Isolering av Viral Replication Kammer-beriket Sub-atom Fraksjoner fra Adenovirus-infiserte Normal humane celler

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenoviruser inneholde en dobbeltkjedet DNA-genom som replikerer i den infiserte cellekjernen. Når det virale DNA kommer inn i kjernen, lokaliserer det ved siden av PML kjernelegemene 1. Etter viral tidlig genuttrykk, er kjernearkitektur dramatisk omlegging, indusere dannelsen av virus microenvironments, kalt viral replikasjon avdelinger (RC) 2. Siden adenovirus (Ad) RC er områder hvor viral genom replikering og uttrykk av virale sene gener finner sted, gir de et miljø for rekruttering av alle nødvendige viral og cellulære faktorer som deltar i disse prosessene. Interessant, et utvalg av cellulære proteiner som er ansvarlig for den cellulære antiviral respons, slik som DNA-skade reaksjon, den medfødte immunrespons og tumorundertrykkelse er co-valgt til disse virale områdene 2. Derfor kan Ad RC anses regulatoriske huber som fremmer effektiv virusreplikasjon, mens samtidig regulerercellulær antiviral respons, noe som indikerer at disse strukturer er nøkkelen til forståelse av virus-vertscelleinteraksjoner. Likevel, de molekylære mekanismene for RC formasjon, sammensetning og tilhørende aktiviteter er dårlig forstått.

Adenoviral RC, samt RC fra andre DNA-virus som replikerer i kjernen ikke er knyttet til membraner, i motsetning til cytoplasmisk RC 3. Videre disse virus-induserte strukturer er sannsynlig å være sammensatt utelukkende av proteiner og nukleinsyrer. RC dannet i celler infisert med RNA-virus (vanligvis kalt viral fabrikker) er blitt isolert, dra nytte av deres cytoplasma lokalisering og membranbundne status, som har tilrettelagt sine detaljert morfologiske, funksjonelle og biokjemisk karakterisering fire.

Så vidt vi vet, har atom viral RC ikke blitt isolert, kanskje på grunn av kompleksiteten i den kjernefysiske arkitektur og fravær av intranuclear membranes som ville letter deres isolasjon. Deres studie har støttet seg i stedet på immunfluorescens mikroskopi, FISH og transmisjonselektronmikroskopi. Men til tross for komplikasjoner iboende å isolere subnuclear strukturer, andre atom domener som nucleoli og Cajal Bodies har vært isolert før 5,6. Siden nucleoli og RC begge er sammensatt av proteiner og nukleinsyrer, og har en diameter på mellom 0,5 - 5 um, har vi antatt at RC må også være mottagelig for isolasjon. Derfor, for å mer nøyaktig karakterisere den molekylære sammensetning og funksjon er knyttet til RC, etablerte vi en ny metode for å isolere subnuclear fraksjoner anriket med fjernstyring. For dette formål ble det fremstilt sub-atomfraksjoner ved hjelp av hastighetsgradienter og sukrose puter som ligner på fremgangsmåter som brukes for å isolere nucleoli 7 eller andre kjerne domener 6 og etablert et cellefritt system som gjør det mulig å studere de molekylære sammensetning og tilhørende aktiviteter avRC. Denne teknikken bør derfor fremme forståelsen av virus-vertscellereaksjoner og representerer et kraftig verktøy som bør også legge til rette for detaljert analyse av RC fra andre virus som kopierer i kjernen og indusere dannelsen av replikering avdelinger av lignende dimensjoner til de som dannes i adenovirus- -infiserte celler, så som herpesvirus, papillomavirus eller polyomaviruses.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Cell Kultur og Ad-infeksjon

  1. Forplante Ad5 WT virus i monolag av HEK-293 celler og titer som fluorescerende forming units (FFU) på HFF celler som beskrevet tidligere åtte.
  2. Vokse Humant forhudsfibroblaster (HFF) i 10 ml DMEM / 10% føtalt bovint serum (FBS) i sterile kultur 100 mm skåler ved 37 ° C og 5% CO2 i en fuktig inkubator. Bestem celle nummer ved hjelp av en Neubauer kammer ved å telle celler i de fire 16-kvadrat sett. Celletallet pr ml ble oppnådd ved å beregne det gjennomsnittlige antall celler i de fire 16-kvadrat sett og multiplisere dette tallet med 10 4. For hver gang etter infeksjon inngår i trinn 1.3 ved å bruke 1 x 10 7 HFF-celler.
  3. Mock-infisere eller infisere HFF celler med adenovirus type 5 (Ad5) vill-type (WT) (H5pg4100 8) i 100 mm vevskulturskåler bruker 1 ml Ad5 i DMEM per tallerken på en MOI på 30 Focus Forming Unit, eller FFU per celle. Inkuberes i 2 timer i ahumidified cellekulturinkubator ved 37 ° C og 5% CO2, nøye gynge retter hvert 15 min for å sikre homogen fordeling av virusinokulum over cellene. Etter denne tid, fjernes mediet og tilsett friskt DMEM supplert med 10% FBS og inkuberes i 16, 24 eller 36 timer i en fuktig cellekulturinkubator ved 37 ° C og 5% CO2. Gå videre til trinn 2.1.

2. Utarbeidelse av Sub-atom Fraksjoner Beriket med Adenovirus RC

  1. Innhøsting Ad5-smittet eller mock-infiserte HFF celler med en celle scrapper og samle cellene i sterile sentrifugerør. Bestem celle nummer som i trinn 1.2. Bruk 1 x 10 7 celler for hver gang etter infeksjonen er angitt i trinn 1,3.
  2. Sentrifuger cellene ved 220 x g, 4 ° C i 5 minutter.
  3. Resuspender cellepelleten i iskald PBS (137 mM NaCl, 2,7 mM KCl, 10 mM Na HPO 2 4 og 1,8 mM KH 2PO 4). Vask cellepellets 3 ganger med 5 ml iskald PBS per vask. For dette formål, sentrifuger cellene ved 220 xg, 4 ° C i 5 minutter, dekantering og kast supernatanten (SN), og cellepelleten suspenderes ved forsiktig pipettering.
  4. Å forstyrre plasmamembranen, cellepelleten suspenderes i 700 ul iskald hypotonisk buffer (10 mM HEPES pH 7,9, 10 mM KCl, 1,5 mM MgCl2, 0,5 mM DTT, 20 μ g / ml fenylmetylsulfonylfluorid (PMSF) en blanding av cystein, serin, treonin og aspartylproteasehemmere inkludert 10 μ g / ml bovint pankreatisk trypsin inhibitor, 10 μ g / ml pepstatin A og 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L -argininal) og la cellene sveller på is i 3 timer.
  5. Lyse av cellene ved hjelp av en homogenisator med en løstsittende En type teflon. Utfør 80 dounce slag og overvåke prøver hver 20 slag etter lyse felt mikroskopi for å sikre at alle cellene er lysert, men at kjerner har not blitt skadet eller sprukket.
  6. Sentrifuger cellehomogenatet ved 300 xg, 4 ° C i 5 minutter. Oppbevar SN som den cytoplasmiske fraksjon ved -20 ° C i et sentrifugerør.
  7. For å fjerne celleavfall fra kjerner, resuspender pelleten i 750 μ l oppløsning 1 (S1) (0,25 M sukrose, 10 mM MgCl 2 20 pg / ml PMSF, en blanding av cystein, serin, treonin og aspartylproteasehemmere inkludert 10 μ g / ml bovint pankreatisk trypsin inhibitor, 10 μ g / ml pepstatin A og 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal) og lag over et like stort volum av oppløsning 2 (S2) (0,35 M sukrose, 0,5 mM MgCl2, 20 μ g / ml PMSF, en blanding av cystein, serin, treonin og aspartylproteasehemmere inkludert 10 μ g / ml bovint pankreatisk trypsin inhibitor, 10 μ g / ml pepstatin A og 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge ved 1400 xg, 4 ° C i 5 minutter.
  8. Kast SN bruker en mikropipette. Unngå å forstyrre pelleten.
  9. Resuspender pelleten inneholdende isolerte kjerner i 750 μ l av S2.
  10. For å isolere subnuclear fraksjoner beriket med adenovirus RC (RCF), sonicate resuspendert kjerner med et ultralydbad, ved hjelp av to 5 min pulser, eller til alle kjerner lyseres som observert av lyse felt mikroskopi. Bruk is i ultrasonisk bad som trengs for å holde prøvene ved eller under 4 ° C.
  11. Layer sonikerte kjernene i løpet av et like stort volum av oppløsning 3 (S3) (0,88 M sukrose, 0,5 mM MgCl2) og sentrifuger ved 3000 xg, 4 ° C i 10 min. Oppbevar 1,5 ml supernatant som nucleoplasmic fraksjon (NPL) ved -70 ºC. Resuspender pelleten i 700 μ l av S2 og lagre som RCF ved -70 ° C.

3. Western Blot Analyser av RCF

MERK: For Western Blot analyse av NPL og RCF fraksjoner set side 640 ul for NPL og 300 μ l for RCF fra det totale volumet oppnådd i trinn 2,11.

  1. Bland 15 μ l av hver subnuclear fraksjon i Laemmli-buffer 2x (4% SDS, 20% glycerol, 10% 2-merkaptoetanol, 0,004% bromfenolblått, 0,125 M Tris-HCl, pH 6,8) og koker ved 95 ° C i 5 min. Last prøvene i en 10% natrium-dodecyl-sulfat-polyakrylamid-gelelektroforese (SDS-PAGE) denaturerende gel og atskilte proteiner i 1,5 timer, ved 20 milliampere (mA).
  2. Overfør proteiner ved elektro i 1,5 timer ved 400 mA til polyvinylidendifluorid (PVDF) membraner.
  3. Blokk membran i 2 timer ved romtemperatur ved anvendelse av 3% fettfri tørrmelk i PBS.
  4. Inkuber O / N ved 4 ° C med primært antistoff mot virale E2A-DNA-bindende protein (B6-8 9) ved en 1: 500 fortynning i PBS / 0,3% fettfri tørrmelk.
  5. Vask membran 3 ganger med PBS / 0,1% Tween 20 i 10 minutter.
  6. Inkuber membranen med mus anti IgG sekundært entibody koblet til pepperrot-peroksidase (HRP) ved en 1: 10000 fortynning i PBS i 2 timer ved RT.
  7. Vask membranen 3 ganger med PBS / 0,1% Tween 20 i 10 minutter.
  8. Utvikle membranen ved hjelp av forbedret chemiluminescence og X-ray filmer.

4. Viral DNA Detection i RCF

NB: For DNA isolert fra både NPL og RCF fraksjoner ved å bruke 210 μ l for NPL og 100 μ l for RCF av totalvolumet oppnådd i trinn 2,11.

  1. Inkuber sub-atomfraksjoner i 1 time ved 55 ° C med 1 mg / ml proteinase K og 0,5% Tween 20.
  2. Inaktivere proteinase K ved å inkubere prøvene i 10 minutter ved 95 ° C.
  3. Sentrifuger prøvene ved 20 000 xg, ved romtemperatur i 2 min.
  4. Samle SN. Utfelling av DNA med 1/10 volum av 3 M natriumacetat, og et volum av isopropanol, O / N ved 4 ° C.
  5. Sentrifuger prøvene ved 20 000 xg, ved RT i 10 min.
  6. Kast SN usynge en mikropipette. Vask pelleten med 70% etanol og sentrifuger ved 20 000 xg, 4 ° C i 5 min.
  7. Resuspender DNA i 10 μ l av 10 mM Tris-HCl pH 7.4
  8. Kvantifisere DNA ved hjelp av et spektrofotometer ved måling av den optiske tetthet (OD) ved 260 nm.
  9. For å forsterke viral DNA ved å bruke 100 ng DNA fra hver subnuclear fraksjon i en standard PCR-reaksjon ved anvendelse av Taq DNA-polymerase i 25 μ l reaksjonsvolum med primere som tillater amplifisering av et område innenfor den Major Late transkripsjonsenheten, fra nukleotid 7273 til nukleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Bruke følgende syklusbetingelser: Innledende denaturering i 3 minutter ved 95 ° C, etterfulgt av 20 sykluser med amplifikasjon (1 min ved 95 ° C, annealing i 1 min ved 62 ° C og forlengelse i 30 sek ved 72 ° C) og en avsluttende forlengelsestrinn for 3 minutter ved 72 ° C.
  10. Kjør PCR-produkt i 2% agarosegeler, 90 V. Stain med etidiumbromid på 0,5 μ g / ml endelig konsentrasjon og visualisere DNA for å underbygge viral DNA berikelse i RCF. Håndtak ethidiumbromid med ekstrem forsiktighet og alltid sørge for å bruke hansker, da denne forbindelsen er en potent mutagen. Kast etidiumbromid henhold til institusjonelle retningslinjer.

5. Late Viral mRNA Detection i RCF

MERK: For RNA isolert fra både NPL og RCF fraksjoner, bruke 640 μ l for NPL og 300 μ l for RCF fra det totale volumet oppnådd i trinn 2.11.

  1. Isolere RNA fra subnuclear fraksjoner ved hjelp Trizol henhold til produsentens instruksjoner. Resuspender RNA i 50 μ l DEPC (diethilpyrocarbonate) -behandlet vann.
  2. Kvantifisere RNA ved hjelp av et spektrofotometer for å måle OD ved 260 nm (ca. 3 μ g ble oppnådd). Oppbevar RNA i 50 ng / ul alikvoter ved -70 ° C.
  3. Sjekk renset RNAfor fraværet av DNA-kontaminering ved å utføre en kontroll PCR-reaksjon i fravær av revers transkriptase (RT), ved anvendelse av 5 ng av total RNA og syklusen betingelser som er beskrevet i trinn 4,9.
    1. Dersom DNA-kontaminering er fraværende ingen amplikon skal produseres. Dersom DNA-kontaminering er til stede, inkubere prøvene med 10 DNase I U, 10 U RNase inhibitor, 0,1 M Tris-HCl pH 8,3, 0,5 M KCl og 15 mM MgCl2 i 30 minutter ved 37 ° C. Fortsett å re-isolere RNA som i trinn 5.1.
  4. For å analysere viralt mRNA forbundet til RCF, forsterke 100 ng av RNA fra hver subnuclear fraksjon ved RT-PCR ved anvendelse av primere utformet til å detektere adenovirus sen mRNA fra forskjellige genfamilier (Tabell 1).
    1. For revers transkripsjon (RT) ved å bruke 100 ng av RNA, fra hver subnuclear fraksjon i en standard RT-reaksjon ved anvendelse av M-MuLV RT enzym i 20 μ l reaksjonsvolum i 1 time ved 42 ° C og 10 minutter ved 70 ° C.
    2. For forsterkning, bruke enμ l av cDNA i PCR-reaksjoner, som i trinn 4.9. Bruke følgende syklusbetingelser: Innledende denaturering i 3 minutter ved 95 ° C, etterfulgt av 25 sykluser med amplifikasjon (1 min ved 95 ° C, gløding i 1 minutt ved den temperatur som er spesifisert i tabell 1, og forlengelse i 30 sek ved 72 ° C) og en endelig forlengelsestrinn i 3 minutter ved 72 ° C.
  5. Kjør RT-PCR produktene i 2% agarosegeler, 90 V. Flekke geler med ethidiumbromid på 0,5 μ g / ml endelig konsentrasjon og visualisere for å underbygge viral sent mRNA tilknytning til RCF. Håndtak ethidiumbromid som angitt i trinn 4.10.

6. Immunfluorescens Visualisering av RCF

MERK: Carry-out denne prosedyren under en laminær kabinett for å unngå forurensning av prøvene med eventuelle støvpartikler, og filtrere alle løsninger før bruk.

  1. Spot 5 pl av RCF-fraksjonen oppnådd i trinn 2,10 directly på en silan-belagt lysbilde.
  2. La stedet tørke i omtrent 5 min ved RT.
  3. Re-hydrat ved sakte og indirekte pipettere 500 μ l PBS i et fall ved siden av RCF stedet og la den flyte ved å vippe raset. Hell av overflødig PBS fra siden.
  4. Blokk ved å dekke prøven med 500 μ liter PBS / 5% bovint serumalbumin (BSA) i 2 timer ved RT.
  5. Vask objektglasset 3 ganger ved forsiktig pipettering, og indirekte 500 μ l PBS på prøven. Vipp raset til å renne av overflødig PBS.
  6. Inkuber prøven med primært antistoff mot virale E2A-DNA-bindende protein (B6-8 9) ved en 1: 500 fortynning i PBS i 2 timer ved RT. Dekk flekket prøven med 20 μ l av antistoffløsning og inkuber i et fuktighetskammer for å unngå tørking.
  7. Vask prøven 3 ganger med PBS / 0,02% Tween 20 ved forsiktig pipettering, og indirekte 500 μ l PBS på prøven. Vipp lysbildet å renne av exsessen vaskeløsning.
  8. Inkuber prøver med mus anti-IgG sekundært antistoff koblet til en fluorofor som er eksitert ved 488 nm ved en 1: 2000 fortynning i PBS, i 1 time ved 4 ° C. Dekk flekket prøven med 20 μ l av antistoffløsning og inkuber i et fuktighetskammer for å unngå tørking.
  9. Vask prøven 3 ganger med PBS / 0,02% Tween 20 ved forsiktig pipettering, og indirekte 500 μ l PBS på prøven. Vipp raset til å renne av overflødig vaskeløsning.
  10. Dekk oppdaget prøven på lysbildet med et dekkglass ved hjelp av to μ l PBS / 10% glycerol som monteringsmedium. Forsegle med klar neglelakk og butikken al -20 ºC.
  11. Analysere prøvene ved hjelp av et fluorescensmikroskop, med et 63x objektiv og en 1,4 numerisk blenderåpning (NA) ved en bølgelengde på 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Siden virale replikasjons kamre (RC) er subnuclear viral-induserte strukturer som består av proteiner og nukleinsyrer, i likhet med andre kjerne domener, viste de seg å være mottagelig for isolering ved hastighetsgradienter basert på biokjemiske egenskaper. Kritiske trinn i fraksjoneringen protokollen er illustrert i figur 1. På hvert trinn prøvene må overvåkes ved lysfelt-mikroskopi for å sikre integriteten av de forskjellige sub-cellulære fraksjoner. For eksempel, når hevelse cellene, må inkubasjonstid i hypotonisk buffer til å bli standardisert for å svelle i cytoplasma å unngå skade på kjernen. Etter homogenisering celle, intakte kjerner, fri for cytoplasmatiske komponenter, inkludert endoplasmic nettet membraner, må skaffes. Også må ultralydbehandling tid til å bli standardisert for å revne den nukleære membran av alle celler uten å forstyrre RC.

Etter å ha fått sub-atomfraksjoner, keykontrollene må være inkludert for å fastslå foreningen og berikelse av bona fide RC markører i RCF. Adenoviral RC blir vanligvis visualisert i infiserte celler ved immunofluorescens ved å bruke antistoffer mot virale E2A-72k protein (DBP). DBP er et viralt protein som deltar direkte i virusgenomet replikasjon; derfor tilstedeværelse av DBP i partikler anriket på RCF demonstrerer direkte tilknytning til denne viralt protein med de isolerte partiklene, som vist i figur 1. Videre påvisning av DBP i RCF ved Western Blot bekrefter foreningen av dette protein til den isolerte RC. I figur 2 er det vist at ved senere tidsavsnitt etter infeksjon (36 HPI), er DBP anriket på RCF i forhold til nucleoplasmic fraksjon (NPL), som viser at RC oppnådd med denne fremgangsmåten ved forskjellige tidspunkter etter infeksjon reflekterer den forventede tidsmessige mønster av DBP assosiasjon til RC. En essensiell komponent i viral RC er viral DNA Itself. I forsøk som det som er vist på figur 3 viser vi at økende mengder av viral DNA forbinder med RCF som replikasjonssyklus av viruset utvikler seg, noe som indikerer at, som for DBP, den tidsmessige mønster av DNA-replikasjon i disse fraksjoner kan også bli undersøkt.

Dessuten inneholder virusproteiner og det virale genomet, RC er også områder av viral sen genekspresjon. I figur 4 presenterer vi representative resultater fra eksperimenter konstruert for å måle ved hjelp av RT-PCR nivået av ulike arter av viralt mRNA sen og deres segregering mellom RCF og NPL ved 36 hpi. Viral sene mRNA syntetiseres i RC og deres postranscriptional behandlingen starter i disse områdene; senere disse viral mRNA distansere fra RC, er frigjort til nukleoplasma, og deretter eksportert til cytoplasma. Den totale pool av modne virus sent mRNA (ML mRNA) ble målt ved hjelp av primere som forsterker en ekson krysset av tredelte leder, ensekvens som utgjør den 5 'av alle adenovirus sen mRNA (figur 4A). Exon veikryss i mRNA av spesifikke modne transkripsjoner av L2, ble L4 og L5 familier også målt. Det er fastslått at så sent i den virale replikasjonssyklusen skrider frem, blir økende mengder av virale sene mRNA eksportert til cytoplasma; Men ved slutten av tid produksjonen av de L5 mRNA-artene øker videre i sammenligning med de andre sen mRNA-familier. I de representative resultatene sådd i figur 4 en ca 2,5 ganger forskjell i ML mRNA er observert i NPL sammenlignet med RCF, som forventet. Interessant når vi sammenligner mRNA fra bestemte familier, både L2 og L4 mRNA synes å bli distribuert i lignende nivåer mellom begge subnuclear fraksjoner (Figur 4B og C, henholdsvis), mens derimot viste L5 mRNA en nesten 2 ganger økning i NPL sammenlignet med RCF. Disse resultatene tyder på en differensial mønster i sy nthesis og frigjøring av de forskjellige virale sen mRNA-arter fra adenoviral RC (som har blitt foreslått før 10). Betydelig Disse resultater viser også at nøyaktige målinger av de forskjellige trinnene i biogenese av viral mRNA kan utføres ved hjelp av isolerte RC med denne nye fremgangsmåten.

Figur 1
Figur 1. lysfelt-mikroskopi på forskjellige trinn under Fraksjone Prosedyre. Under isolering av RC, prøvene må overvåkes ved hjelp av et optisk mikroskop for å sikre integriteten av sub-cellulære fraksjoner. Figuren viser trinnene som anvendes i fremgangsmåten for å oppnå RCF, fra svellingen av HFF-celler, til separasjon av kjerner og isolering av RCF gjennom sukrose puter. 40x mikrografier: skala bar 50 μ m; 63x mikrografier: skala bar 5 μ m; DBP vises i grønt.tps: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Western Blot mot DBP. Prøvene ble analysert ved SDS-PAGE og bearbeidet for western blot mot DBP, en bona fide markør for viral RC. For å bestemme anrikning av proteinet i RCF, er det nyttig å sammenligne tilstedeværelsen og relative overflod av DBP i både RCF og NPL ved forskjellige tidspunkter etter infeksjon. I HFF-celler 16 hpi representerer et tidlig tidspunkt under adenoviral replikasjonssyklus; 24 hpi markerer overgangen til den sene fasen av infeksjonen som viral DNA syntese begynner; 36 HPI representerer et sent tidspunkt etter infeksjonen. Den forventede molekylvekt på DBP er vist. Vennligst CLICk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. PCR-analyse for å oppdage virus-DNA (vDNA) i RCF. DNA ble renset fra RCF og NPL på 24 og 36 HPI. Viralt DNA ble amplifisert ved PCR ved bruk av primere som var spesifikke for det virale genomet. Grafen viser berikelse av virus-DNA i RCF 36 HPI. Klikk her for å se en større versjon av dette tallet.

Figur 4
.. Figur 4. Analyse av mRNA sen Viral RNA ble isolert fra RCF og NPL og analysert ved RT-PCR for å påvise spesifikk viral sen mRNA (A) Totalt Viral sen mRNA (ML: Major Late), (B) mRNA fra L2 Familie, (C) mRNA fra L4 Familie, (D) mRNA fra L5 Family. Verdiene representerer gjennomsnitt ± standardavvik på triplikatprøvene. Klikk her for å se en større versjon av dette tallet.

Navn Forover primer-sekvens (5'-3 ') Revers primer-sekvens (5'-3 ') Utglødningstemperatur
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabell 1. Primere brukt for Viral sen mRNA Amplification ML mRNA: disse primere tillater amplifisering av et område i den tredelte leder, 5'-sekvens som er felles for alle virus sen mRNA; L2 mRNA primere tillater amplifikasjon av en spesifikk region i pV mRNA; L4 mRNA primere tillater amplifikasjon av en spesifikk region i 100 K mRNA; L5 mRNA tillater amplifisering av et område inne i fiber mRNA. Sekvens og annealing temperaturer for hver primer vist.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics