मानव भ्रूण स्टेम कोशिकाओं से उत्पन्न एण्डोडर्म कोशिकाओं की शुद्धि के लिए एक त्वरित और कारगर तरीका

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहाँ, हम विभेदित मानव भ्रूण स्टेम कोशिकाओं है कि बहाव के अनुप्रयोगों और आगे differentiations के सुधार के लिए निश्चित एण्डोडर्म के प्रति प्रतिबद्ध हैं की शुद्धि के लिए एक विधि का वर्णन।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ऐसे भ्रूण स्टेम कोशिकाओं (ESCs) के रूप में स्टेम कोशिकाओं के भेदभाव क्षमताओं सेल प्रतिस्थापन उपचार के लिए एक संभावित चिकित्सीय आवेदन अनुमति देते हैं। टर्मिनली विभेदित सेल प्रकार विभिन्न अपक्षयी रोगों के उपचार के लिए इस्तेमाल किया जा सकता है। फेफड़े, यकृत और अग्न्याशय के ऊतकों की दिशा में इन कोशिकाओं की इन विट्रो भेदभाव पहले कदम के रूप में निश्चित endodermal कोशिकाओं की पीढ़ी की आवश्यकता है। यह कदम दर सीमित ऐसे इंसुलिन के उत्पादन बीटा कोशिकाओं, hepatocytes या अन्य endoderm व्युत्पन्न प्रकार की कोशिकाओं के रूप में परिपक्व हो टर्मिनली प्रकार की कोशिकाओं की दिशा में आगे भेदभाव के लिए है। प्रकोष्ठों कि एण्डोडर्म वंश के प्रति प्रतिबद्ध हैं अत्यधिक ऐसे FOXA2, SOX17, HNF1B, GATA परिवार के सदस्यों, और सतह रिसेप्टर CXCR4 के रूप में प्रतिलेखन कारकों में से एक भीड़ व्यक्त करते हैं। हालांकि, भेदभाव प्रोटोकॉल शायद ही कभी 100% कुशल हैं। यहाँ, हम भेदभाव के बाद एक CXCR4 + सेल की आबादी की शुद्धि के लिए एक विधि का वर्णनडे में चुंबकीय microbeads का उपयोग करके। इस शुद्धि इसके अतिरिक्त अवांछित प्रजातियों की कोशिकाओं को हटा। कोमल शोधन विधि त्वरित और विश्वसनीय है और बहाव के अनुप्रयोगों और differentiations सुधार करने के लिए इस्तेमाल किया जा सकता है।

Introduction

ऐसे भ्रूण स्टेम कोशिकाओं (ESCs) के रूप में स्टेम कोशिकाओं की क्षमता मानव शरीर के लगभग किसी भी प्रकार की कोशिका में अंतर करने के लिए है। इस प्रकार, इन विट्रो भेदभाव प्रोटोकॉल ऐसे cardiomyocytes 1, 2 hepatocytes, बीटा कोशिकाओं 3, 4 या फेफड़ों उपकला neuronal कोशिकाओं 5 के रूप में कई प्रकार के वयस्क कोशिका उत्पन्न करने के लिए इस्तेमाल किया जा सकता है। इस ESCs विभिन्न अपक्षयी रोगों 3 की संभावित उपचार के लिए एक महत्वपूर्ण उपकरण बना देता है।

फेफड़े, यकृत और अग्न्याशय के वयस्क ऊतकों की ओर ESCs की इन विट्रो भेदभाव निश्चित एण्डोडर्म (डे) 6 की याद ताजा की कोशिकाओं में एक छद्म gastrulation की आवश्यकता है। चूंकि ऊपर उल्लिखित दैहिक प्रकार की कोशिकाओं की दिशा नीचे की ओर भेदभाव काफी कम कुशल है, एक इष्टतम एण्डोडर्म भेदभाव दर सीमित 7 के रूप में माना जाता है। प्रकोष्ठों कि एण्डोडर्म वंश के प्रति प्रतिबद्ध हैं चा गुजरनाउनके जीन अभिव्यक्ति प्रोफ़ाइल में racteristic बदल जाता है। Pluripotency मास्टर नियामक जीन नीचे विनियमित रहे हैं, इस तरह के FOXA2, SOX17, HNF1B, GATA परिवार के सदस्यों और सतह रिसेप्टर CXCR4 अत्यधिक 6 upregulated है, 8, 9। CXCR4 SMAD2 द्वारा transactivated होने के लिए जाना जाता है के रूप में अन्य प्रतिलेखन कारक की अभिव्यक्ति है, जबकि / 3, इसके प्रमोटर क्षेत्र में 10 विशिष्ट बाध्यकारी साइटों के कारण नोडल / TGF-β संकेतन और SOX17 के बहाव। इस प्रकार यह एक बहुत ही उपयुक्त रिपोर्टों 6, 8, 11-13 की संख्या में इस्तेमाल किया मार्कर है। ये अभिव्यक्ति में परिवर्तन एक छद्म gastrulation घटना, जिसमें ESCs पहले एक आदिम लकीर की तरह सेल की आबादी की विशेषताओं को हासिल करने और बाद में एण्डोडर्म रोगाणु परत 6 में प्रतिबद्ध दर्शाता है।

हालांकि, भेदभाव प्रोटोकॉल शायद ही कभी 100% कुशल हैं कुछ कोशिकाओं भेदभाव प्रक्रिया का विरोध या अन्य प्रजातियों अनायास ही 14 की दिशा में अंतर हो सकता है। इन कोशिकाओं को नकारात्मक influe सकता हैnce आगे भेदभाव। इसके अलावा, अवशिष्ट undifferentiated कोशिकाओं बाद में प्रत्यारोपण के प्रयोगों के लिए महान जोखिम बंदरगाह और teratomas 15-17 को जन्म दे सकता है।

जल्दी-सतह पर मार्कर CXCR4 कोशिकाओं है कि डे 18 के प्रति प्रतिबद्ध हैं की शुद्धि के लिए इस्तेमाल किया जा सकता है इन अवांछित कोशिकाओं को हटाने के लिए। यहाँ, हम डे भेदभाव संस्कृतियों से CXCR4 + कोशिकाओं के सकारात्मक चयन के लिए एक विधि का वर्णन है। इस के लिए, सतह मार्कर CXCR4 एक एंटीबॉडी जो तब बदले में चुंबकीय microbeads को बांध से बाध्य है। FACS छँटाई के दौरान कठोर परिस्थितियों के विपरीत, चुंबकीय लेबल डे कोशिकाओं की तरह तो आसानी से एक benchtop प्रारूप में एक सज्जन शोधन विधि का उपयोग कर शुद्ध किया जा सकता है। इस प्रोटोकॉल सेल आबादी को हटाने की है कि DE भेदभाव प्रक्रिया विरोध के लिए एक सरल तरीका प्रदान करता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

निश्चित एण्डोडर्म की दिशा में मानव ईएससी के 1. भेदभाव

  1. 37 डिग्री सेल्सियस पर एक मशीन में मानव भ्रूण स्टेम कोशिकाओं (ESCs) खेती और 5% सीओ 2।
  2. कोट एक तहखाने झिल्ली मैट्रिक्स के 1 मिलीलीटर के साथ एक नया 6 अच्छी तरह से सेल संस्कृति की थाली और आरटी पर कम से कम 30 मिनट के लिए संस्कृति के बर्तन सेते हैं। विशेष जानकारी के लिए कृपया संबंधित निर्माता के निर्देशों की बारी है।
  3. पुष्टि करें कि सुसंस्कृत मानव ESCs 80% -90% confluency खुर्दबीन के नीचे एक कम बढ़ाई (जैसे, 4X) का उपयोग पहुँच चुके हैं। एक बाँझ कांच पाश्चर pipet के साथ मध्यम चूसने से गुहाओं से मध्यम aspirate। फॉस्फेट बफर खारा (पीबीएस) समाधान के साथ एक बार कोशिकाओं को धो लें। इस के लिए, अच्छी तरह से धीरे से प्रत्येक के लिए 2 मिलीलीटर पीबीएस जोड़ने थाली हिला और समाधान चूसना बंद मृत कोशिकाओं और सेल मलबे को हटाने के लिए।
  4. सेल समूहों की कोमल हदबंदी के लिए एंजाइम से मुक्त passaging समाधान अभिकर्मक के 1 मिलीलीटर जोड़ें। 37 डिग्री सेल्सियस पर एक कोशिकाओं को सेतेडी 5% सीओ 2 तक कोशिकाओं छोटे समूहों में व्यवधान के स्पष्ट संकेत नहीं दिखा।
    नोट: ऊष्मायन समय इस्तेमाल किया अभिकर्मक पर निर्भर करता है। एंजाइम से मुक्त passaging समाधान माल खंड में वर्णित के लिए, ऊष्मायन समय मोटे तौर पर 7 मिनट है।
  5. 1 मिलीलीटर DMEM / F-12 के माध्यम जोड़ें और ऊपर pipetting द्वारा और एक 1 मिलीलीटर विंदुक टिप का उपयोग कर नीचे एकल कक्षों में शेष सेल समुच्चय को बाधित। इस का प्रयोग करें सतह से कोशिकाओं को फ्लश और एक centrifugation ट्यूब कोशिकाओं हस्तांतरण करने के लिए। सभी कोशिकाओं को पुन: प्राप्त करने के लिए, DMEM / F-12 के माध्यम से 1 मिलीलीटर के साथ अच्छी तरह से प्रत्येक धोने और centrifugation ट्यूब के माध्यम जोड़ें।
  6. 300 पर 5 मिनट के लिए कोशिकाओं अपकेंद्रित्र x जी। सतह पर तैरनेवाला Aspirate और युक्त 10 माइक्रोन रो-kinase (रॉक) अवरोध 5 मिलीलीटर ते सेल संस्कृति माध्यम में कोशिकाओं resuspend।
  7. खुर्दबीन के नीचे कोशिकाओं एक hemocytometer का उपयोग गिनती और 150,000 बीज - प्रति 6 अच्छी तरह से या किसी अन्य प्लेट लेआउट में 400,000 कोशिकाओं, ते सेल का इस्तेमाल किया लाइन पर निर्भर करता है। उपयोग संस्कृति-मध्यम युक्त 10 माइक्रोन रॉक अवरोध संरचना 37 डिग्री सेल्सियस और 5% सीओ 2 में apoptosis और संस्कृति एक मशीन में कोशिकाओं से बचने के लिए।
  8. लगभग एक बाँझ कांच पाश्चर pipet के साथ महाप्राण मध्यम बोने और आदिम लकीर प्रेरण मध्यम 2 मिलीलीटर जोड़ने के बाद 24 घंटे।
    नोट: यह मध्यम उन्नत RPMI 1640 मध्यम में 1% glutamine, 0.2% एफसीएस, 5 माइक्रोन के चीड़-99021 और 50 एनजी / एमएल activin ए के अंतिम सांद्रता शामिल हैं। आमतौर पर, 6 अच्छी तरह प्लेटें में खेती के लिए मध्यम 2 मिलीलीटर का उपयोग करें।
  9. बोने के बाद 48 घंटा, मध्यम प्रेरण मध्यम एण्डोडर्म करने के लिए जगह। दैनिक मध्यम परिवर्तन के साथ एक और 48 घंटे के लिए इस माध्यम में कोशिकाओं खेती।
    नोट: यह मध्यम उन्नत RPMI 1640 मध्यम में 1% glutamine, 0.2% एफसीएस और 50 एनजी / एमएल activin ए में शामिल है। प्रकोष्ठों कि निश्चित एण्डोडर्म के प्रति प्रतिबद्ध हैं सतह मार्कर CXCR4 व्यक्त करते हैं। CXCR4 का धुंधला-डे प्रतिबद्ध कोशिकाओं की संख्या यों इस्तेमाल किया जा सकता है।
  1. अंतिम 24 घंटा लेकिन कटाई से पहले कम से कम 1 घंटे के लिए कोशिकाओं संस्कृति के माध्यम से 10 माइक्रोन रॉक अवरोध जोड़ें।
  2. कोट सेल संस्कृति के बर्तन कि एक तहखाने झिल्ली मैट्रिक्स के साथ फिर से बोने, IE के लिए इस्तेमाल किया जाएगा, immunofluorescence धुंधला के लिए qPCR विश्लेषण या चैम्बर स्लाइड्स के लिए 12 अच्छी तरह प्लेटें। आरटी पर कम से कम 30 मिनट के लिए प्लेटों या स्लाइड सेते हैं।
  3. धुंधला हो जाना और / या छँटाई के लिए इस्तेमाल किया विभेदित कोशिकाओं के कुओं से एक बाँझ कांच पाश्चर pipet के साथ मध्यम aspirate।
  4. सेल समूहों की कोमल हदबंदी के लिए एंजाइम से मुक्त passaging समाधान अभिकर्मक के 1 मिलीलीटर जोड़ें। सीओ 2 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं और 5% तक कोशिकाओं छोटे समूहों में व्यवधान के स्पष्ट संकेत नहीं दिखा।
    नोट: ऊष्मायन समय इस्तेमाल किया अभिकर्मक पर निर्भर करता है। एंजाइम से मुक्त passaging समाधान materi में उल्लेख के लिएए एल एस अनुभाग, ऊष्मायन समय मोटे तौर पर 7 मिनट है।
  5. 1 मिलीलीटर DMEM / F-12 के माध्यम जोड़ें और ऊपर pipetting द्वारा और एक 1 मिलीलीटर टिप का उपयोग कर नीचे एकल कक्षों में सेल समुच्चय शेष बाधित। इस का प्रयोग करें सतह से कोशिकाओं को फ्लश और एक centrifugation ट्यूब कोशिकाओं हस्तांतरण करने के लिए। सभी कोशिकाओं को पुन: प्राप्त करने के लिए, w / ओ एफसीएस DMEM / F-12 के माध्यम से 1 मिलीलीटर के साथ अच्छी तरह से प्रत्येक धोने और centrifugation ट्यूब के माध्यम जोड़ें।
  6. खुर्दबीन के नीचे कोशिकाओं एक hemocytometer का उपयोग गिनती। 6 अच्छी तरह से थाली के तीन कुओं से कोशिकाओं भेदभाव के तीन दिनों के बाद 10-15 x 10 6 कोशिकाओं में परिणाम चाहिए। 300 पर 5 मिनट के लिए कोशिकाओं अपकेंद्रित्र x जी।
    नोट: प्राप्त कोशिकाओं की सही संख्या भेदभाव के लिए इस्तेमाल किया pluripotent सेल लाइन पर निर्भर करेगा।
  7. सतह पर तैरनेवाला Aspirate और 10 माइक्रोन रॉक अवरोध युक्त PEB बफर में कोशिकाओं resuspend। अप करने के लिए 10 7 कोशिकाओं के लिए इस बफर के 100 μl का प्रयोग करें। staini के दिन पर 10 माइक्रोन रॉक अवरोध जोड़ेएनजी। सभी बहाव के अनुप्रयोगों (PEB बफर + आरआई के रूप में) के लिए इस बफर का प्रयोग करें।
    ध्यान दें: PEB बफर 0.5% बीएसए और पीबीएस में 2 मिमी EDTA में शामिल है। अधिक कोशिकाओं दाग हो रहे हैं, बफर मात्रा के हिसाब से समायोजित करें।
  8. 100 μl में 10 7 कोशिकाओं प्रति एक CXCR4 एपीसी एंटीबॉडी के 10 μl जोड़ें, यह मोटे तौर पर 1:10 के कमजोर पड़ने का प्रतिनिधित्व करता है।
    नोट: एक एपीसी से जुड़े एंटीबॉडी का उपयोग अनिवार्य नहीं है। इसके बजाय इसे इस्तेमाल microbeads के आधार पर प्रतिस्थापित किया जा सकता है। अधिक कोशिकाओं दाग किया जाए तो तदनुसार एंटीबॉडी मात्रा समायोजित करें।
  9. धीरे उंगलियों के साथ ट्यूब flipping द्वारा मिक्स और 15 मिनट के लिए एक रेफ्रिजरेटर में 4 डिग्री सेल्सियस पर सेते हैं। 1-2 मिलीलीटर PEB बफर के साथ कोशिकाओं Resuspend। 300 पर 5 मिनट के लिए कोशिकाओं अपकेंद्रित्र x जी।
  10. एक बाँझ कांच पाश्चर pipet के साथ सतह पर तैरनेवाला Aspirate और 10 7 कोशिकाओं प्रति 80 μl PEB में सेल गोली resuspend और 20 μl विरोधी एपीसी microbeads जोड़ें।
    ध्यान दें:
  11. धीरे उंगलियों के साथ ट्यूब flipping द्वारा मिक्स और 15 मिनट के लिए एक रेफ्रिजरेटर में 4 डिग्री सेल्सियस पर सेते हैं। 1-2 मिलीलीटर PEB बफर + आरआई के साथ कोशिकाओं Resuspend। 300 पर 5 मिनट के लिए कोशिकाओं अपकेंद्रित्र x जी। बफर aspirate। 500 μl PEB बफर + आरआई में Resuspend।

3. CXCR4 + कोशिकाओं के चुंबकीय जुदाई

  1. एक चुंबकीय क्षेत्र में एक मध्यम आकार के चुंबकीय स्तंभ निर्माण निर्देशों के अनुसार रखें। 500 μl PEB बफर + आरआई के साथ स्तंभ पूर्व कुल्ला। स्तंभ के लिए पूरे सेल निलंबन लागू करें। स्तंभ के लिए बाध्य होगा के रूप में नहीं सभी कोशिकाओं के माध्यम से प्रवाह लीजिए। यकीन CXCR4 + कोशिकाओं का इष्टतम पुनः प्राप्ति के लिए कॉलम को परेशान नहीं करें।
  2. स्तंभ 500 μl PEB बफर + आरआई के साथ तीन बार धोएं। के माध्यम से पहली प्रवाह लीजिए और 3.1 चरण से एकत्र की कोशिकाओं के साथ गठबंधन। चुंबकीय क्षेत्र से चुंबकीय स्तंभ निकालें और एक में जगहउपयुक्त संग्रह ट्यूब। 1 मिलीलीटर PEB बफर + आरआई स्तंभ पर जोड़ें। elute करने के लिए कोशिकाओं को मजबूती स्तंभ में सवार नीचे दबाएँ।
  3. वैकल्पिक: अलग नमूने के माध्यम से सभी प्रवाह लीजिए और प्रवाह cytometry का उपयोग CXCR4 + कोशिकाओं की संख्या का विश्लेषण करने के लिए 20 μl प्रत्येक का उपयोग करें। उनकी संख्या हर कदम धोने के साथ गिरावट चाहिए।
    नोट: कम से कम 2 एक्स 10 4 व्यवहार्य, gated कोशिकाओं विश्वसनीय परिणामों के लिए ही किया जाना चाहिए।
  4. दोहराएँ चरण में 3.1 से नमूना के माध्यम से एकत्र प्रवाह और 3.2 कदम से नमूना के माध्यम से पहली प्रवाह एक नया स्तंभ का उपयोग के साथ 3.1-3.3 कदम। पिछले कॉलम नहीं है फिर से उपयोग करें। सवार हवा का उपयोग करके स्तंभ है, जो यह ब्लॉकों में दबाया जाता है।
  5. खुर्दबीन के नीचे कोशिकाओं एक hemocytometer का उपयोग गिनती। 6 एक्स 10 6 कोशिकाओं को भेदभाव से ऊपर की दक्षता पर निर्भर करता है शुरू में हल किया जा सकता है और एक दूसरे स्तंभ का उपयोग करते समय प्रक्रिया के लिए 10 7 कोशिकाओं का उपयोग करके एक और 1 x 10 6 कोशिकाओं। 5 मिनट के लिए 300 XG पर कोशिकाओं अपकेंद्रित्र। महाप्राण सतह पर तैरनेवाला और एक बाँझ कांच पाश्चर pipet के साथ और अतिरिक्त 10 माइक्रोन के रॉक अवरोध करनेवाला के साथ कदम 1.9 से 1 मिलीलीटर एण्डोडर्म प्रेरण माध्यम में कोशिकाओं resuspend।
  6. खुर्दबीन के नीचे कोशिकाओं एक hemocytometer का उपयोग गिनती। एक उपयुक्त घनत्व में कोशिकाओं बीज यानी, ~ 12 अच्छी तरह से थाली के प्रति अच्छी तरह से 4 x 10 5 कोशिकाओं (एपीपी। 3.6 सेमी 2 सतह) या ~ एक 8 अच्छी तरह से चैम्बर स्लाइड की अच्छी तरह से प्रति 1.5 x 10 5 कोशिकाओं।

4. वैकल्पिक: शुद्ध निश्चित एण्डोडर्म जनसंख्या का विश्लेषण

  1. immunofluorescence धुंधला के लिए मोटे तौर पर निश्चित एण्डोडर्म (डे) और / या pluripotency मार्कर प्रोटीन के लिए 4% paraformaldehyde और दाग के साथ बोने के बाद 24 घंटे चरण में 3.7 से शुद्ध कोशिकाओं को ठीक।
    नोट: आमतौर पर इस्तेमाल डे मार्कर FOXA2 और SOX17 शामिल हैं, आमतौर पर इस्तेमाल pluripotency मार्कर OCT3 / 4, NANOG और Sox2 6, 8 शामिल हैं।
  2. एफओआर आर टी-qPCR विश्लेषण, प्रत्यक्ष या 24 घंटा बोने के बाद शुद्ध कोशिकाओं फसल निकालने की कुल शाही सेना और निकाले कुल शाही सेना के नमूने से सीडीएनए टाइप रिवर्स। 10 एनजी सीडीएनए प्रति RT-qPCR प्रतिक्रिया (triplicates) टेम्पलेट के रूप में प्रयोग डे और pluripotency मार्कर जीन 6, 8 की अभिव्यक्ति का विश्लेषण करने के लिए।
    नोट: आमतौर पर इस्तेमाल मार्कर जीन 4.1 चरण में उल्लेख कर रहे हैं। साइकिल की स्थिति 95 डिग्री सेल्सियस पर 5 मिनट और 95 डिग्री सेल्सियस पर 15 सेकंड के 40 चक्र और 60 डिग्री सेल्सियस पर 1 मिनट, वक्र विश्लेषण पिघलने से पीछा कर रहे हैं।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

भेदभाव पर ESCs जीन और प्रोटीन अभिव्यक्ति में भारी बदलाव से गुजरना। चित्रा 1 दर्शाया गया है ठेठ मार्कर जीन है कि एक सफल एण्डोडर्म भेदभाव सत्यापित करने के लिए इस्तेमाल किया जा सकता है। एक जीन अभिव्यक्ति विश्लेषण के निशाने GSC, FOXA2, और SOX17 कर रहे हैं। एक रिश्तेदार जीन अभिव्यक्ति विश्लेषण में विशेष रूप से FOXA2 और SOX17> 2,000 गुना से बढ़ रहे हैं जब अविभाजित ESCs की तुलना में। GSC पहले से ही आदिम लकीर गठन के दौरान बहुत जल्दी 24 घंटा के भीतर व्यक्त किया है लेकिन यह फिर भी प्रेरित किया है चार दिन> 100 गुना। इन जीनों की अभिव्यक्ति के फलस्वरूप CXCR4 सतह मार्कर 6 का उपयोग छँटाई पर बढ़ जाती है। ऐसे OCT3 / 4 (POU5F1) और NANOG रूप pluripotency मास्टर नियामकों काफी नीचे विनियमित रहे हैं, हालांकि इन जीनों की अभिव्यक्ति अभी भी चार दिनों के बाद detectable है। इस इंडिकाटीईएस कि कुछ कोशिकाओं को पर्याप्त रूप चीड़-99021 और activin ए SOX7 जीन अभिव्यक्ति के साथ इलाज के आहार का जवाब नहीं है आम तौर पर डे के खिलाफ अतिरिक्त भ्रूण एण्डोडर्म गठन के भेदभाव को संबोधित किया है। पहले मामले में SOX17 सह व्यक्त SOX7 के साथ और बाद के मामले में SOX17 सह व्यक्त FOXA2 के साथ है। चित्रा 1 में परिणाम से संकेत मिलता है कि डे के साथ साथ कुछ अतिरिक्त भ्रूण कोशिकाओं भेदभाव के दौरान गठन हो सकता है, हालांकि हम अभी तक नहीं किया है SOX7 + कोशिकाओं दाग के लिए सक्षम है।

चित्रा 2 अलग सेल आबादी है कि ESCs के भेदभाव डे में करने के बाद उपस्थित होते हैं दिखाता है। चरण में 1 ESCs एकल कक्षों के रूप में वरीयता प्राप्त और फिर चार दिनों के लिए चीड़-99021 और activin एक साथ इलाज के द्वारा भेदभाव कर रहे हैं। डे की अगर धुंधला मार्करों SOX17 और FOXA2 (2A चित्रा) से पता चलता है कि दोनों समान रूप से मार्कर सह स्पष्ट हैंडी नाभिक के भीतर। इस डे प्रतिबद्धता की एक बानगी के रूप में माना जाता है। हालांकि, कुछ कोशिकाओं भेदभाव प्रक्रिया का विरोध और दो ​​डे मार्कर प्रोटीन (2A चित्रा) से न तो व्यक्त करते हैं। वास्तव में, दो अलग-अलग सेल आबादी चार दिन बाद मनाया भेदभाव कर रहे हैं। जबकि कई कोशिकाओं डे मार्कर FOXA2 व्यक्त करते हैं कि वहाँ अभी भी pluripotency मार्कर Sox2 (चित्रा 2 बी) को व्यक्त शेष कोशिकाओं रहे हैं। इन दो प्रोटीन दो अलग आबादी में व्यक्त कर रहे हैं और कोई सह अभिव्यक्ति मनाया जा सकता है (चित्रा 2 बी)।

तीन भेदभाव के चार दिन हो या सतह पर प्रोटीन CXCR4 डे-प्रतिबद्ध CXCR4 + आबादी सुलझाने के लिए और इस तरह शेष pluripotent कोशिकाओं और अन्य अवांछित प्रजातियों को दूर किया जाता है। इस्तेमाल किया सेल लाइन के भेदभाव दक्षता पर निर्भर करता है> 80% CXCR4 + कोशिकाओं चरण 1 से 8 में उल्लिखित भेदभाव प्रोटोकॉल का उपयोग कर प्राप्त किया जा सकता चित्रा 3 डेटा प्रवाह cytometry दर्शाया गया है धुंधला हो जाना और CXCR4 की एमएसीएस शुद्धि के बाद + कोशिकाओं से पहले 66% ± 3% CXCR4 पॉजिटिव कोशिकाओं झुकेंगे पहले और एमएसीएस शुद्धि के बाद immunofluorescence (यदि) धुंधला का उपयोग आम डे और pluripotency मार्कर प्रोटीन की अभिव्यक्ति से पता चलता है। भेदभाव लगभग 60% CXCR4 + CXCR4 के लिए immunofluorescence धुंधला चरण 2 में वर्णित का उपयोग कोशिकाओं (चित्रा 3 ए, मध्यम पैनल) प्राप्त किया गया के तीन दिन। CXCR4 + कोशिकाओं एक एपीसी संयुग्मित विरोधी CXCR4 एंटीबॉडी के साथ धुंधला हो पर Q1 के लिए Q4 से चलते हैं। एमएसीएस शुद्धि चरण 3 में वर्णित के बाद CXCR4 + जनसंख्या 85% से समृद्ध है। शुद्धिकरण की प्रक्रिया है, तथापि, संस्कृतियों से सभी अवांछित प्रजातियों (चित्रा 3 ए, सही पैनल) को खत्म नहीं करता।

एमएसीएस शुद्धि के बाद,CXCR4 + कोशिकाओं आगे के विश्लेषण के लिए वरीयता प्राप्त कर सकते हैं या वैकल्पिक रूप से छंटाई के दूसरे दौर में उच्च purities लेकिन कम व्यवहार्यता उपज के लिए किया जा सकता है। pluripotency मार्कर Sox2 (हरे रंग में दाग) के व्यापक प्रसार अभिव्यक्ति भेदभाव करने से पहले यदि धुंधला द्वारा पता चला है। इसके विपरीत, डे मार्कर FOXA2 (लाल रंग में दाग) (चित्रा 3 बी) नहीं पाया जा सकता है। चित्रा -3 सी CXCR4 + कोशिकाओं में FOXA2 (हरा) के लिए एंटीबॉडी के साथ दाग रहे हैं और pluripotency मार्कर Sox2 (लाल) के लिए कर रहे हैं सह-दाग। शुद्ध CXCR4 + कोशिकाओं के बोने के बाद केवल कुछ Sox2 + कोशिकाओं का पता चला रहे हैं। वरीयता प्राप्त कोशिकाओं के बहुमत डे मार्कर FOXA2 के लिए सकारात्मक रहे हैं।

आकृति 1
एक दिन में चार एण्डोडर्म भेदभाव के दौरान चित्रा 1. विभिन्न pluripotency और एण्डोडर्म मार्कर जीन के जीन की अभिव्यक्ति में प्रतिनिधि परिवर्तन। (ए) 7, एक अकेला activin के साथ एक एक इलाज है, और सीए-ए का उपयोग कर भेदभाव को अर्थ (चीड़-99021 और activin ए) प्रोटोकॉल, जो छँटाई एमएसीएस के लिए प्रयोग किया जाता है (8 में विवरण देखें)। सीए-ए प्रोटोकॉल में इस्तेमाल किया मीडिया यहां आदिम लकीर प्रेरण मध्यम और एण्डोडर्म प्रेरण माध्यम के रूप में भेजा जाता है। (बी) चित्रित जीन GSC, SOX17 और FOXA2 की RT-qPCR है, जो निश्चित एण्डोडर्म प्रतिबद्धता पर बिना व्यक्त कर रहे हैं के द्वारा मापा अभिव्यक्ति है आगे एमएसीएस छँटाई। POU5F1 (OCT3 / 4) और NANOG pluripotency नियामकों हैं और आम तौर पर नीचे, भेदभाव पर विनियमित जबकि SOX7 अतिरिक्त भ्रूण एण्डोडर्म में व्यक्त किया जाता है। जीन अभिव्यक्ति तीन स्थिरतापूर्वक व्यक्त गृह व्यवस्था जीन के खिलाफ सामान्यीकृत था (<उन्हें> TBP, TUBA1A, G6PD) CNRQ मूल्यों में जिसके परिणामस्वरूप। undifferentiated कोशिकाओं में उपर्युक्त जीनों की अभिव्यक्ति को 1 पर सेट किया गया था और परिवर्तन जीन अभिव्यक्ति के गुना परिवर्तन के रूप में प्लॉट किए जाते हैं। मान ± SEM के साधन हैं, एन = 4-5। एनोवा Bonferroni प्लस के पोस्ट अस्थायी परीक्षण। ** पी ≤ 0.01 रैंडम और #P ≤ 0.05 के साथ तुलना में, ## 0.01 ≤ पी आर पी (यह आंकड़ा भीतर सभी डेटा हाल ही में 8 में प्रकाशित किया गया है) के साथ तुलना में। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
एण्डोडर्म भेदभाव के बाद 2. अलग सेल आबादी चित्रा। (ए) डे का धुंधला SOX17 और भेदभाव की D4 पर संबंधित एंटीबॉडी के साथ FOXA2 उनकी समरूप सह स्थानीयकरण का पता चलता है मार्करों। हालांकि, कुछकोशिकाओं भेदभाव प्रक्रिया का विरोध किया और इन मार्करों व्यक्त नहीं करते (केवल नीले नाभिक धुंधला)। हरे और लाल धुंधला के मर्ज पीले रंग में दिखाया गया है। (बी) डे भेदभाव के बाद वहाँ दो अलग सेल आबादी हैं। डे की तरह कोशिकाओं FOXA2 को व्यक्त कोशिकाओं है कि भेदभाव की प्रक्रिया अभी भी विरोध pluripotency मार्कर Sox2 को व्यक्त जबकि। (एबी) नाभिक DAPI (नीला) के साथ counterstained थे। पैनल (ए) में स्केल बार 50 माइक्रोन और पैनल में है (बी) 100 माइक्रोन है। इमेजिंग 670 एनएम (लाल, Cy5), 520 एनएम (हरे, FITC) और 433 एनएम (नीला, DAPI) पर बाहर किया गया था, क्रमशः। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. एमएसीएस भेदभाव डे सेल आबादी और प्रतिनिधि सेंट की छँटाईछंटाई के बाद aining। (ए) CXCR4 + दाग कोशिकाओं (क्यू 1) छँटाई एमएसीएस के बाद समृद्ध कर रहे हैं। CXCR4- कोशिकाओं (Q4) की संख्या में कमी आई है। सेल लाइन पर निर्भर करता है भेदभाव प्रोटोकॉल पैदावार> 80% CXCR4 पॉजिटिव कोशिकाओं 8 और एमएसीएस आगे उन्हें संतुष्ट करने के लिए इस्तेमाल किया जा सकता है। (बी) undifferentiated कोशिकाओं pluripotency मार्कर Sox2 (हरा) का इजहार नहीं बल्कि डे मार्कर FOXA2 इस्तेमाल किया जा रहा है (लाल )। (सी) एमएसीएस केवल बहुत कुछ अविभाजित Sox2 + कोशिकाओं छँटाई करने के बाद, (लाल), शेष जबकि हल जनसंख्या लगभग समान DE मार्कर FOXA2 (हरा) को व्यक्त करता है। (BC) के नाभिक DAPI (नीला) के साथ counterstained थे। पैनल (सी) में स्केल बार 100 माइक्रोन है और सभी पैनलों के लिए लागू होता है। इमेजिंग 670 एनएम (लाल, Cy5), 520 एनएम (हरे, FITC) और 433 एनएम (नीला, DAPI) पर बाहर किया गया था, क्रमशः। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

वर्तमान में इस्तेमाल किया भेदभाव प्रोटोकॉल शायद ही कभी 100% विभेदित कोशिकाओं में परिणाम। कारणों से अभी भी संबोधित किया जाना है उस के लिए कुछ कोशिकाओं भेदभाव प्रक्रिया का विरोध। इस्तेमाल किया भेदभाव प्रोटोकॉल की दक्षता और ईएससी की प्रवृत्ति पर निर्भर करता है लाइन अवशिष्ट pluripotent कोशिकाओं की एक निश्चित संख्या आमतौर पर निश्चित एण्डोडर्म में भेदभाव के बाद भी मनाया जाता है। इन कोशिकाओं को इस तरह के अवशिष्ट transcriptomics, प्रोटिओमिक्स, और miRNA अभिव्यक्ति विश्लेषण के रूप में नीचे की ओर differentiations या आगे के विश्लेषण के क्षीण हो सकता है। अवशिष्ट pluripotent कोशिकाओं या अन्य अवांछित प्रजातियों भी पैराक्राइन प्रभाव है कि भेदभाव के लक्ष्यों के साथ हस्तक्षेप कर सकते हैं प्रदर्शन कर सकते हैं। नतीजतन, इन कोशिकाओं को हटाने में सुधार reproducibility में हो सकता है।

CXCR4 के भेदभाव के बाद एण्डोडर्म कोशिकाओं को व्यक्त + शुद्धि इन आबादियों को समृद्ध करने और कोशिकाओं है कि भेदभाव प्रक्रिया विरोध को दूर किया जा सकता है।सतह डे मार्कर प्रोटीन CXCR4 एण्डोडर्म कोशिकाओं के विशिष्ट शुद्धि के लिए इस्तेमाल किया जा सकता है। हाथ में एमएसीएस शुद्धि प्रोटोकॉल कम से कम 2 घंटा के भीतर पूरा किया जा सकता है और महंगा प्रयोगशाला के उपकरण और उपकरणों के बिना हर सेल कल्चर प्रयोगशाला में एक साधारण बेंच शीर्ष प्रारूप में क्रियान्वित किया जा सकता है। FACS शुद्धि आमतौर पर इस्तेमाल किया तकनीक है, लेकिन कठोर परिस्थितियों कार्यरत हैं। FACS के दौरान शुद्धिकरण कोशिकाओं को आमतौर पर समय की एक लम्बी अवधि के लिए निलंबन में रखा जाता है और कोशिकाओं अन्य चुनौतीपूर्ण कारकों, जैसे, FACS डिवाइस की नोक में उच्च दबाव के अधीन हैं। इसकी तुलना में एमएसीएस प्रक्रिया तेजी से और कोमल है। यह कोशिकाओं 'शुद्धिकरण की प्रक्रिया के बाद reseeding दौरान पुनः अनुलग्न करने की क्षमता में सुधार। आगे इस reattachment कम करने के लिए एक रॉक अवरोध के बाद और शुद्धि apoptosis को रोकने के लिए करने से पहले संस्कृति मीडिया में जोड़ा जाता है। reattachment प्रभावित करती है कि एक अन्य महत्वपूर्ण कारक घनत्व, जिस पर कोशिकाओं reseeded रहे हैं। यह दृढ़ता से निर्भरताइस्तेमाल किया सेल लाइन पर डी एस। सेल इस अध्ययन में बोने के लिए इस्तेमाल की संख्या प्रतिनिधि सेल नंबर है कि हमारे हाथ में अच्छी तरह से काम कर रहे हैं। हालांकि, वहाँ अलग सेल लाइनों के लिए इन नंबरों समायोजित करने की आवश्यकता हो सकती है। दोनों उपायों, एक रॉक अवरोध के अलावा और reseeding के लिए सेल नंबर का मूल्यांकन, छंटाई के बाद आगे सेल संस्कृति की सफलता के लिए महत्वपूर्ण हैं।

इस्तेमाल किया DE भेदभाव प्रोटोकॉल के साथ आम तौर पर> 70% CXCR4 + कोशिकाओं 8 छँटाई के बिना प्राप्त किया जा सकता है। डे पीढ़ी के लिए इस्तेमाल किया प्रोटोकॉल का प्रदर्शन तदनुसार बाद एमएसीएस शुद्धि प्रोटोकॉल की दक्षता प्रभावित करती है। सामान्य, कुशल भेदभाव (> 80% CXCR4 + कोशिकाओं) में एमएसीएस (95% तक) छंटाई के बाद एक उच्च शुद्धता अर्जित करता है। इस प्रकार, इस शोधन विधि का उपयोग undifferentiated कोशिकाओं को काफी हद लेकिन 100% शुद्धता हासिल नहीं किया जा सकता है की संख्या कम कर देता है। भविष्य में, वंश विशिष्ट सतह मार्कर टी परिभाषित किया जा सकताटोपी अधिक टर्मिनली विभेदित कोशिकाओं की शुद्धि की अनुमति होगी। एमएसीएस छँटाई प्रक्रिया इस उद्देश्य के लिए प्रधानमंत्री चयन है।

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

बेला Kresse की कुशल तकनीकी सहायता कृतज्ञता स्वीकार किया है।

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics