인간 배아 줄기 세포로부터 생성 된 내배엽 세포의 정제를위한 신속하고 효율적인 방법

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기서는 하류 어플리케이션 및 상기 분화의 개선을위한 결정적인 내배엽으로 분화 노력하고 인간 배아 줄기 세포의 정제를위한 방법을 설명한다.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포의 분화 능력은 세포 대체 요법에 대한 잠재적 인 치료 적 적용을 허용한다. 말단 분화 세포 유형. 각종 퇴행성 질환의 치료에 사용되는 폐, 간 및 췌장 조직을 향해 이러한 세포의 체외 분화는 첫 단계로 최종 내배엽 세포의 생성을 필요로 할 수있다. 이 단계는 속도 제한 인슐린 - 생산 베타 세포, 간세포 등 내배엽 유래의 세포 유형으로 말단 성숙 세포 유형 향해 더 분화된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 매우 같은 FOXA2, SOX17, HNF1B, GATA 가족의 구성원, 표면 수용체 CXCR4 같은 전사 인자의 군중을 표현한다. 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 여기서는 분화 후 CXCR4 + 세포군의 정제 방법을 서술자기 마이크로 비드를 사용하여 DE에. 이 정제는 또한 원치 않는 계통의 세포를 제거합니다. 부드러운 정제 방법은 신속하고 신뢰성 및 하류 어플리케이션 및 분화를 개선하는 데 사용될 수있다.

Introduction

배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포는 신체의 거의 모든 세포 유형으로 분화 할 수있는 능력을 가지고있다. 따라서, 생체 외 분화 프로토콜은 심근 1 간세포 2, 3 베타 세포, 폐 상피 4 또는 5 신경 세포 등 다양한 성인 세포 유형을 생성하기 위해 사용될 수있다. 이는 ESC에게 다양한 퇴행성 질환 (3)의 잠재적 인 치료를위한 유용한 도구를 만든다.

폐, 간, 췌장의 성인 조직으로는 ESC의 체외 분화는 최종 내배엽 (DE) 6 연상 세포로 의사 낭 배기가 필요합니다. 상기 체세포 유형 하류쪽으로 분화 상당히 비효율적이기 때문에, 최적의 내배엽 분화는 7 레이트 제한으로 간주된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 차를 받다이들 유전자 발현 프로파일 racteristic 변한다. 능성 마스터 조절 유전자 다운 규제 예 9. CXCR4가 된 Smad2 의해 transactivated 것으로 알려져 FOXA2, SOX17, HNF1B, GATA 가족 구성원과 CXCR4 높은 6 상향 조절되어 표면 수용체 (8)과 같은 다른 전사 인자의 발현 반면 / 3, 인해 프로모터 영역 (10)의 특정 결합 부위에 결절 / TGF-β 신호 및 SOX17의 하류. 따라서 리포트 6, 8, 11 ~ 13의 번호를 사용 매우 적합한 마커이다. 이러한 발현 변화는 ESC는 먼저 기본 연속 형 세포 집단의 특성을 획득하고이어서 배아 내배엽 층 (6)에 투입하는 의사 낭배 이벤트를 반영한다.

몇 세포가 분화 과정에 저항 또는 다른 의도하지 않은 계통 (14)으로 구별 할 수있다 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 이러한 세포 부정적인 influe있다후부 더 차별화. 또한, 잔여 미분화 세포는 나중에 이식 실험에 대한 큰 위험을 항구 및 기형 종 15-17을 야기 할 수 있습니다.

초기에 표면 마커 CXCR4 드 (18)를 향해 최선을 다하고 있습니다 세포의 정제에 사용할 수있는 이러한 원치 않는 세포를 제거합니다. 여기서는 DE 분화 배양에서 CXCR4 + 세포의 양성 선별을위한 방법을 설명한다. 이를 위해 표면 마커 CXCR4 후 다시 자성 마이크로 비드에 결합 된 항체에 의해 결합된다. FACS 정렬 동안 가혹한 조건 달리 자기 표지 DE 같은 세포를 쉽게 부드러운 정제 방법을 사용하여 벤치 탑 형태로 정제 될 수있다. 이 프로토콜은 DE 분화 과정 저항 세포 집단을 제거하기위한 간단한 방법을 제공한다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

확실한 내배엽으로 인간의 ESC 1. 차별화

  1. 37 ℃ 배양기에서 인간 배아 줄기 세포 (는 ESC)를 배양하고, 5 % CO 2.
  2. 코트 기저막 매트릭스 1 ㎖와 새로운 6- 웰 세포 배양 접시에 RT에서 적어도 30 분 동안 배양 도자기 부화. 특정 자세한 내용은 각 제조업체의 지침을 켜십시오.
  3. 배양 된 인간는 ESC (예 : 4X) 낮은 배율을 사용하여 현미경으로 80 % -90 %의 포화 상태에 도달했는지 확인합니다. 멸균 유리 파스퇴르 피펫으로 매체를 흡입하여 공동의 매체를 기음. 인산염 완충 식염수 (PBS) 용액으로 한 번 세포를 씻으십시오. 이를 위해 부드럽게 각 웰에 2 ㎖의 PBS를 추가 플레이트를 흔들어 사균 및 세포 파편을 제거하는 용액을 빨아.
  4. 세포 클러스터의 부드러운 해리에 대한 효소가없는 계대 솔루션 시약의 1 ML을 추가합니다. 37 ° C 형의 세포를 품어D 5 % CO 2 세포가 작은 클러스터로 중단의 명확한 징후를 표시 할 때까지.
    주 : 배양 시간을 사용 시약에 따라 달라집니다. 자료 섹션에서 언급 된 효소가없는 계대 솔루션의 경우, 배양 시간은 약 7 분입니다.
  5. 1 ml의 DMEM / F-12 배지를 추가로 pipetting에 의해 1 ML의 피펫 팁을 사용하여 아래 하나의 세포에 남아있는 세포 집합체을 방해. 표면으로부터 세포를 세척하고, 원심 분리 튜브에 세포를 전송하기 위해를 사용한다. 모든 셀을 검색하려면, DMEM / F-12 배지 1 ㎖ 잘 각각의 세척 및 원심 분리 튜브에 매체를 추가 할 수 있습니다.
  6. g X 300에서 5 분간 세포를 원심 분리기. 상등액을 흡인하고 10 μM의 Rho 키나아제 (ROCK) 억제제를 함유하는 5 ㎖의 ES 세포 배양 배지에서 세포를 재현 탁.
  7. 혈구를 사용하여 현미경으로 세포를 세어 150,000 시드 - 사용 ES 세포주에 따라 6- 웰 당 또는 다른 플레이트 레이아웃 400,000 세포. 사용 막 다른37 ° C, 5 % CO 2에서 세포 사멸과 문화를 인큐베이터에서 세포를 방지하기 위해 매체를 포함하는 10 μM의 ROCK 저해제를 진짜야.
  8. 약 24 시간 멸균 유리 파스퇴르 피펫으로 매체 대기음을 파종하고 원시적 인 행진 유도 배지 2 ㎖를 추가 한 후.
    참고 :이 매체는 고급 RPMI-1640 배지에 1 % 글루타민, 0.2 % FCS, 5 μM CHIR-99021 50 NG / ㎖ 티빈의 최종 농도가 포함되어 있습니다. 일반적으로, 6 웰 플레이트에서 배양을위한 배지 2 ㎖를 사용합니다.
  9. 48 시간 시딩 후, 유도 매체를 내배엽 할 수있는 매체를 교체합니다. 매일 매체 변화에 또 다른 48 시간이 매체에 세포를 배양.
    참고 :이 매체는 고급 RPMI-1640 배지에 1 % 글루타민, 0.2 % FCS 50 NG / ㎖ 티빈이 포함되어 있습니다. 최종 내배엽을 향해 최선을 다하고 있습니다 세포 표면 마커 CXCR4를 표현한다. CXCR4의 염색 DE 결정 세포 수를 정량화하는데 사용될 수있다.
  1. 수확 전 마지막 24 시간 그러나 최소한 1 시간 동안 세포 배양 배지에 10 μM의 ROCK 억제제를 추가합니다.
  2. 코트 즉, 기저막 행렬 재 파종에 사용되는 세포 배양웨어, 면역 형광 염색법에 대한 qPCR에 분석 또는 챔버 슬라이드 12 웰 플레이트. 실온에서 적어도 30 분 동안 판 또는 슬라이드를 품어.
  3. 오염 및 / 또는 정렬을 위해 사용되는 분화 된 세포의 웰에서 멸균 유리 파스퇴르 피펫으로 흡인 매체.
  4. 세포 클러스터의 부드러운 해리에 대한 효소가없는 계대 솔루션 시약의 1 ML을 추가합니다. 세포를 작은 클러스터로 중단 뚜렷한 표시까지 CO 2, 37 ℃에서 인큐베이션하고 세포를 5 %.
    주 : 배양 시간을 사용 시약에 따라 달라집니다. materi에 언급 된 효소가없는 계대 솔루션ALS 부는, 배양 시간은 약 7 분이다.
  5. 1 ml의 DMEM / F-12 배지를 추가로 pipetting에 의해 1 ml의 팁을 사용하여 아래 하나의 세포로 세포 집합체 남아 방해. 표면으로부터 세포를 세척하고, 원심 분리 튜브에 세포를 전송하기 위해를 사용한다. 모든 셀을 검색하려면, / FCS 오 w DMEM / F-12 배지 1 ㎖ 잘 각각의 세척 및 원심 분리 튜브에 매체를 추가 할 수 있습니다.
  6. 혈구를 사용하여 현미경으로 세포를 카운트. 6 잘 판의 세 우물에서 세포 분화의 삼일 후 10 ~ 15 × 10 6 세포에서 발생한다. g X 300에서 5 분간 세포를 원심 분리기.
    참고 얻어지는 세포의 정확한 수는 사용 된 분화 다 능성 세포주에 의존 할 것이다.
  7. 뜨는을 기음과 10 μM의 ROCK 저해제를 포함하는 PEB 버퍼에 세포를 재현 탁. 최대 10 7 세포에 대한 버퍼 100 μl를 사용합니다. staini의 날에 10 μM의 ROCK 저해제 추가NG. (PEB 버퍼 + RI 라 함) 모든 다운 스트림 응용 프로그램에 대한 버퍼를 사용합니다.
    참고 : PEB 버퍼가 0.5 % BSA와 PBS에서 2 mM의 EDTA가 포함되어 있습니다. 이상의 세포가 염색 할 경우, 이에 따라 상기 버퍼 볼륨을 조절한다.
  8. 이 약 1:10 희석을 대표하는 100 ㎕의 10 7 세포 당 CXCR4-APC 항체의 10 μl를 추가합니다.
    참고 : APC 결합 항체의 사용은 필수가 아닙니다. 대신 사용 마이크로 비드에 따라 치환 될 수있다. 이상의 세포가 염색 될 경우 그에 따라 항체 량을 조정한다.
  9. 부드럽게 손가락으로 튜브를 틀지하여 혼합하고 15 분 동안 냉장고에 4 ° C에서 품어. 1-2 ml의 PEB 버퍼와 세포를 재현 탁. g X 300에서 5 분간 세포를 원심 분리기.
  10. 멸균 유리 파스퇴르 피펫으로 뜨는을 대기음 10 7 세포 당 80 μL의 PEB에있는 세포 펠렛을 resuspend 20 μl를 방지 APC 마이크로 비드를 추가합니다.
    노트:
  11. 부드럽게 손가락으로 튜브를 틀지하여 혼합하고 15 분 동안 냉장고에 4 ° C에서 품어. 1-2 ml의 PEB 버퍼 + RI와 세포를 재현 탁. g X 300에서 5 분간 세포를 원심 분리기. 버퍼를 대기음. 500 μL의 PEB 버퍼 + RI에 재현 탁.

CXCR4 + 세포의 3. 자기 분리

  1. 제조 지침에 따라 자기장에 중간 크기의 자석 열을 놓습니다. 500 μL의 PEB 버퍼 + RI와 열을 미리 씻어. 열에 전체 세포 현탁액을 적용합니다. 컬럼에 결합되므로, 모든 셀을 통해 유동을 수집한다. 확인 CXCR4 + 세포의 최적의 검색을 위해 열을 방해하지합니다.
  2. 칼럼 500 μL의 PEB 버퍼 + RI로 3 회 씻는다. 내지 제 유동을 수집 단계 3.1에서 수집 된 세포와 결합. 자기장에서 자기 열을 제거하고에 배치적절한 포집 관. 컬럼에 1 ML의 PEB 버퍼 + RI를 추가합니다. 세포가 단단히 열에 플런저를 눌러 용출합니다.
  3. 선택 사항 : 개별적으로 샘플을 통해 모든 흐름을 수집하고 유동 세포 계측법 사용 CXCR4 + 세포의 수를 분석하는 20 ㎕를 각각 사용한다. 그들의 수는 모든 세척 단계로 감소한다.
    참고 : 적어도 2 × 10 4 가능한, 게이트 세포가 신뢰할 수있는 결과를 계산해야한다.
  4. 반복 단계 3.1에서 샘플을 통해 수집 된 흐름과 새 열을 사용하여 단계 3.2에서 샘플을 통해 제 1 유동와 3.1-3.3 단계. 하지 마십시오 이전 칼럼을 다시 사용합니다. 플런저 공기를 사용하여이를 차단하는 열로 가압된다.
  5. 혈구를 사용하여 현미경으로 세포를 카운트. 6 × 106 세포로 분화 최대의 효율에 따라 초기 정렬 및 절차 107 세포를 사용하는 경우 두 번째 열을 사용하여 다른 1 × 106 세포 수있다. 5 분 동안 300 XG에 세포를 원심 분리기. 기음 뜨는 및 멸균 유리 파스퇴르 피펫와 추가로 10 μM의 ROCK 저해제와 단계 1.9에서 1 ml의 내배엽 유도 배지에서 세포를 재현 탁.
  6. 혈구를 사용하여 현미경으로 세포를 카운트. 적절한 밀도로 세포를 시드 즉, ~ 12 웰 플레이트의 웰 당 4 × 10 5 세포 (응용 프로그램. 3.6 cm 2면) 또는 ~ 8 잘 챔버 슬라이드의 웰 당 1.5 × 10 5 세포.

4. 선택 사항 : 정제 된 결정적인 내배엽 인구의 분석

  1. 면역 형광 염색법의 경우 약 24 시간 최종 내배엽 (DE) 및 / 또는 능성 마커 단백질 4 % 파라 포름 알데히드와 얼룩 시드 후 단계 3.7에서 정제 된 세포를 고정합니다.
    참고 : 일반적으로 사용되는 DE 마커 FOXA2 및 SOX17을 포함, 일반적으로 사용되는 만능 마커는 OCT3 / 4, NANOG와 SOX2 6, 8을 포함한다.
  2. FOR RT-qPCR에 분석, 직접 또는 24 시간 시딩 후 정제 된 세포를 수확 총-RNA 추출하고 추출 된 총-RNA 샘플에서의 cDNA를 전사 역. DE 및 다 능성 마커 유전자 (6), (8)의 발현을 분석하기 위해 RT-qPCR의 반응 (삼중) 당 10 ng의 주형으로서 cDNA를 사용합니다.
    참고 : 일반적으로 사용되는 마커 유전자는 단계 4.1에 언급되어있다. 사이클 조건은 곡선 분석을 용융 다음 95 ℃에서 5 분, 95 ° C에서 15 초 40주기와 60 ° C에서 1 분입니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

분화시 는 ESC 유전자와 단백질 발현의 급격한 변화를 겪는다. 1 성공적인 내배엽 분화를 확인하는 데 사용할 수있는 일반적인 마커 유전자를 보여주고있다. 유전자 발현 분석을위한 주요 목표 GSC, FOXA2 및 SOX17있다. 미분화는 ESC에 비해 상대적 유전자 발현 분석에서 특히 FOXA2SOX17는> 000 배 증가된다. GSC 이미 프리미티브 킬 형성시 초기 24 시간 이내 나타낸다 하지만 그럼에도 불구하고 하루 사에> 100 배 유도된다. 이러한 유전자의 발현은 결과적 CXCR4 표면 마커 6을 사용 정렬시 증가된다. 이들 유전자의 발현은 여전히 사일 후 검출하지만 이러한 OCT3 / 4 (POU5F1) 및 NANOG 등 만능 마스터 레귤레이터는 상당히 아래로 조절된다. 이 바랭이일부 세포가 적절하게 CHIR-99021 및 티빈 A. SOX7 유전자 발현과 치료 요법에 반응하지 않는 TES는 일반적으로 DE에 대한 여분의 배아 내배엽 형성을 구별하기 위해 해결됩니다. 첫 번째 경우 SOX17 공동 발현 SOX7와 후자의 경우 SOX17 공동 발현으로 FOXA2이다. 그림 1의 결과는 우리가 아직 SOX7 + 세포를 염색하지 못하고 있지만, DE와 함께 몇 가지 여분의 배아 세포가 분화하는 동안 형성 할 수있는 것을 나타냅니다.

그림 2는 DE으로는 ESC의 분화 후 존재하는 서로 다른 세포 집단을 보여줍니다. 단계 1는 ESC는 하나의 세포로 접종 된 후 나흘 CHIR-99021 및 티빈으로 처리하여 차별화. DE의 IF 염색 SOX17 및 FOXA2 (그림 2A)이 모두 마커가 균일하게 공동 expresse 것을 보여준다 마커핵 내 라. 이것은 DE 약속의 특징으로 간주된다. 그러나, 일부 세포 분화 과정 레지스트 두 DE 마커 단백질 (도 2a)의 어느 쪽을 표현한다. 실제로, 두 개의 별개의 세포 집단은 사일 분화 후에 관찰된다. 많은 세포가 DE 마커 FOXA2을 표현하지만 여전히 만능 마커 SOX2 (그림 2B)을 표현하는 나머지 셀이 있습니다. 이 두 단백질은 두 개의 집단으로 표현하고 어떤 공동 식 (그림 2B) 관찰 할 수 없습니다.

일 세 분화 네에서 표면 단백질 CXCR4는 DE 커밋 CXCR4 + 집단을 정렬하여 나머지 능성 세포 및 기타 원치 않는 계통을 제거하기 위해 사용된다. 사용되는 세포주의 분화에 따라 효율> 80 % CXCR4 + 세포는 단계 1~8에 약술 분화 프로토콜을 사용하여 얻을 수있다 것이고도 3 전에 66 % ± 3 % CXCR4 양성 세포를 수득 전 MACS 정제 후 면역 형광 (IF) 염색을 사용하여 일반적인 DE 및 능성 마커 단백질의 발현을 보여줍니다. 2 단계에 설명 된 CXCR4에 대한 면역 형광 염색법을 사용하여 약 60 % CXCR4 + 세포 (그림 3A, 가운데 패널)을 얻었다 분화 하루 세에. CXCR4 + 세포는 APC 복합 항 CXCR4 항체로 염색시 Q1에 Q4에서 이동합니다. MACS 정제 3 단계에서 설명 된 후 CXCR4 + 집단은 85 %로 농축된다. 정제 공정은, 그러나, 배양 물에서 모든 불필요한 계통 (도 3a, 오른쪽 패널)을 제거하지 않는다.

MACS 정제 한 후,CXCR4 + 세포를 추가 분석을 위해 접종 될 수 있거나 임의로 정렬 번째 라운드는 높은 순도하지만 환원 가능성을 수득하기 위해 수행 될 수있다. (녹색으로 염색) 능성 마커 SOX2의 대폭적인 발현은 분화 이전 IF 염색에 의해 검출된다. 대조적으로, (적색 염색) DE 마커 FOXA2은 (도 3B)을 검출 할 수 없다. 그림 3C CXCR4 +에서 세포 FOXA2 (녹색)에 대한 항체로 염색하고 능성 마커 SOX2 (빨간색)에 대한 공동 염색. 정제 된 CXCR4 + 세포의 파종 후 단 몇 SOX2 + 세포가 검출된다. 시드 세포의 대부분은 DE 마커 FOXA2 긍정적이다.

그림 1
사일의 내배엽 분화하는 동안 다른 능성과 내배엽 마커 유전자의 유전자 발현 1. 대표 변화를 그림. (에이) 7, 혼자 티빈과 치료 및 CA-A를 사용하여 차별화를 나타내며, 어떤 성장 인자없이 배양 조건에 나타낸다 회보 서 (Criminal-99021 및 티빈 A) 정렬 MACS에 사용되는 프로토콜, (8 세부 사항을 참조). CA-A 프로토콜에 사용되는 미디어는 다음과 원시적 인 행진 유도 매체와 내배엽 유도 매체로 불린다. 묘사 (B)이없이 최종 내배엽의 의지에 표현 GSC, SOX17FOXA2의 RT-qPCR에 의해 측정 된 유전자 발현입니다 더 MACS 정렬. POU5F1 (OCT3 / 4) 및 NANOG가 능성 규제하고 SOX7이 여분의 배아 내배엽으로 표현되는 반면, 일반적으로 아래, 차별화에 규제. 유전자 발현은 <(세 안정적으로 발현 하우스 키핑 유전자에 대해 표준화 된EM> CNRQ 값의 결과 TBP, TUBA1A, G6PD). 미분화 된 세포에서 상기 언급 된 유전자의 발현은 1로 설정하고, 변화는 유전자 발현의 배 변화로서 그려진다. 값은 평균 ± SEM이며, N = 4-5. ANOVA 플러스 페로 니의 게시물 임시 테스트. ** P ≤ 0.01 랜덤 및 #P ≤ 0.05에 비해, RP (이 그림 내의 모든 데이터가 최근 8 년에 출판되었다)에 비해 0.01 ≤ ## P. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
내배엽 분화 후 2. 다른 세포 집단을줍니다. DE의 (A) 염색은 SOX17과 분화의 D4에 각각의 항체 FOXA2가 균일 한 공동 현지화를 보여 마커. 그러나 일부세포는 분화 과정을 저항하고 (파란색 핵 염색 만)이 마커를 표현하지 않습니다. 녹색과 빨간색 염색의 병합은 노란색으로 표시된다. (B) 두 가지 세포 인구가 DE 분화 후를. 분화 세포 처리를 저항 여전히 능성 마커를 발현하는 반면 SOX2 DE 같은 세포 FOXA2 표현한다. (AB) 핵은 DAPI (파란색)으로 대조 하였다. 패널 (A)에서 스케일 바는 50 μm의 패널에 (B)는 100 μM이다. 영상이 670 나노 미터 (빨강, Cy5에), 520 nm의 (녹색, FITC) 및 433 nm의 (파란색, DAPI)에서 수행하고, 각각. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
차별화 드 세포 집단 대표 일의 분류 그림 3. MACS정렬 후 aining. (A) CXCR4 + 염색 된 세포 (Q1)의 정렬 MACS 후 농축된다. CXCR4- 세포 (Q4)의 개수는 감소된다. 세포주에 따라이 분화 프로토콜 수율> 80 % CXCR4 양성 세포 8 MACS 더을 농축하기 위해 사용될 수있다. (B) 미분화 세포가 다 능성 마커 SOX2 (녹색)를 표현할 수 있지만 DE 마커 FOXA2 사용되고 (적색 정렬 인구가 거의 균일하게 DE 마커 FOXA2 (녹색)를 표현하는 반면 매우 소수의 미분화 SOX2 + 세포를 분류 MACS 후). (C)는, (빨간색) 남아있다. (BC) 핵은 DAPI (파란색)으로 대조 하였다. 패널 (C)의 스케일 바는 100 μm의이며, 모든 패널에 적용됩니다. 영상이 670 나노 미터 (빨강, Cy5에), 520 nm의 (녹색, FITC) 및 433 nm의 (파란색, DAPI)에서 수행하고, 각각. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

현재 사용 분화 프로토콜은 거의 100 % 차별화 된 세포에서 발생합니다. 아직 해결해야 할 몇 가지 이유로 세포 분화 과정 레지스트. 사용 된 분화 프로토콜의 효율 및 ESC의 성향에 따라 잔류 다 능성 세포의 소정 수는 일반적으로, 심지어 최종 내배엽으로 분화 후에 관찰되는 광고. 이러한 잔류 세포는 transcriptomics, 단백질 체학 및 miRNA의 발현 분석 등 다운 스트림 분화 또는 추가 분석을 방해 할 수 있습니다. 잔여 만능 세포 또는 기타 원치 않는 계보는 차별화 목표를 방해 할 수 있습니다 분비 효과를 나타낼 수있다. 따라서, 이들 세포의 제거 재현성 향상 될 수있다.

CXCR4 내배엽 분화 후 세포를 발현 + 정제 이러한 집단을 풍부하게하고 분화 과정 저항 세포를 제거하는데 사용될 수있다.DE 표면 마커 단백질 CXCR4는 내배엽 세포의 특정의 정제에 사용될 수있다. 손 MACS 정제 프로토콜은 이하에서 2 시간 내에 완료 될 수 있고, 고가의 실험실 장비 및 장치없이 모든 세포 배양 실험실 벤치 탑 간단한 형식으로 실행될 수있다. FACS 정제는 일반적으로 사용되는 방법이지만, 가혹한 조건을 사용한다. FACS 동안 정제를 세포는 일반적으로 오랜 시간 동안 현탁액에서 유지하고, 세포를 다른 도전 요소 FACS 장치의 노즐 등, 고압의 적용을 받는다. 비교 MACS 절차는 빠르고 부드러운입니다. 이는 정제 과정 후에 시드 중에 다시 부착 세포의 능력을 향상시킨다. 또,이 재 부착을 용이하게하기 ROCK 억제제 후 사전 아폽토시스 방지 정제 배양 배지에 첨가한다. 재 부착에 영향을 미치는 또 다른 중요한 인자는 세포 시드되어있는 농도이다. 이 강하게 의존적이다사용 된 세포주에 DS. 이 연구에서 시드에 사용되는 세포 수는 우리 손에 잘 작동 대표 세포 수 있습니다. 그러나, 다른 세포주에 대해 이러한 숫자를 조정할 필요가있을 수있다. 두 방법, ROCK 억제제의 첨가 및 시드에 대한 세포 수의 평가는 정렬 후 상기 세포 배양의 성공에 중요하다.

사용 DE 분화 프로토콜 통상적> 70 %의 세포가 CXCR4 + 8을 정렬하지 않고 얻을 수있다. DE 생성을 위해 사용되는 프로토콜의 성능은 간접으로 후속 MACS 정제 프로토콜의 효율에 영향을 미친다. 일반적으로, 효율적인 분화 (> 80 % CXCR4 + 세포)에서 MACS는 (95 %까지) 정렬 후 더 높은 순도를 얻을 수 있습니다. 따라서, 이러한 정제 방법의 사용은 실질적이지만 100 % 순도 얻을 수없는 미분화 된 세포의 수를 감소시킨다. 향후 리니지 표면적 마커 t 정의 될 수있다모자 이상의 말단 분화 세포의 정제를 허용한다. MACS 선별 절차는이 목적을 위해 프라임 선택이다.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

재스민 Kresse의 숙련 된 기술 지원은 기꺼이 인정 받고 있습니다.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics