерным фракции, ключконтроля должны быть включены, чтобы определить связь и обогащение добросовестных RC маркеров в RCF. Аденовирусный RC обычно визуализируется в инфицированных клетках с помощью иммунофлуоресценции с использованием антител против вируса E2A-72K белка (DBP). ДАД является вирусным белком, который непосредственно участвует в репликации вирусного генома; Поэтому, наличие ДАД в частицах, обогащенный RCF демонстрирует прямую связь этого вирусного белка с выделенными частицами, как показано на рисунке 1. Кроме того, обнаружение ДАД в RCF помощью Вестерн-блоттинга подтверждает связь этого белка с изолированной RC. На рисунке 2 показано, что в конце времени после инфицирования (36 HPI), ДАД обогащен RCF сравнению с нуклеоплазме фракции (NPL), демонстрируя, что RC получены с помощью этой процедуры в разные моменты времени после инфицирования отражает ожидаемых временных модель DBP ассоциации с RC. Существенным вирусный компонент RC является вирусная ДНК ИЦЭнизкая частота В экспериментах, как показано на рисунке 3 показано, что увеличение количества вирусных ДНК ассоциированной с RCF также цикл репликации вируса прогрессирует, указывая, что, как и для ДАД, временной образец репликации ДНК в этих фракций может быть также изучены.

Кроме того, содержащий вирусные белки и вирусного генома, RC также сайты вирусного выражения поздно генов. На рисунке 4 мы представляем репрезентативные результаты экспериментов, предназначенных для измерения ОТ-ПЦР уровень различных видов вирусного конце мРНК и их сегрегации между RCF и NPL в 36 HPI. Вирусные конце мРНК синтезируются в RC и их обработка postranscriptional инициирует в этих местах; Позже эти вирусные мРНК отмежеваться от RC, будут освобождены в нуклеоплазме, и впоследствии экспортируется в цитоплазму. Общая бассейн зрелых вирусных мРНК конце (ML мРНК) измеряли с использованием праймеров, которые усиливают экзон переход трехстороннего лидер,Последовательность, которая составляет 5 'всех аденовирусный поздний мРНК (фиг.4А). Экзон переходы в мРНК конкретных зрелых транскриптов L2, L4 и L5 семьи также были измерены. Было установлено, что по мере развития поздней стадии вирусной репликации цикла, увеличение количества вирусных конце мРНК экспортируются в цитоплазму; Однако, в конце раз производство видов мРНК L5 дальнейшем увеличении по сравнению с другими семействами в конце мРНК. В представительных результатов посевных на рисунке 4 приближенно 2,5 раза разница в ML мРНК наблюдается в NPL сравнению с RCF, как и ожидалось. Интересно, если мы сравним мРНК из конкретных семей, и L2 и L4 мРНК-видимому, распространяется в том же уровне между двумя субъядерных фракций (фиг.4В и C, соответственно), тогда как в противоположность этому, L5 мРНК показала почти 2-кратное увеличение NPL по сравнению с RCF. Эти результаты позволяют предположить, дифференциальный шаблон в SY nthesis и освобождение различных вирусных видов поздно мРНК из аденовирусной RC (как было предложено до 10). Примечательно, что эти результаты также показывают, что точные измерения различных этапов в биогенеза вирусной мРНК может быть выполнена с использованием изолированного RC с этой процедурой роман.

фигура 1
Рисунок 1. Яркий поле микроскопия разных этапах во время процедуры фракционирования. Во время изоляции RC, образцы должны быть проверены с помощью оптического микроскопа, чтобы обеспечить целостность субклеточных фракций. На рисунке показаны действия, используемые в процедуре, чтобы получить RCF, от набухания HFF клеток, к разделению ядер и изоляции RCF через сахарозы подушки. 40x микрофотографии: шкала бар 50 μ м; 63x микрофотографии: шкала бар 5 μ м; ДАД отображается зеленым цветом.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "целевых =" _blank "> Нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 2
Рисунок 2. Вестерн-блот против ДАД. Образцы анализируют с помощью SDS-PAGE и обрабатывали для вестерн-блоттинга с DBP, истинного маркера вирусной RC. Для определения обогащение белка в RCF, полезно сравнить наличие и относительное содержание DBP в обоих RCF и NPL в различные моменты времени после инфицирования. В HFF клеток 16 HPI представляет собой раннюю время в течение аденовирусной цикла репликации; 24 HPI знаменует переход к поздней стадии инфекции, вирусный начинается синтез ДНК; 36 HPI представляет собой позднего времени после инфицирования. Ожидаемый молекулярная масса ДАД показано. Пожалуйста, сделайте кликК здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 3
Рисунок 3. ПЦР для обнаружения вирусной ДНК (vDNA) в RCF. ДНК очищали от RCF и NPL в 24 и 36 HPI. Вирусную ДНК амплифицировали с использованием праймеров, специфичных для генома вируса с помощью ПЦР. График показывает обогащение вирусной ДНК в RCF в 36 HPI. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 4
.. Рисунок 4. Анализ вирусной мРНК позднего РНК была выделена из RCF и NPL и анализировали с помощью ОТ-ПЦР для обнаружения специфических вирусных мРНК конце (A) Всего Вирусный В конце мРНК (ML: главный поздний), (б) мРНК из L2 Семейный; (С) мРНК из L4 семьи; (D) мРНК из L5 семьи. Значения представляют собой среднее ± стандартное отклонение трех образцов. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

имя Форвард последовательность праймера (5'-3 ') Обратный последовательность праймера (5'-3 ') Температура отжига
ML мРНК GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ° С
L2 мРНК GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ° С
L4 мРНК CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ° С
L5 мРНК GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ° С

. Таблица 1. Праймеры, используемые для вирусных мРНК конце Amplification ML мРНК: эти праймеры позволяют амплификацию региона в трехсторонней вождя, "последовательность 5, что является общим для всех вирусных мРНК конце; L2 мРНК праймеры позволяют усиление конкретного региона в ФВ мРНК; L4 мРНК праймеры позволяют усиление конкретного региона в 100 K мРНК; L5 мРНК позволяет амплификации области в волокне мРНК. Температуры последовательность и отжига для каждого чопорнаяэ показаны.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics