Isolamento de Frações Sub-nuclear Viral Replication Compartimento enriquecidas de Adenovirus-infectados células normais Humanos

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Os adenovírus contêm um genoma de ADN de cadeia dupla que replicam no núcleo da célula infectada. Quando o ADN virai entra no núcleo, que se localiza junto a PML corpos nucleares 1. Após expressão do gene precoce viral, a arquitetura nuclear é reorganizada de forma dramática, induzindo a formação de microambientes virais, denominado de Compartimentos replicação viral (RC) 2. Desde adenovirus (Ad) RC são os locais onde a replicação viral genoma e expressão de genes virais final têm lugar, eles fornecem um ambiente para o recrutamento de todos os fatores virais e celulares necessários que participam nestes processos. Curiosamente, uma variedade de proteínas celulares responsáveis ​​pela resposta antiviral celular, tais como a resposta a danos no ADN, a resposta imune inata e supressão tumoral são co-optou por esses sítios virais 2. Cubos reguladoras Assim, Ad RC pode ser considerado que promovem a replicação viral eficiente enquanto concomitantemente regulação doresposta antiviral celular, indicando que estas estruturas são fundamentais para a compreensão das interacções vírus-hospedeiro de células. No entanto, os mecanismos moleculares da formação de RC, a sua composição e as suas actividades são mal compreendidos.

RC adenoviral, bem como RC de outros vírus de ADN que se replicam no núcleo não estão associadas a membranas, em contraste com RC citoplasmática 3. Além disso, estas estruturas induzida por vírus são susceptíveis de ser inteiramente constituída por proteínas e ácidos nucleicos. RC formado nas células infectadas com os vírus de ARN (usualmente denominado fábricas virais) foram isolados, aproveitando a sua localização citoplásmica e ligada à membrana de estado, o que facilitou a sua morfológica detalhada, a caracterização funcional e bioquímica 4.

Para nosso conhecimento, RC viral nuclear não tenham sido isolados, talvez devido à complexidade da arquitectura nuclear e ausência de m intranuclearesembranes que facilitem o seu isolamento. O estudo se baseou em vez de microscopia de imunofluorescência, FISH e microscopia eletrônica de transmissão. No entanto, apesar de complicações inerentes a isolar estruturas subnucleares, outros domínios nucleares, tais como nucléolos e Corpos de Cajal foram isoladas antes de 5,6. Desde nucléolos e Rc são ambas compostas de proteínas e ácidos nucleicos, e tem um diâmetro entre 0,5 - 5 mm, a hipótese de que RC também devem ser passíveis de isolamento. Por conseguinte, a fim de caracterizar mais precisamente a composição molecular e funções associadas a RC, foi estabelecido um novo método para isolar fracções enriquecidas com subnucleares RC. Para este fim, preparado de fracções sub-nuclear utilizando gradientes de velocidade e almofadas de sucrose semelhantes aos procedimentos usados ​​para isolar nucléolos 7 ou outros domínios nucleares 6 e estabelecido um sistema isento de células, que permite o estudo da composição molecular e de actividades associadasRC. Essa técnica deve, portanto, fazer avançar a compreensão das interações celulares vírus-hospedeiro e representa uma ferramenta poderosa que devem também facilitar a análise detalhada de RC de outros vírus que se replicam no núcleo e induzir a formação de compartimentos de replicação de dimensões semelhantes às formada em adenovirus- As células infectadas, tais como, vírus do herpes, vírus de papiloma ou poliomavírus.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Cultura de Células e-infecção Anúncio

  1. Propagar o vírus Ad5 WT em monocamadas de células HEK-293 e título como unidades formadoras fluorescentes (UFF) em células HFF como anteriormente descrito 8.
  2. Cresça fibroblastos de prepúcio humano (HFF) em 10 ml de DMEM / 10% de Soro Fetal Bovino (FBS) em cultura estéreis placas de 100 mm a 37 ° C e 5% de CO2 num incubador humidificado. Determinar o número de células utilizando uma câmara de Neubauer por contagem de células nas quatro conjuntos de 16 quadrados. O número de células por mL é obtida através do cálculo da média do número de células nas quatro conjuntos de 16 quadrados e multiplicando este número por 10 4. Para cada tempo de pós-infecção incluídos na etapa 1.3, usar 1 x 10 7 células HFF.
  3. Mock-infectar ou infectar células HFF com adenovírus tipo 5 (Ad5) do tipo selvagem (WT) (H5pg4100 8) em 100 mm placas de cultura de tecido com 1 ml de Ad5 em DMEM por prato a uma MOI de 30 Foco Forming Unit, ou FFU , por célula. Incubar por 2 horas em ahumidified incubadora de cultura de células a 37 ° C e 5% de CO 2, de balanço cuidadosamente os pratos a cada 15 minutos para assegurar uma distribuição homogénea do inoculo de vírus sobre as células. Após este tempo, remover o meio e adicionar DMEM fresco suplementado com FBS a 10% e incuba-se durante 16, 24 ou 36 h numa incubadora de cultura de células humidificada a 37 ° C e 5% de CO 2. Prossiga para a etapa 2.1.

2. Preparação de fracções Sub-nuclear Enriquecido com Adenovírus RC

  1. Colheita Ad5-infectadas ou células HFF falsamente infectadas com um raspador celular e recolher as células em tubos de centrífuga estéreis. Determinar o número de células como no passo 1.2. Use 1 x 10 7 células para cada pós-infecção de tempo especificado no passo 1.3.
  2. Centrifugar as células a 220 xg, 4 ºC por 5 min.
  3. Ressuspender o sedimento celular em PBS arrefecido em gelo (NaCl 137 mM, KCl 2,7 mM, 10 mM de Na 2 HPO 4 1,8 mM e KH 2 PO 4). Lave o peletizado de célulass 3 vezes com 5 ml de PBS gelado por lavagem. Para este efeito, centrifugar as células a 220 xg, a 4 ° C durante 5 minutos, decantar e desprezar o sobrenadante (SN), e ressuspender o sedimento de células por pipetagem suave.
  4. Para romper a membrana de plasma, ressuspender o sedimento celular em 700 uL de tampão hipotónico gelado (HEPES 10 mM pH 7,9, KCl 10 mM, MgCl 1,5 mM, 2, 0,5 mM DTT, 20 μ g / ml de fluoreto de fenilmetilsulfonilo (PMSF) , uma mistura de cisteína, serina, treonina e inibidores da aspartil protease, incluindo 10 μ g / ml de inibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A e 10 μ g / ml de N-acetil-L-leucil-L-leucil-L- -argininal) e deixar que as células inchar em gelo durante 3 h.
  5. Lyse as células utilizando um homogeneizador com uma folgada Um pilão tipo teflon. Realize 80 dounce derrames e monitor de amostras a cada 20 golpes por microscopia de campo claro para assegurar que todas as células foram lisadas, mas que têm núcleos not sido danificado ou rompido.
  6. Centrifuga-se o homogeneizado de células a 300 xg, 4 ° C durante 5 min. Armazenar o SN como a fracção citoplasmática a -20 ° C em um tubo de centrífuga.
  7. Para remover os detritos celulares a partir de núcleos, ressuspender o sedimento em 750 μ l de solução de 1 (S1) (0,25 M de sacarose, 10 mM de MgCl 2 20 ug / ml de PMSF, uma mistura de cisteína, serina, inibidores da treonina e da protease de aspartilo que incluem 10 μ g / ml de inibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A e 10 μ g / ml de N-acetil-L-leucil-L-leucil-L-argininal) e camada sobre um volume igual de solução de 2 (S2) (0,35 M de sacarose, 0,5 mM de MgCl 2, 20 μ g / ml de PMSF, uma mistura de cisteína, serina, inibidores da treonina e da protease de aspartilo que incluem 10 μ g / ml de inibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A e 10 μ g / ml de N-acetil-L-leucil-L-leucil-L-argininal). Centrifuge a 1.400 xg, 4 ºC por 5 min.
  8. Descartar o SN utilizando uma micropipeta. Evite perturbar o sedimento.
  9. Ressuspender o sedimento contendo núcleos isolados em 750 μ l de S2.
  10. Para isolar frações subnucleares enriquecidos com adenovírus RC (RCF), sonicate núcleos ressuspenso com um banho de ultra-som, usando dois pulsos 5 min, ou até que todos os núcleos são lisadas como observado por microscopia de campo claro. Use gelo no banho de ultra-sons, conforme necessário para manter as amostras a, ou abaixo de 4 ° C.
  11. Camada os núcleos sonicadas sobre um volume igual de solução de 3 (S3) (0,88 M de sacarose, 0,5 mM de MgCl2) e centrifuga-se a 3000 xg, 4 ° C durante 10 min. Guarde a 1,5 ml sobrenadante como a fracção nucleoplasmic (NPL) a -70 ºC. Ressuspender o sedimento em 700 μ l de S2 e armazenar como RCF a -70 ºC.

3. As análises de Western Blot RCF

NOTA: Para a análise Western Blot de NPL e RCF frações set de lado 640 ul para Npl e 300 μ l para RCF do volume total obtido na etapa 2.11.

  1. Misturar 15 μ l de cada fracção subnuclear em tampão Laemmli 2x (4% de SDS, 20% glicerol, 10% de 2-mercaptoetanol, 0,004% de azul de bromofenol, Tris-HCl 0,125 M pH 6,8) e fervura a 95 ºC durante 5 min. Coloque as amostras em uma electroforese de sódio dodecil 10% sulfato-poliacrilamida gel (SDS-PAGE) em gel de desnaturação e de proteínas separadas por 1,5 h, a 20 miliamperes (mA).
  2. Proteínas transferir por Eletroblotting durante 1,5 horas a 400 mA para polivinilideno (PVDF) membranas.
  3. Bloco de membrana durante 2 horas à temperatura ambiente a partir de leite seco sem gordura a 3% em PBS.
  4. Incubar O / N a 4 ºC com o anticorpo primário contra proteína E2A de ligação a DNA viral (B6-8 9) a uma diluição de 1: 500 em leite seco PBS / 0,3% desnatado.
  5. Membrana Lavar 3 vezes com PBS / 0,1% Tween 20 durante 10 min.
  6. Incubar a membrana com um rato anti IgG secundáriotibody acoplado a peroxidase de rábano (HRP) a uma diluição de 1: 10.000 em PBS durante 2 horas à temperatura ambiente.
  7. Lava-se a membrana 3 vezes com PBS / 0,1% Tween 20 durante 10 min.
  8. Desenvolver a membrana usando quimioluminescência aumentada e filmes de raios-X.

4. Detecção de ADN viral no RCF

NOTA: Para o isolamento de ADN a partir de ambas as fracções de morosidade e RCF, utilizar 210 μ l para Npl e 100 μ l para RCF do volume total obtido na etapa 2.11.

  1. Incubar fracções sub-nucleares durante 1 h a 55 ºC, com 1 mg / ml de proteinase K e 0,5% de Tween 20.
  2. Inactivar a proteinase K por incubação das amostras durante 10 min a 95 ° C.
  3. Centrifugar as amostras a 20.000 xg, à temperatura ambiente durante 2 min.
  4. Recolher o SN. Precipitar o ADN com 1/10 de volume de acetato de sódio 3M e um volume de isopropanol, O / N a 4 ° C.
  5. Centrifugar as amostras a 20.000 xg, à temperatura ambiente durante 10 min.
  6. Descarte o u SNcantar uma micropipeta. Lava-se a pastilha com etanol a 70% e centrifuga-se a 20000 xg, 4 ° C durante 5 min.
  7. Ressuspender o ADN em 10 μ l de 10 mM de Tris-HCl a pH 7,4
  8. Quantificar ADN utilizando um espectrofotómetro, medindo a densidade óptica (DO) a 260 nm.
  9. Para amplificar o ADN viral, utilizar 100 ng de ADN de cada fracção subnuclear numa reacção de PCR utilizando polimerase de ADN de Taq em 25 μ l de volume de reacção com iniciadores que permitem a amplificação de uma região no interior da unidade de transcrição tardia principal, a partir do nucleótido 7273 de nucleotídeo 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use as seguintes condições de ciclos: desnaturação inicial durante 3 min a 95 ºC, seguido por 20 ciclos de amplificação (1 min a 95 ° C, recozimento durante 1 minuto a 62 ° C e extensão durante 30 s a 72 ° C) e um passo final de extensão para 3 min a 72 ºC.
  10. Executar o produto de PCR em géis de agarose a 2%, a 90 V. mancha com etídiobrometo em 0,5 μ g / ml de concentração final e visualizar o ADN para corroborar o enriquecimento do ADN viral no RCF. Lidar com brometo de etídio com extremo cuidado e certifique-se sempre usar luvas, como este composto é um potente mutagênico. Descarte brometo de etídio de acordo com as diretrizes institucionais.

5. tarde Viral Detecção de mRNA em RCF

NOTA: Para o isolamento do RNA a partir de ambas as frações NPL e RCF, use 640 μ l para Npl e 300 μ l para RCF do volume total obtido na etapa 2.11.

  1. Isolar o ARN a partir de fracções subnucleares usando Trizol de acordo com as instruções do fabricante. Ressuspender o RNA em 50 μ l de DEPC (diethilpyrocarbonate) tenha sido tratada com água.
  2. Quantificar o ARN utilizando um espectrofotómetro para medir a densidade óptica a 260 nm (cerca de 3 μ g são obtidos). Armazenar o ARN em 50 ng / ul de aliquotas a -70 ° C.
  3. Verifique RNA purificadopara a ausência de contaminação com ADN através da realização de uma reacção de controlo na ausência de PCR de transcriptase reversa (RT), utilizando-se 5 ng de ARN total e as condições do ciclo descritas no passo 4.9.
    1. Se a contaminação de ADN não está ausente amplicão deve ser produzido. Se a contaminação de ADN está presente, incubar as amostras com 10 U de ADNase I, 10 U de inibidor de RNase, 0,1 M de Tris-HCl pH 8,3, 0,5 M de KCl e 15 mM de MgCl2 durante 30 min a 37 ºC. Prossiga para a re-isolar RNA como no passo 5.1.
  4. Para analisar ARNm viral associado a RCF, ampliada 100 ng de ARN a partir de cada fracção subnuclear por RT-PCR utilizando iniciadores desenhados para detectar ARNm tardio adenoviral de diferentes famílias de genes (Tabela 1).
    1. Para a transcrição reversa (RT) a 100 ng de ARN, a partir de cada fracção subnuclear numa reacção de RT utilizando enzima M-MuLV RT em 20 μ l de volume de reacção durante 1 hora a 42 ° C e 10 min a 70 ºC.
    2. Para a amplificação, usar 1μ l do ADNc em reacções de PCR, como no passo 4.9. Use as seguintes condições de ciclos: desnaturação inicial durante 3 min a 95 ºC, seguido por 25 ciclos de amplificação (1 min a 95 ° C, recozimento durante 1 minuto à temperatura especificada no Quadro 1 e extensão durante 30 s a 72 ºC) e um etapa de extensão final de 3 min a 72 ºC.
  5. Executar os produtos de RT-PCR em géis de agarose a 2%, em géis de 90 V. mancha com brometo de etídio a 0,5 μ g / ml de concentração final e visualizar a corroborar associação ARNm tardio virai para o RCF. Pega brometo de etídio, tal como indicado no passo 4.10.

6. Imunofluorescência Visualização de RCF

NOTA: Carry-out este procedimento sob uma câmara de fluxo laminar para evitar a contaminação das amostras com as partículas de poeira e filtrar todas as soluções antes de usar.

  1. Spot 5 uL da fracção RCF obtidos no passo 2.10 directly em uma lâmina revestida de silano.
  2. Deixe o local seco durante cerca de 5 min à temperatura ambiente.
  3. Re-hidratado por lentamente e indiretamente pipetando 500 μ l de PBS em uma queda ao lado do local RCF e deixá-lo fluir pela inclinação do slide. Escorra o excesso de PBS de lado.
  4. Bloquear, cobrindo a amostra com 500 μ l de PBS / 5% de albumina de soro bovino (BSA) durante 2 horas à temperatura ambiente.
  5. Lave o slide 3 vezes por suavemente e indiretamente pipetando 500 l μ da PBS sobre a amostra. Incline o slide para drenar o excesso de PBS.
  6. Incubar a amostra com o anticorpo primário contra proteína E2A de ligação a DNA viral (B6-8 9) a uma diluição de 1: 500 em PBS durante 2 horas à temperatura ambiente. Cobrir a amostra manchada com 20 μ l da solução de anticorpo e incuba-se numa câmara húmida, para evitar a secagem.
  7. Lava-se a amostra 3 vezes com PBS / 0,02% de Tween 20 e, indirectamente, por suavemente pipetando 500 μ l de PBS para a amostra. Incline o slide para drenar o exsolução de lavagem cesso.
  8. Incubar as amostras com rato anticorpo secundário IgG anti acoplado a um fluoróforo que é excitada a 488 nm, a uma diluição de 1: 2000 em PBS, durante 1 hora a 4 ºC. Cobrir a amostra manchada com 20 μ l da solução de anticorpo e incuba-se numa câmara húmida, para evitar a secagem.
  9. Lava-se a amostra 3 vezes com PBS / 0,02% de Tween 20 e, indirectamente, por suavemente pipetando 500 μ l de PBS para a amostra. Incline o slide para drenar o excesso de solução de lavagem.
  10. Cobrir a amostra manchada sobre a lâmina com uma lamela utilizando 2 μ l de PBS / glicerol a 10% como meio de montagem. Selo com clara unha polonês e armazenar al -20 ºC.
  11. Analisar as amostras utilizando um microscópio de fluorescência, com uma objectiva 63x e uma Abertura Numérica 1,4 (NA) num comprimento de onda de 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Uma vez que os compartimentos de replicação virai (RC) são estruturas virais induzidas subnucleares compostas por proteínas e ácidos nucleicos, semelhante a outros domínios nucleares, elas provaram ser passíveis de isolamento por gradientes de velocidade com base nas características bioquímicas. As etapas críticas no protocolo de fraccionamento são ilustrados na Figura 1. Em cada passo, as amostras devem ser monitorizada por microscopia de campo brilhante para assegurar a integridade das diferentes fracções sub-celulares. Por exemplo, quando o inchaço das células, tempo de incubação no tampão hipotónica tem de ser normalizado de modo a inchar o citoplasma evitando danos para os núcleos. Após a homogeneização de células, os núcleos intactos, livre de componentes citoplasmáticos incluindo membranas do retículo endoplasmático, precisa de ser obtida. Além disso, o tempo de sonicação necessita de ser normalizado de modo a romper a membrana nuclear de todas as células, sem perturbar RC.

Após a obtenção das fracções sub-nuclear, chavecontroles precisam ser incluídos para determinar a associação e enriquecimento de marcadores de boa-fé de RC no RCF. Adenoviral RC são normalmente visualizadas em células infectadas por imunof luorescência utilizando anticorpos contra a proteína E2A-72K viral (PAD). DBP é uma proteína viral que participa diretamente na replicação do genoma viral; Portanto, a presença de DBP em partículas enriquecido no RCF demonstra a associação directa desta proteína virai com as partículas isoladas, como se mostra na Figura 1. Além disso, a detecção de PAD em RCF por Western Blot confirma a associação desta proteína para o isolado RC. Na Figura 2 mostra-se que por tempos tardios após a infecção (36 hpi), DBP é enriquecido no RCF em comparação com a fracção nucleoplásmica (NPL), demonstrando que RC obtidos com este procedimento em diferentes tempos pós-infecção refletem o esperado temporais padrão de associação PAD para RC. Um componente essencial de RC viral é a itse ADN virallf. Em experiências como o mostrado na Figura 3 demonstram que quantidades crescentes de ADN virai associado com RCF como o ciclo de replicação do vírus progride, indicando que, tal como para a PAD, o padrão temporal da replicação do ADN nestas fracções pode também ser estudado.

Além de conter proteínas virais e o genoma virai, RC são também locais de expressão de genes tardios virais. Na Figura 4 apresentamos resultados representativos de experimentos destinados a medir por RT-PCR a nível de várias espécies de mRNA tarde viral e sua segregação entre RCF e Npl a 36 hpi. ARNm tardios virais são sintetizados em RC e a sua transformação postranscriptional inicia nestes locais; posteriores destes mRNA viral dissociar-RC, estão liberados para o nucleoplasma, e são posteriormente exportados para o citoplasma. O pool total de mRNA tarde viral madura (ML mRNA) foi medido utilizando primers que amplificam uma junção exão do líder tripartido, umsequência que constitui a 5 'de todos os ARNm tardio de adenovírus (Figura 4A). Junções exão no mRNA dos transcritos maduros específicos de L2, L4 e L5 famílias também foram medidos. Foi estabelecido que, como a fase tardia do ciclo de replicação virai progride, quantidades crescentes de ARNm tardios virais são exportados para o citoplasma; No entanto, por vezes a produção final das espécies de ARNm L5 aumenta ainda mais em comparação com as outras famílias de mRNA final. Nos resultados representativos semeadas na Figura 4 uma diferença de aproximadamente 2,5 vezes na ML ARNm é observada em comparação com Npl RCF, como esperado. Curiosamente, quando comparamos ARNm a partir de famílias específicas, tanto L2 e L4 ARNm parecem ser distribuídos em níveis semelhantes entre ambas as fracções subnucleares (Figura 4B e C, respectivamente), enquanto, em contraste, o ARNm L5 mostrou um aumento de quase duas vezes na Npl em comparação com RCF. Estes resultados sugerem um padrão diferencial no sy nthesis e libertação das diferentes espécies de ARNm tardio virais de adenoviral RC (como foi sugerido antes 10). Significativamente, estes resultados também demonstram que as medições precisas das diferentes etapas na biogénese do ARNm viral pode ser realizada utilizando isolado RC com este novo processo.

figura 1
Figura 1. Microscopia de Campo brilhante Passos diferentes durante o procedimento de fraccionamento. Durante o isolamento de RC, as amostras precisam ser monitorados por um microscópio óptico para garantir a integridade das fracções sub-celulares. A figura mostra os passos utilizados no procedimento de obtenção de RCF, o inchaço das células HFF, a separação de núcleos e o isolamento de fibras recicladas por meio de almofadas de sucrose. 40x micrografias: bar escala de 50 μ m; 63x micrografias: bar escala de 5 μ m; DBP é mostrado em verde.TPS: "target =" _ blank //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "> Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Western Blot contra PAD. As amostras são analisadas por SDS-PAGE e western blot para processado contra PAD, um marcador bona fide de RC viral. Para determinar o enriquecimento da proteína na RCF, que é útil para comparar a presença e abundância relativa de DBP em ambos RCF Npl e em diferentes momentos após a infecção. Em células HFF 16 hpi representa um momento cedo durante o ciclo de replicação adenoviral; 24 hpi marca a passagem para a fase tardia da infecção, a síntese de ADN virai começa; 36 hpi representa um pós-infecção tempo de atraso. A massa molecular esperada de DBP é mostrado. Por favor, cliquemk aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. PCR ensaio para detectar DNA viral (vDNA) em RCF. ADN foi purificado a partir RCF e Npl em 24 e 36 hpi. O ADN virai foi amplificado por PCR utilizando iniciadores específicos para o genoma viral. O gráfico mostra o enriquecimento de DNA viral em RCF às 36 hpi. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
.. Figura 4. Análise de ARN viral tardia de ARNm foi isolado a partir de fibras recicladas e Npl e analisado por RT-PCR para detectar ARNm tardio viral específica (A) total de ARNm viral tardia (ML: major tardio); (B) a partir de ARNm de LFamília 2; (C) a partir do ARNm da família L4; (D) a partir do ARNm da família L5. Os valores representam a média ± desvio padrão de amostras em triplicado. Por favor clique aqui para ver uma versão maior desta figura.

Nome Sequência de iniciador de sentido directo (5'-3 ') Sequência de iniciador de sentido reverso (5'-3 ') Temperatura de recozimento
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabela 1. Os iniciadores utilizados para a amplificação de ARNm viral tardia ML ARNm: estes iniciadores permitem a amplificação de uma região dentro do líder tripartido, a sequência 5 'que é comum a todos os ARNm tardio virai; Iniciadores L2 de ARNm de permitir a amplificação de uma região específica dentro de ARNm pV; L4 iniciadores de amplificação de ARNm de permitir que a de uma região específica dentro de 100 K ARNm; L5 ARNm permite a amplificação de uma região dentro do ARNm de fibra. As temperaturas de recozimento e de sequência para cada primer são mostrados.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics