בידוד של שברים תת-גרעיניים מועשרים-תא ויראלי שכפול מתאים נורמלים אדם נגוע Adenovirus

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenoviruses מכיל הגנום גדילי דנ"א כפול שמשכפל בגרעין התא הנגוע. כאשר ה- DNA הנגיפי נכנס לגרעין, זה localizes סמוך לגופים גרעיניים PML 1. בעקבות ביטוי גנים נגיפי מוקדם, הארכיטקטורה הגרעינית היא מחדש באופן דרמטי, וישכנע היווצרות של מייקרו-סביבות נגיפיות, המכונה תאים לנגיפיים שכפול (RC) 2. מאז אדנווירוס RC (מודעות) הם אתרים שבם שכפול הגנום נגיפי וביטוי של גנים נגיפיים מאוחר יתקיימו, הם מספקים סביבה לגיוס של כל הגורמים הנגיפיים וסלולריים הצורך המשתתפים בתהליכים אלה. מעניין, מגוון רחב של חלבונים תאיים אחראים לתגובה אנטי הסלולרית, כגון תגובת הנזק לדנ"א, התגובה החיסונית המולדת ודיכוי גידול הם לאתרים הנגיפיים אלה 2 נבחרים. רכזות רגולציה מכאן, יכול להיחשב מודעות RC המקדמות שכפול נגיפי יעיל תוך הסדרה במקבילתגובה תאית אנטי, מצביעה על כך שהמבנים אלה הם מפתח להבנת אינטראקציות תא-מארח וירוס. עם זאת, המנגנונים המולקולריים של היווצרות RC, הרכבם והפעילויות נלוות הם הבינו היטב.

Adenoviral RC, כמו גם RC מוירוסים DNA אחרים שלשכפל בגרעין אינם קשור לקרומים, בניגוד לRC cytoplasmic 3. יתר על כן, מבנים מושרה וירוס אלה עשויים להיות מורכבים כולו מחלבונים וחומצות גרעין. RC נוצר בתאים נגועים בווירוסי RNA (בדרך כלל מכונה מפעלים נגיפיים) היה מבודד, מנצל הלוקליזציה שלהם cytoplasmic ומעמד קרום הנכנס, אשר הקלה המורפולוגיות מפורטות שלהם, אפיון פונקציונלי ויוכימיים 4.

למיטב ידיעתנו, RC הנגיפי גרעיני לא היה מבודד, אולי בשל המורכבות של הארכיטקטורה והיעדר הגרעיניים של מטר intranuclearembranes שיאפשר בידודם. מחקרם הסתמך במקום על מיקרוסקופיה immunofluorescence, דגים ומיקרוסקופים אלקטרונים הילוכים. עם זאת, למרות סיבוכים הגלומים לבידוד מבני subnuclear, תחומים גרעיניים אחרים כגון nucleoli וגופים קחל היו מבודדים לפני 5,6. מאז nucleoli וRC שניהם מורכבים מחלבונים וחומצות גרעין, ויש קוטר בין 0.5-5 מיקרומטר, שערנו כי RC צריך להיות גם נוח לבידוד. לכן, על מנת לאפיין את ההרכב המולקולרי ופונקציות הקשורות לRC מדויק יותר, הקמנו שיטה חדשה לבודד את השברים subnuclear מועשרים בRC. לשם כך, אנחנו מוכנים שברים תת-גרעיני באמצעות הדרגתיים מהירות וכריות סוכרוז דומה לנהלים המשמשים לבודד nucleoli 7 או תחומים גרעיניים אחרים 6 והקמנו מערכת תא ללא שמאפשרת הלימוד של ההרכב המולקולרי ופעילויות הקשורות לRC. טכניקה זו ולכן צריכה לקדם את ההבנה של אינטראקציות תא-מארח וירוס ומהווה כלי רב עוצמה שצריכה גם להקל על הניתוח מפורט של RC מוירוסים אחרים שלשכפל בגרעין ולגרום להיווצרות של תאי שכפול של ממדים דומים לאלה שנוצרו בadenovirus- נגועים בתאים, כגון, herpesviruses, papillomaviruses או polyomaviruses.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

תרבית תאי 1. HFF ומודעות-זיהום

  1. הפץ וירוס Ad5 WT בmonolayers של HEK-293 תאים וכיילו כיחידות ניאון יוצרים (FFU) בתאי HFF כפי שתואר לעיל 8.
  2. לגדול fibroblasts העורלה האדם (HFF) ב 10 מיליליטר של DMEM 10% שור עוברי סרום (FBS) במנות מ"מ סטרילי תרבות 100 על 37 מעלות צלזיוס, 5% CO / 2 בחממה humidified. לקבוע את המספר הסלולרי באמצעות תא נויבאואר על ידי ספירת תאים בארבעת סטים של 16 מ"ר. מספר התאים למ"ל מתקבל על ידי חישוב מספר התאים הממוצע בארבעת סטים של 16 מ"ר והכפלת מספר זה ב -10 4. עבור כל זיהום שלאחר זמן הכלול בשלב 1.3, להשתמש 1 x 10 7 תאי HFF.
  3. מוק להדביק או להדביק תאי HFF עם סוג אדנווירוס 5 (Ad5) wild-type (WT) (H5pg4100 8) במנות בתרבית רקמת 100 מ"מ באמצעות 1 מיליליטר של Ad5 בDMEM לכל צלחת במשרד פנים של 30 פוקוס יצירת יחידה, או FFU , לכל תא. דגירה עבור שעה 2 באהחממת umidified תרבית תאים על 37 מעלות צלזיוס, 5% CO 2, נדנדה בזהירות את המנות בכל 15 דקות על מנת להבטיח הפצה הומוגנית של הבידוד הווירוס על התאים. לאחר פרק זמן זה, להסיר את המדיום ולהוסיף DMEM הטרי בתוספת 10% FBS ו דגירה של 16, 24 או 36 שעות בתרבית תאי חממת humidified על 37 מעלות צלזיוס, 5% CO 2. המשך לשלב 2.1.

2. הכנת שברים תת-גרעיניים מועשר בAdenovirus RC

  1. נגוע Ad5 הקציר או תאי HFF נגועים מדומים עם scrapper תא ולאסוף את התאים בצינורות צנטריפוגות סטרילי. לקבוע את המספר הסלולרי כמו בשלב 1.2. להשתמש 1 x 10 7 תאים לכל זיהום שלאחר זמן מסוים בשלב 1.3.
  2. צנטריפוגה התאים ב 220 XG, 4 מעלות צלזיוס למשך 5 דקות.
  3. Resuspend התא גלולה בPBS קר כקרח (137 מ"מ NaCl, 2.7 מ"מ KCl, 10 מ"מ Na 2 4 HPO ו -1.8 מ"מ KH 2 PO 4). תא גלולה לשטוףשל 3 פעמים באמצעות 5 מיליליטר של PBS קר כקרח לכל לשטוף. לצורך כך, צנטריפוגה התאים ב 220 XG, 4 מעלות צלזיוס למשך 5 דקות, למזוג וזורקים supernatant (SN), וresuspend התא גלולה על ידי pipetting העדין.
  4. לשבש את קרום הפלזמה, resuspend התא גלולה ב700 μ l של חיץ hypotonic קר כקרח (10 מ"מ HEPES pH 7.9, 10 מ"מ KCl, 1.5 מ"מ MgCl 2, 0.5 מ"מ DTT, 20 μ g / ml phenylmethylsulfonyl פלואוריד (PMSF) , תערובת של ציסטאין, סרין, תראונין מעכבי פרוטאז וaspartyl כולל 10 גרם / מיליליטר מעכבי טריפסין לבלב שור, 10 גר '/ מיליליטר pepstatin μ μ ו -10 גר' / מיליליטר -acetyl-L-leucyl-L-leucyl-L N μ -argininal) ולתת לתאים להתנפח על קרח 3 שעות.
  5. Lyse התאים באמצעות homogenizer עם העלי טפלון סוג רפוי. בצע 80 dounce שבץ ודגימות צג כל 20 משיכות על ידי מיקרוסקופ שדה הבהיר כדי להבטיח שכל התאים כבר lysed, אבל שיש לי הגרעינים nםוריה נפגע או מקרע.
  6. צנטריפוגה homogenate התא ב 300 XG, 4 מעלות צלזיוס למשך 5 דקות. אחסן את SN כחלק cytoplasmic ב -20 מעלות צלזיוס בצינור צנטריפוגות.
  7. כדי להסיר סלולרית פסולת מגרעינים, resuspend גלולה ב750 μ l של פתרון 1 (S1) (0.25 מ 'סוכרוז, 10 מ"מ MgCl 2 20 μ g מעכבים / מיליליטר PMSF, תערובת של ציסטאין, סרין, תראונין ופרוטאז aspartyl כולל 10 μ g / ml מעכב שור לבלב טריפסין, 10 μ g מיליליטר pepstatin / 10 וμ g / ml N -acetyl-L-leucyl-L-leucyl-L-argininal) ושכבה מעל נפח שווה של פתרון 2 (S2) (0.35 מ 'סוכרוז, 0.5 מ"מ MgCl 2, 20 μ g / ml PMSF, תערובת של ציסטאין, סרין, תראונין מעכבי פרוטאז וaspartyl כוללים 10 μ g / מיליליטר מעכבי טריפסין לבלב שור, 10 μ g / ml pepstatin ו -10 μ g / ml N -acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge ב1,400 XG, 4 מעלות צלזיוס למשך 5 דקות.
  8. מחק את SN באמצעות micropipette. הימנע להפריע גלולה.
  9. Resuspend גלולה המכילה גרעינים מבודדים ב750 μ l של S2.
  10. כדי לבודד שברים subnuclear מועשרים באדנווירוס RC (RCF), sonicate resuspended גרעינים עם אמבטיה קולית, באמצעות שתי פעימות 5 דקות, או עד שכל הגרעינים lysed כפי שנצפו על ידי מיקרוסקופ שדה הבהיר. השתמש בקרח באמבטיה קולית לפי צורך כדי לשמור על דגימות באו מתחת ל -4 מעלות צלזיוס.
  11. שכבת גרעיני sonicated על נפח שווה של פתרון 3 (S3) (0.88 M סוכרוז, 0.5 מ"מ MgCl 2) ו צנטריפוגות ב3,000 XG, 4 מעלות צלזיוס במשך 10 דקות. אחסן את supernatant 1.5 מיליליטר כחלק nucleoplasmic (NPL) ב -70 מעלות צלזיוס. Resuspend גלולה ב700 μ l של S2 וחנות כRCF ב -70 מעלות צלזיוס.

3. ניתוח המערבי כתם של RCF

הערה: לניתוח המערבי כתם של שברים של NPL וRCFet הצידה 640 μ l לNPL ו -300 μ l לRCF מהנפח הכולל שהושג בשלב 2.11.

  1. מערבבים 15 μ l של כל חלק subnuclear ב2x Laemmli חיץ (4% SDS, גליצרול 20%, 10% 2-mercaptoethanol, bromophenol 0.004% כחולים, 0.125 M טריס HCl pH 6.8) ורתיחה ב 95 מעלות צלזיוס למשך 5 דקות. טען את הדגימות באלקטרופורזה נתרן 10% dodecyl סולפט-polyacrylamide ג'ל (SDS-PAGE) denaturing ג'ל וחלבונים נפרדים עבור 1.5 שעות, בטמפרטורה של 20 milliamperes (MA).
  2. העבר את החלבונים על ידי electroblotting תמורת 1.5 שעות ב 400 מילי-אמפר על difluoride polyvinylidene ממברנות (PVDF).
  3. לחסום קרום לשעה 2 ב RT באמצעות חלב יבש ללא שומן 3% ב- PBS.
  4. דגירה O / N במעלות צלזיוס 4 עם נוגדן ראשוני נגד חלבון נגיפי E2A מחייב DNA (B6-8 9) בדילול 1: 500 בחלב ללא שומן יבש / 0.3% PBS.
  5. קרום לשטוף 3 פעמים עם PBS / 0.1% Tween 20 במשך 10 דקות.
  6. דגירה הממברנה עם IgG נגד עכבר המשניtibody מצמידים peroxidase סוס-צנון (HRP) בדילול 1: 10,000 ב PBS עבור שעה 2 ב RT.
  7. שטוף את הקרום 3 פעמים עם PBS / 0.1% Tween 20 במשך 10 דקות.
  8. לפתח הקרום באמצעות chemiluminescence משופרת וצילומי רנטגן.

4. ויראלי DNA איתור בRCF

הערה: לבידוד DNA משני השברים NPL וRCF, להשתמש 210 μ l לNPL וμ 100 ליטר לRCF מהנפח הכולל שהושג בשלב 2.11.

  1. דגירה שברים תת-גרעיניים עבור שעה 1 ב 55 מעלות צלזיוס עם 1 מ"ג / מיליליטר של proteinase K ו 0.5% Tween 20.
  2. להשבית K proteinase ידי דוגרים הדגימות במשך 10 דקות על 95 מעלות צלזיוס.
  3. צנטריפוגה דגימות ב20,000 XG, ב RT למשך 2 דקות.
  4. לאסוף SN. להאיץ את ה- DNA עם 1/10 נפח של נתרן אצטט 3M ונפח אחד של isopropanol, O / N ב 4 מעלות צלזיוס.
  5. צנטריפוגה דגימות ב20,000 XG, ב RT במשך 10 דקות.
  6. מחק את u SNלשיר micropipette. שטוף את הכדור עם 70% אתנול ו צנטריפוגות ב 20,000 XG, 4 מעלות צלזיוס למשך 5 דקות.
  7. Resuspend DNA ב 10 μ l 10 מ"מ טריס-HCl pH 7.4
  8. לכמת DNA באמצעות ספקטרופוטומטר על ידי מדידת הצפיפות האופטית (OD) ב 260 ננומטר.
  9. כדי להגביר DNA הנגיפי, להשתמש של DNA 100 ng כל חלק מן subnuclear בתגובת PCR סטנדרטית באמצעות פולימראז תקי DNA ב -25 μ l של נפח תגובה עם פריימרים המאפשרים ההגברה של אזור בתוך יחידת השעתוק המאוחר סרן, מנוקלאוטיד 7273 ל נוקלאוטיד 7353 (81 נ"ב) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). השתמש בתנאים הבאים המחזור: denaturation הראשוני 3 דקות ב 95 מעלות צלזיוס, ואחריו 20 מחזורים של הגברה (1 דקות ב 95 מעלות צלזיוס, חישול 1 דקות במעלות צלזיוס 62 והארכה למשך 30 שניות על 72 מעלות צלזיוס) וצעד ארכה סופי ל 3 דקות ב 72 מעלות צלזיוס.
  10. הפעל את מוצר ה- PCR בג'ל agarose 2%, ב -90 V. כתם עם ethidiumרומיד ברמה של 0.5 μ / מיליליטר ריכוז סופי גרם ולדמיין DNA כדי לאשש העשרת ה- DNA נגיפית בRCF. ידית ברומיד בזהירות רבה ותמיד לוודא ללבוש כפפות, כמתחם הזה הוא mutagen חזק. השלך ברומיד על פי הנחיות מוסדיות.

5. ויראלי המאוחר mRNA איתור בRCF

הערה: לבידוד RNA משני השברים NPL וRCF, להשתמש 640 μ l לNPL ו -300 μ l לRCF מהנפח הכולל שהושג בשלב 2.11.

  1. לבודד RNA משברי subnuclear באמצעות Trizol פי עם הוראות היצרן. Resuspend RNA ב -50 μ l של DEPC מים -treated (diethilpyrocarbonate).
  2. לכמת את RNA באמצעות ספקטרופוטומטר למדוד את OD ב 260 ננומטר (ז כ 3 μ מתקבל). אחסן את RNA ב -50 ng / μ aliquots l ב -70 מעלות צלזיוס.
  3. בדוק RNA המטוהרעל היעדריו של זיהום הדנ"א על ​​ידי ביצוע תגובת PCR שליטה בהעדר טרנסקריפטאז (RT), באמצעות 5 ננוגרם של רנ"א הכל ותנאי המחזור מתואר בשלב 4.9.
    1. אם זיהום הדנ"א נעדר צריך להיות מיוצר לא amplicon. אם זיהום הדנ"א הוא הווה, דגירה הדגימות עם 10 U DNase אני, 10 U של מעכב RNase, 0.1 מ 'טריס-HCl pH 8.3, 0.5 M KCl ו -15 מ"מ MgCl 2 למשך 30 דקות ב 37 מעלות צלזיוס. המשך מחדש לבודד RNA כמו בשלב 5.1.
  4. כדי לנתח mRNA ויראלי הקשורים לRCF, להגביר של RNA 100 ng כל חלק מן subnuclear על ידי RT-PCR באמצעות פריימרים נועדו לזהות mRNA מאוחר adenoviral ממשפחות גנים שונים (טבלה 1).
    1. לשעתוק לאחור (RT), להשתמש של RNA 100 ng, מכל חלק subnuclear בתגובת RT סטנדרטי באמצעות אנזים M-MuLV RT 20 μ l של נפח תגובה עבור שעה 1 ב 42 מעלות צלזיוס ו -10 דקות ב -70 מעלות צלזיוס.
    2. להגברה, להשתמש 1l μ של cDNA בPCR תגובות, כמו בשלב 4.9. השתמש בתנאים הבאים המחזור: denaturation הראשוני 3 דקות ב 95 מעלות צלזיוס, ואחריו 25 מחזורים של הגברה (1 דקות ב 95 מעלות צלזיוס, חישול 1 דקות בטמפרטורה שצוינה בטבלה 1 והארכה למשך 30 שניות על 72 מעלות צלזיוס) ו צעד ארכה סופי 3 דקות ב 72 מעלות צלזיוס.
  5. הפעל את מוצרי RT-PCR בג'ל agarose 2%, ב 90 ג 'ו' כתם עם ברומיד ברמה של 0.5 μ / מיליליטר ריכוז סופי גרם ולדמיין לאשש עמותת mRNA מאוחר נגיפית לRCF. ידית ברומיד כפי שצוין בשלב 4.10.

6. ויזואליזציה Immunofluorescence של RCF

הערה: לעסוק בהליך זה תחת הזרימה למינרית כדי למנוע זיהום של הדגימות עם כל חלקיקי אבק, ולסנן את כל הפתרונות לפני השימוש.

  1. מקום 5 μ l של חלק RCF שהושג בשלב 2.10 חמוריםctly בשקופית מצופה silane.
  2. בואו יבש מקום לכ -5 דקות ב RT.
  3. Re-מימה ידי לאט ובעקיפין pipetting 500 ליטר μ של PBS בירידה ליד מקום RCF ולתת לה לזרום על ידי הטיית השקופיות. מסננים את PBS העודף מהצד.
  4. בלוק על ידי כיסוי המדגם עם 500 μ l של / 5% אלבומין בסרום שור PBS (BSA) לשעה 2 ב RT.
  5. לשטוף את השקופית 3 פעמים על ידי בעדינות ובעקיפין pipetting 500 ליטר μ של PBS על המדגם. הטה את השקופית כדי לנקז את PBS העודף.
  6. דגירה המדגם עם נוגדן ראשוני נגד החלבון הנגיפי E2A מחייב DNA (B6-8 9) בדילול 1: 500 ב PBS עבור שעה 2 ב RT. מכסה את המדגם הבחין עם 20 μ l של פתרון נוגדן דגירה בתא לח כדי למנוע התייבשות.
  7. לשטוף את המדגם 3 פעמים עם PBS Tween / 0.02% 20 על ידי בעדינות ובעקיפין pipetting 500 μ l של PBS על המדגם. הטה את השקופית כדי לנקז את לשעברפתרון לשטוף סס.
  8. דגירה הדגימות עם נוגדן אנטי עכבר IgG המשני מצמידים את fluorophore שהלהיב ב 488 ננומטר בדילול 1: 2,000 ב PBS, עבור שעה 1 ב 4 מעלות צלזיוס. מכסה את המדגם הבחין עם 20 μ l של פתרון נוגדן דגירה בתא לח כדי למנוע התייבשות.
  9. לשטוף את המדגם 3 פעמים עם PBS Tween / 0.02% 20 על ידי בעדינות ובעקיפין pipetting 500 μ l של PBS על המדגם. הטה את השקופית כדי לנקז את הפתרון לשטוף העודף.
  10. מכסה את המדגם הבחין בשקופית עם coverslip באמצעות 2 μ l גליצרול / 10% PBS כהרכבה בינונית. חותם עם לק ברור וחנות אל -20 מעלות צלזיוס.
  11. ניתוח הדגימות באמצעות מיקרוסקופ פלואורסצנטי, עם מטרת 63x ומספרי צמצם 1.4 (NA) באורך גל של 488 ננומטר.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

מאז תאים נגיפיים שכפול (RC) הם מבנים הנוצרים על-נגיפיים subnuclear המורכב מחלבונים וחומצות גרעין, בדומה לתחומים אחרים גרעיניים, הם הוכיחו שניתנים לבידוד על ידי מילויים מהירות המבוססים על תכונות ביוכימיות. צעדים קריטיים בפרוטוקול חלוקה הם באיור 1. בכל שלב הדגימות צריכים להיות במעקב על ידי מיקרוסקופ שדה הבהיר כדי להבטיח את השלמות של שברי משנה הסלולר השונים. לדוגמא, כאשר נפיחות התאים, זמן דגירה במאגר hypotonic צריך להיות אחיד כדי להתנפח ציטופלסמה הימנעות נזק לגרעינים. לאחר הומוגניזציה תא, גרעינים שלמים, ללא רכיבים cytoplasmic כוללים ממברנות reticulum endoplasmic, צריך לקבל. כמו כן, זמן sonication צריך להיות אחיד כדי לקרוע את קרום הגרעין של כל התאים מבלי לשבש RC.

לאחר קבלת השברים תת-גרעיניים, מפתחבקרות צריכה להיכלל כדי לקבוע את העמותה והעשרה של סמני RC בתום לב בRCF. Adenoviral RC הם דמיינו נפוצים בתאים נגועים על ידי immunofluorescence באמצעות נוגדנים נגד החלבון הנגיפי E2A-72K (DBP). DBP הוא חלבון נגיפי המשתתף ישירות בשכפול הגנום נגיפי; לכן, הנוכחות של DBP בחלקיקים המועשר בRCF מדגימה עמותה הישירה של חלבון נגיפי זה עם החלקיקים הבודדים, כפי שמוצגת באיור 1. יתר על כן, זיהוי של DBP בRCF ידי מערבי כתם מאשר את העמותה של חלבון זה לבודד RC. באיור 2 הוא הראה כי על ידי פעמים מאוחר לאחר זיהום (36 HPI), DBP מועשר בRCF לעומת חלק nucleoplasmic (NPL), הוכחה כי RC שהושג עם הליך זה בזמנים שונים לאחר ההדבקה משקפת צפויה זמנית דפוס של עמותת DBP לRC. מרכיב ויראלי חיוני של RC הוא itse DNA הנגיפיLF. בניסויים כמו שמוצגים באיור 3 אנו מראים כי כמויות גדלות והולכות של חבר ה- DNA הנגיפי עם RCF כמחזור השכפול של הנגיף מתקדם, המצביעים על כך, כפי שלDBP, הדפוס הזמני של שכפול הדנ"א שבברים אלה יכולים להיות גם למד.

חוץ מזה המכיל חלבונים נגיפיים והגנום הנגיפי, RC גם אתרים של ביטוי גנים נגיפי מאוחר. באיור 4 אנו מציגים תוצאות נציג של ניסויים שנועדו למדוד על ידי RT-PCR הרמה של מינים שונים של mRNA מאוחר הנגיפי וההפרדה ביניהם RCF וNPL ב 36 HPI. mRNA ויראלי מאוחר מסונתז בRC ועיבוד postranscriptional יוזם באתרים אלה; מאוחר יותר אלה mRNA ויראלי לנתק מRC, משוחררים לnucleoplasm, ולאחר מכן ייצא לציטופלסמה. הבריכה הכוללת של mRNA מאוחר הנגיפי הבוגר (ML mRNA) נמדדה באמצעות פריימרים שלהגביר צומת אקסון של המנהיג המשולש,רצף שמהווה 5 'של כל mRNA מאוחר adenoviral (איור 4 א). צמתים אקסון בmRNA של תמלילים בוגרים ספציפיים של L2, משפחות L4 וL5 נמדדו גם. זה כבר נקבע כי כשלב המאוחר של מחזור השכפול הנגיפי מתקדם, כמויות גדלות והולכות של mRNA מאוחר הנגיפי מיוצאות לציטופלסמה; עם זאת, על ידי ייצור פעמים המאוחר של מיני L5 mRNA מגביר עוד יותר בהשוואה למשפחות mRNA מאוחר האחרות. בתוצאות הנציג נזרעו באיור 4 הבדל כ 2.5 פי בML mRNA הוא ציין בNPL לעומת RCF, כצפוי. מעניין כאשר אנו משווים mRNA ממשפחות ספציפיות, מופיעים שני L2 וL4 mRNA להיות מופצים ברמות דומות בין שני השברים subnuclear (איור 4 ו- C, בהתאמה), ואילו בניגוד לכך, ה- mRNA L5 הראה עלייה כמעט פי 2 בNPL בהשוואה לRCF. תוצאות אלו מצביעות על תבנית ההפרש בסאים nthesis ושחרור של מיני mRNA מאוחר נגיפיים השונים מRC adenoviral (כפי שכבר הציע לפני 10). באופן משמעותי, תוצאות אלה גם מראים כי מדידות מדויקות של השלבים השונים בbiogenesis של mRNA ויראלי יכולות להתבצע באמצעות RC המבודד עם הליך הרומן הזה.

איור 1
איור 1. מואר שדה מיקרוסקופית של שלבים שונים במהלך הליך הפלזמה. במהלך הבידוד של RC, הדגימות צריכים להיות במעקב על ידי מיקרוסקופ אופטי כדי להבטיח את השלמות של שברי משנה הסלולר. איור מציג את השלבים המשמשים בהליך לקבלת RCF, מהנפיחות של תאי HFF, להפרדת גרעינים ובידוד של RCF באמצעות כריות סוכרוז. 40x micrographs: סרגל קנה מידה 50 μ מ '; 63x micrographs: סרגל קנה מידה 5 μ מ '; DBP מוצג בירוק.תב"ע: "target =" _ //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. מערבי כתם נגד DBP. הדגימות מנותחות על ידי SDS-PAGE ומעובד לכתם מערבי נגד DBP, סמן תום לב של RC ויראלי. כדי לקבוע את ההעשרה של החלבון בRCF, כדאי להשוות את הנוכחות ושפע יחסי של DBP בשני RCF וNPL בזמנים שונים לאחר הדבקה. בתאי HFF 16 HPI מייצג את הזמן מוקדם במהלך מחזור שכפול adenoviral; 24 HPI מסמן את המעבר לשלב המאוחר של זיהום כסינתזת ה- DNA נגיפי מתחילה; 36 HPI מייצג לאחר זיהום מאוחר זמן. המסה המולקולרית הצפויה של DBP מוצגת. אנא Click כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. PCR Assay לזיהוי נגיפי DNA (vDNA) בRCF. DNA היה מטוהר מRCF וNPL ב 24 ו -36 HPI. ה- DNA הנגיפי היה מוגבר על ידי PCR באמצעות פריימרים ספציפיים להגנום הנגיפי. הגרף מראה את ההעשרה של ה- DNA הנגיפי בRCF ב 36 HPI. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
.. איור 4. ניתוח של נגיפי RNA המאוחר mRNA היה מבודד מRCF וNPL ונותח על ידי RT-PCR לגילוי mRNA מאוחר נגיפי הספציפי () סה"כ ויראלי המאוחר mRNA (ML: רס"ן המאוחר); (ב) mRNA מL2 משפחה; (ג) mRNA ממשפחת L4; (ד) mRNA ממשפחת L5. ערכים מייצגים ממוצע ± סטיית תקן של דגימות בשלושה עותקים. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

שֵׁם רצף קדימה פריימר (5'-3 ") רצף הפוך פריימר (5'-3 ") טמפרטורת חישול
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 מעלות צלזיוס
L2 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 מעלות צלזיוס
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 מעלות צלזיוס
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 מעלות צלזיוס

. טבלת 1. Primers משמש לויראלי המאוחר mRNA הגברה ML mRNA: פריימרים אלה מאפשרים ההגברה של אזור בתוך המנהיג המשולש, הרצף 5 'שמשותף לכל mRNA מאוחר הנגיפי; פריימרים L2 mRNA מאפשרים ההגברה של אזור מסוים בתוך mRNA PV; פריימרים L4 mRNA מאפשרים ההגברה של אזור מסוים בתוך 100 K mRNA; L5 mRNA מאפשר ההגברה של אזור בתוך mRNA הסיבים. טמפרטורות הרצף וחישול עבור כל חסודאה מוצגים.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics