Быстрый и эффективный метод для очистки эндодермы клеток, полученных из эмбриональных стволовых клеток человека

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы опишем метод очистки дифференцированных эмбриональных стволовых клеток человека, которые совершаются по отношению к окончательному энтодермы для улучшения последующих применений и дальнейших дифференцировок.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Возможности дифференцировки плюрипотентных стволовых клеток, таких как эмбриональные стволовые клетки (ЭСК) позволяют потенциальное терапевтическое применение для клеточной заместительной терапии. Терминально дифференцированных типов клеток могут быть использованы для лечения различных дегенеративных заболеваний. В пробирке дифференцировки этих клеток по отношению к тканям легких, печени и поджелудочной железы требует в качестве первого шага генерации окончательных эндодермы клеток. Этот шаг является ограничивающим скорость для дальнейшей дифференциации по отношению к неизлечимо созревших типов клеток, таких как инсулин-продуцирующих бета-клеток, гепатоцитов или других эндодермы типов клеток. Клетки, которые совершаются в направлении энтодермы линии высоко выражают множество транскрипционных факторов, таких как Foxa2, SOX17, HNF1B, члены семьи GATA, и поверхностный рецептор CXCR4. Тем не менее, протоколы дифференциации редко эффективны на 100%. Здесь мы опишем метод для очистки популяции CXCR4 + клеток после дифференцировкив ДЭ с использованием магнитных микрогранул. Эта очистка дополнительно удаляет клетки нежелательных линий. Метод нежной очистки является простым и надежным и может быть использовано для улучшения вниз по течению приложений и дифференциацию.

Introduction

Плюрипотентные стволовые клетки, такие как эмбриональные стволовые клетки (ЭСК) обладают способностью дифференцироваться в практически любой тип клеток человеческого организма. Таким образом, экстракорпоральное протоколы дифференцировки могут быть использованы для создания многочисленных типов зрелых клеток , таких как кардиомиоциты 1, гепатоциты 2, бета - клетки, эпителиальные 3 легких 4 или 5 нейрональных клеток. Это делает ESCS ценным инструментом для потенциального лечения различных дегенеративных заболеваний 3.

Дифференциация в пробирке ЭСК в сторону взрослых тканей легких, печени и поджелудочной железы требует псевдо-гаструляции в клетки , напоминающие окончательное энтодермы (DE) 6. Так как ниже по течению дифференциации по отношению к вышеупомянутым типов соматических клеток значительно менее эффективно, оптимальная дифференциация эндодермы рассматривается как ограничивающий скорость 7. Клетки, которые совершаются в направлении энтодермы линии подвергаются тяracteristic изменения в их профиля экспрессии генов. Гены мастер Плюрипотентность регулятора вниз регулируется, тогда как экспрессия других факторов транскрипции , таких как Foxa2, SOX17, HNF1B, членов семейства GATA и поверхностного рецептора CXCR4 высоко активируемых 6, 8, 9. CXCR4 , как известно, трансактивируется по SMAD2 / 3, ниже по потоку Узловое сигнализации / TGF-бета и SOX17 из - за специфических участков связывания в его промоторной области 10. Таким образом , это очень подходит маркер , используемый в ряде докладов 6, 8, 11-13. Эти изменения экспрессии отражает событие псевдо-гаструляции, в которой ЭСК сначала приобрести характеристики первичной полоски типа клеточной популяции , а затем совершить в энтодермы зародышевого слоя 6.

Тем не менее, протоколы дифференциации редко 100% эффективны , как несколько клеток могут сопротивляться процессу дифференциации или дифференциации по отношению к другим непредвиденным родословных 14. Эти клетки могут отрицательно influeсть дальнейшая дифференциация. Кроме того, остаточные недифференцированные клетки питают большие риски для последующих экспериментов по трансплантации и может привести к тератомы 15-17.

Чтобы удалить эти нежелательные клетки на ранней на поверхности маркера CXCR4 может быть использован для очистки клеток, которые совершаются в направлении DE 18. Здесь мы опишем метод позитивного отбора CXCR4 + клеток от дифференциации культур DE. Для этого поверхность маркер CXCR4 связывается с антителом, которое затем, в свою очередь связывается с магнитными микрогранул. В отличие от жестких условий во время FACS сортировки, Магнитно меченых DE-подобные клетки могут затем легко быть очищены в формате стендовых, используя щадящий метод очистки. Этот протокол обеспечивает простой способ удаления клеточных популяций, противоставших процесса дифференцировки DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Дифференциация человека ESC к Definitive энтодермы

  1. Выращивают человеческих эмбриональных стволовых клеток (ЭСК) в термостате при температуре 37 ° С и 5% CO 2.
  2. Coat новый 6-луночный культуральный планшет с 1 мл матрицы базальной мембраны и инкубировать культуры стеклотару в течение по крайней мере 30 минут при комнатной температуре. Для конкретных деталей просьба обращаться к инструкции соответствующего изготовителя.
  3. Убедитесь , что культивированные человеческие стволовые клетки достигли 80% -90% слитности под микроскопом с использованием низкой кратности (например, 4X). Аспирируйте среды из полостей путем отсасывания среды с стерильную стеклянную пипетку Пастера. Промывают клетки один раз фосфатным буферным раствором солевого раствора (PBS). Для этого, добавьте 2 мл PBS в каждую лунку мягко встряхните тарелку и отсасывать раствора для удаления мертвых клеток и клеточных обломков.
  4. Добавьте 1 мл реагента пассажи раствора фермента бесплатно для бережной диссоциации клеточных кластеров. Инкубируйте клетки при 37 ° С А.Н.d 5% CO 2 до тех пор , пока клетки не показывают явные признаки разрушения на мелкие кластеры.
    Примечание: в зависимости от используемого реагента Время инкубации. Для ферментного раствора без пассирования, указанного в разделе Материалы, время инкубации составляет примерно 7 мин.
  5. Добавляют 1 мл DMEM / F-12 среду и разрушают оставшиеся клеточных агрегатов на отдельные клетки пипетированием вверх и вниз с помощью пипетки 1 мл. Используйте это, чтобы промыть клетки с поверхности и перенести клетки в центрифужную пробирку. Чтобы получить все клетки, промойте каждую лунку с 1 мл DMEM / F-12 среды и добавить среду в центрифужную пробирку.
  6. Центрифуга клетки в течение 5 мин при 300 х г. Аспирируйте супернатант и клетки вновь суспендируют в 5 мл ES клеточной культуральной среде, содержащей 10 мкМ Rho-киназы (ROCK) ингибитор.
  7. Подсчитайте клетки под микроскопом использованием гемоцитометра и семян 150000 - 400000 клеток на 6-луночных или в другой компоновщик пластины, в зависимости от клеточной линии ES, используемой. Использование кульTURE среде , содержащей ингибитор ROCK 10 мкМ , чтобы избежать апоптоза и культивирования клеток в инкубаторе при температуре 37 ° С и 5% CO 2.
  8. Примерно 24 ч после посева аспирата среду с помощью стерильной стеклянной Пастера пипетку и добавьте 2 мл первичной полоски индукционной среде.
    Примечание: Эта среда содержит конечные концентрации 1% глутамина, 0,2% FCS, 5 мкМ Чир-99021 и 50 нг / мл активина А в Advanced RPMI-1640. Как правило, используют в 2 мл среды для культивирования в 6-луночных планшетах.
  9. 48 ч после посева, замените носитель на энтодермы индукционную среду. Культивировать клетки в этой среде в течение еще 48 часов с ежедневной сменой среды.
    Примечание: Эта среда содержит 1% глутамина, 0,2% FCS и 50 нг / мл активин А в Advanced RPMI-1640 среде. Клетки, которые совершаются по отношению к окончательному энтодермы выразить поверхностный маркер CXCR4. Окрашивание CXCR4 может быть использован для количественного определения количества ДЕ-совершенных клеток.
  1. Для последнего 24 ч, но не менее 1 ч до сбора клеток добавляют ингибитор ROCK 10 мкМ в культуральную среду.
  2. Покрыть клеточной культуры посуда , которая будет использоваться для повторного сева с матрицей базальной мембраны, то есть, 12-луночные планшеты для анализа или камеры слайдов КПЦР для иммунофлуоресцентного окрашивания. Инкубируйте пластин или слайды в течение по крайней мере 30 минут при комнатной температуре.
  3. Аспирируйте среду со стерильной стеклянной пастеровской пипеткой из скважин дифференцированных клеток, используемых для окрашивания и / или сортировки.
  4. Добавьте 1 мл реагента пассажи раствора фермента бесплатно для бережной диссоциации клеточных кластеров. Инкубируйте клетки при 37 ° С и 5% CO 2 до тех пор , пока клетки не показывают явные признаки разрушения в небольшие кластеры.
    Примечание: в зависимости от используемого реагента Время инкубации. Для ферментного раствора без пассирования упомянутого в материаALS раздел, время инкубации составляет примерно 7 мин.
  5. Добавляют 1 мл DMEM / F-12 среду и разрушают оставшиеся клеточные агрегаты на отдельные клетки пипетированием вверх и вниз с помощью 1 мл кончик. Используйте это, чтобы промыть клетки с поверхности и перенести клетки в центрифужную пробирку. Для того, чтобы получить все клетки, промойте каждую лунку с 1 мл DMEM / F-12 среды без FCS и добавить среду в центрифужную пробирку.
  6. Граф клеток под микроскопом с использованием гемоцитометра. Клетки из трех лунках 6-луночного планшета должно привести к 10-15 х 10 6 клеток после трех суток дифференцировки. Центрифуга клетки в течение 5 мин при 300 х г.
    Примечание: Точное количество полученных клеток будет зависеть от линии плюрипотентных клеток , используемых для дифференциации.
  7. Аспирируйте супернатант и клетки вновь суспендируют в буфере, содержащем ПЭБ ингибитор ROCK 10 мкМ. Используйте 100 мкл этого буфера до 10 7 клеток. Добавить ингибитор раскачивать 10 мкМ в день stainiнг. Используйте этот буфер для всех последующих применений (называемый ПЭБ буфер + RI).
    Примечание: ПЭБ буфер содержит 0,5% бычьего сывороточного альбумина и 2 мМ ЭДТА в PBS. Если больше клетки должны быть окрашены, регулировать громкость буфера соответственно.
  8. Добавьте 10 мкл антитела CXCR4-АРС на 10 7 клеток в 100 мкл, это примерно представляет собой разведение 1:10.
    Примечание: Использование БТР-связанного антитела не является обязательным. Вместо того, чтобы его можно заменить в зависимости от используемых микрошариков. Если все большее число клеток окрашиваться регулировать громкость антител соответственно.
  9. Смешать, осторожно переворачивая трубку с пальцами и инкубировать при температуре 4 ° С в холодильнике в течение 15 мин. Ресуспендируют клеток с 1-2 мл буфера ПЭБ. Центрифуга клетки в течение 5 мин при 300 х г.
  10. Аспирируйте супернатант со стерильным стеклянным Пастера пипетку и ресуспендируют осадок клеток в 80 мкл PEB на 10 7 клеток и добавляют 20 мкл анти-APC микрогранулы.
    ЗАМЕТКА:
  11. Смешать, осторожно переворачивая трубку с пальцами и инкубировать при температуре 4 ° С в холодильнике в течение 15 мин. Ресуспендируют клеток с 1-2 мл буфера ПЭБ + RI. Центрифуга клетки в течение 5 мин при 300 х г. Аспирируйте буфер. Ресуспендируют в 500 мкл буфера ПЭБ + RI.

3. Магнитное разделение CXCR4 + клеток

  1. Место среднего размера магнитного колонки в магнитном поле в соответствии с инструкциями производства. Предварительно промыть колонку с 500 мкл буфера ПЭБ + RI. Нанести всю клеточную суспензию в колонку. Собирают поток через так как не все клетки связываются с колонкой. Убедитесь в том, чтобы не нарушить столбцы для оптимального извлечения CXCR4 + клеток.
  2. Промыть колонку три раза с 500 мкл буфера ПЭБ + RI. Возьмите первый поток через и объединить его с собранных клеток со стадии 3.1. Удалите магнитную колонку из магнитного поля и поместить его вподходящей коллекции трубки. Добавить 1 мл буфера PEB + RI на колонку. Для элюирования клетки плотно прижимать плунжер в колонну.
  3. Дополнительно: Собрать все поток через образцы отдельно и использовать 20 мкл каждого для анализа количество CXCR4 клеток + с помощью проточной цитометрии. Их число должно уменьшаться с каждым шагом промывки.
    Примечание: По крайней мере , 2 х 10 4 жизнеспособны, забор с воротами клетки должны быть подсчитаны для получения надежных результатов.
  4. Повторите шаги 3.1-3.3 с собранными потока через образец из шага 3.1 и первого потока через образец со стадии 3.2, используя новый столбец. Не повторно использовать предыдущий столбец. С помощью плунжера воздух нагнетается в колонну, которая блокирует его.
  5. Граф клеток под микроскопом с использованием гемоцитометра. В зависимости от эффективности дифференцировке до 6 х 10 6 клеток могут быть отсортированы сначала и еще 1 х 10 6 клеток с помощью второго столбца при использовании 10 7 клеток для процедуры. Центрифуга клетки при 300 мкг в течение 5 мин. Отберите супернатант и стерильной стеклянной Пастера пипетку и ресуспендирования клеток в 1 мл эндодермы индукции среды со стадии 1.9 с дополнительным ингибитором ROCK 10 мкМ.
  6. Граф клеток под микроскопом с использованием гемоцитометра. Семенной клетки при соответствующей плотности, т.е. ~ 4 × 10 5 клеток на лунку 12-луночного планшета (ок. 3,6 см 2 поверхности) или ~ 1,5 × 10 5 клеток на лунку 8-и камерного горкой.

4. Необязательно: Анализ Очищенный Definitive энтодермы населения

  1. Для окрашивания иммунофлюоресценции фиксируют очищенные клетки от стадии 3,7 примерно 24 ч после посева с 4% параформальдегидом и пятна для окончательного энтодермы (DE) и / или плюрипотентности маркерных белков.
    Примечание: Обычно используемые DE маркеры включают Foxa2 и SOX17, обычно используемые маркеры плюрипотентности включают Oct3 / 4, NANOG и SOX2 6, 8.
  2. FoАнализ г RT-КПЦР, собрать очищенные клетки непосредственно или 24 ч после посева, извлечения общей РНК и обратной транскрипции кДНК из извлеченных образцов общей РНК. Используйте 10 нг кДНК в качестве матрицы в реакции RT-КПЦР (трехкратном повторе) для анализа экспрессии DE и плюрипотентности маркеров генов 6, 8.
    Примечание: Обычно используемые маркерные гены упоминаются в шаге 4.1. Условия цикла 5 мин при 95 ° С и 40 циклов 15 с при 95 ° С и 1 мин при 60 ° С, с последующим расплавлением анализа кривых.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

При дифференциации Стволовые клетки претерпевают резкие изменения в гене и экспрессии белка. На рисунке 1 представлена ​​типичные гены - маркеры , которые могут быть использованы для проверки успешной дифференциации энтодермы. Prime цели для анализа экспрессии генов являются GSC, Foxa2 и SOX17. В относительном анализе экспрессии генов особенно Foxa2 и SOX17 увеличиваются> 2000 раз по сравнению с недифференцированных ЭСК. GSC уже выражена очень рано в течение 24 ч при формировании первичной полоски но, тем не менее индуцированное> 100 раз в день четыре. Экспрессия этих генов , следовательно , повышается при сортировке с помощью CXCR4 поверхностный маркер 6. Мастер Плюрипотентность регуляторы , такие как Oct3 / 4 (POU5F1) и NANOG значительно подавлен , хотя экспрессия этих генов еще обнаруживается после четырех дней. Это индикатес , что некоторые клетки не адекватно реагировать на схему лечения с экспрессии гена SOX7 A. Чир-99021 и активин , как правило , на имя дискриминировать образование внеэмбриональной энтодермы против DE. В первом случае SOX17 является коэкспрессии с SOX7 и в последнем случае SOX17 является коэкспрессии с Foxa2. Результаты на рисунке 1 , показывают , что наряду с DE некоторые экстра-эмбриональные клетки могли образоваться во время дифференцировки, хотя мы еще не были в состоянии пятно SOX7 + клеток.

На рисунке 2 показаны различные клеточные популяции, которые присутствуют после дифференцировки ЭСК в DE. На стадии 1 ЭСК высевают в виде отдельных клеток, а затем дифференцированы обработкой Чир-99021 и активин А в течение четырех дней. IF окрашивание DE маркеров SOX17 и Foxa2 (рис 2A) показывает , что оба маркера равномерно со-Expressed в ядрах. Это рассматривается как признак DE обязательств. Тем не менее, некоторые клетки сопротивляются процесса дифференцировки и выражают ни одно из двух маркерных белков DE (рис 2А). На самом деле, две популяции различных клеточных наблюдаются после дифференцировки четыре дня. В то время как многие клетки экспрессируют маркер Foxa2 DE есть еще клетки оставшиеся , которые выражают плюрипотентности маркера SOX2 (рис 2B). Эти два белки экспрессируются в виде двух отдельных групп населения и не коэкспрессией не наблюдается (фиг.2В).

На третий день или четыре дифференцировки поверхностный белок CXCR4 используется для сортировки DE-CXCR4 + совершенное население и тем самым устранить оставшиеся плюрипотентных клеток и других нежелательных линий. В зависимости от эффективности дифференцировки , используемой линии клеток> 80% CXCR4 + клетки могут быть получены с использованием протокола дифференцировки , описанной в шаге 1 8 рисунке 3 приведены проточной цитометрии данных после окрашивания и MACS очистки CXCR4 + клеток после дифференцировки к DE и показана экспрессия общих DE и плюрипотентности белков-маркеров с помощью иммунофлюоресценции (IF) окрашивание до и после очистки MACS. На третий день дифференцировки примерно 60% CXCR4 + клеток с использованием иммунофлуоресцентного окрашивания для CXCR4 , описанной на стадии 2 , были получены (фиг 3А, средняя панель). CXCR4 + клетки перемещаются от Q4 до Q1 после окрашивания с APC конъюгированным антителом анти-CXCR4. После очистки MACS описано в шаге 3 популяция CXCR4 + обогащен до 85%. Процесс очистки, однако, не устраняет все нежелательные клоны из культур (рис 3А, правая панель).

После очистки MACS,то CXCR4 + клетки могут быть посеяны для дальнейшего анализа или необязательно второй раунд сортировки может быть выполнена с получением более высокой степени чистоты, но и к снижению жизнеспособности. До дифференциации широко распространенное выражение плюрипотентности маркера SOX2 (окрашенного в зеленый цвет) обнаруживается IF окрашивания. В отличие от этого , маркер Foxa2 DE (окрашенный в красный цвет) не может быть обнаружено (фигура 3В). На рисунке 3C CXCR4 + клетки окрашивались антителами для Foxa2 (зеленый) и совместно окрашивали для плюрипотентности маркера SOX2 (красный). После высева очищенных CXCR4 + клеток обнаруживаются лишь немногие SOX2 + клетки. Большинство посеянных клеток положительны для маркера Foxa2 DE.

Рисунок 1
Рисунок 1. Типичные изменения в экспрессии генов различных генов плюрипотентности и энтодермы маркеров во время дифференцировки энтодермы четыре дня. (А) 7, лечение с помощью активин только множеством и СА-А (Чир-99021 и активин А) протокол, который используется для MACS сортировочных (подробнее см 8). Средства массовой информации , используемые в-A CA протокола здесь называют в качестве примитивного полоса индукции среды и энтодермы индукционной среде. (В) Показанное экспрессия гена измеряется RT-КПЦР из GSC, SOX17 и Foxa2, которые выражаются при окончательном энтодермы обязательства без далее MACS сортировка. POU5F1 (Oct3 / 4) и NANOG являются регуляторами плюрипотентности и , как правило , вниз регулируется при дифференцировании, в то время как SOX7 выражается в внеэмбриональной энтодермы. Экспрессии генов нормализовали против трех стабильно выраженных генов домашнего хозяйства (<EM> ТБФ, TUBA1A, Г6ФД) приводит к значениям CNRQ. Экспрессия вышеуказанных генов в недифференцированных клеток, был установлен на 1 и изменения нанесены в виде кратности изменения экспрессии генов. Значения являются средние значения ± SEM, п = 4-5. ANOVA плюс Бонферрони постфактум тест. ** P ≤ 0,01 по сравнению с Random и #P ≤ 0,05, ## P ≤ 0,01 по сравнению с RP (все данные в пределах этой цифры были недавно опубликованы в 8). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Различные популяции клеток после дифференцировки энтодермы. (А) Окрашивание DE маркеров SOX17 и Foxa2 с соответствующими антителами на d4 дифференциации показывает их гомогенное совместной локализации. Тем не менее, некоторыеклетки сопротивлялись процесса дифференцировки и не выражают эти маркеры (только синее окрашивание ядра). Слияние зеленого и красного окрашивания показан желтым цветом. (B) После DE дифференциации существуют две популяции различных клеток. DE-подобные клетки экспрессируют Foxa2, тогда как клетки, которые сопротивлялись процесса дифференцировки до сих пор выражают плюрипотентности маркера SOX2. (AB) Ядра контрастно с DAPI (синий). Шкала бар в панели (А) составляет 50 мкм, и в панели (В) составляет 100 мкМ. Визуализацию проводили при 670 нм (красный, Cy5), 520 нм (зеленый, FITC) и 433 нм (голубой, DAPI), соответственно. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. MACS сортировочные дифференцированных клеточных популяций DE и представительное улAining после сортировки. (A) CXCR4 + окрашивали клетки (Q1) обогащены после MACS сортировки. Число CXCR4- клеток (Q4) уменьшается. В зависимости от клеточной линии используются выходы протокола дифференциации> 80% CXCR4-позитивных клеток 8 и MACS могут быть использованы для дальнейшего обогащения их. (B) недифференцированные клетки экспрессируют плюрипотентности маркера SOX2 (зеленый) , но не DE маркер Foxa2 (красный ). (C) После того , как MACS сортировочных только очень немногие недифференцированные Sox2 + клеток остаются (красный), в то время как отсортированный население почти равномерно выражает маркер Foxa2 DE (зеленый). (BC) Ядра контрастно с DAPI (синий). Шкала бар в панели (С) 100 мкм и применяется ко всем панелям. Визуализацию проводили при 670 нм (красный, Cy5), 520 нм (зеленый, FITC) и 433 нм (голубой, DAPI), соответственно. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

В настоящее время используются протоколы дифференциации редко приводят к 100% дифференцированных клеток. По причинам, которые еще должны быть решены некоторые клетки сопротивляются процесса дифференцировки. В зависимости от эффективности используемого протокола дифференцировки и Склонность ESC линии определенное количество остаточных плюрипотентных клеток, как правило, наблюдается даже после дифференцировки в окончательной энтодермы. Эти остаточные клетки могут ухудшить или вниз по течению дифференциацию дальнейшего анализа, такие как транскриптомику, протеомики и анализа экспрессии микроРНК. Остаточные плюрипотентные клетки или другие нежелательные клоны также могут проявляться паракринной эффекты, которые могут помешать целям дифференциации. Следовательно, удаление этих клеток может привести к улучшению воспроизводимости.

Очистку CXCR4 + экспрессирующих эндодермы клетки после дифференцировки могут быть использованы для обогащения этих групп населения и для удаления клеток, противоставших процесса дифференцировки.Маркер белка поверхность ДЕ CXCR4, можно использовать для специфической очистки эндодермы клеток. Протокол очистки MACS под рукой может быть завершена в течение менее 2 часов и может быть выполнен в простом формате настольной в каждой лаборатории клеточной культуры без дорогостоящего лабораторного оборудования и приборов. очистка FACS является широко используемым методом, но использует жесткие условия. Во время FACS очисток клетки, как правило , выдерживают в суспензии в течение продолжительного периода времени , и клетки подвергаются других сложных факторов, например, высокое давление в сопле устройства FACS. По сравнению процедура MACS быстро и нежно. Это улучшает способность клеток к пересев во время снова подсоединить после процесса очистки. Чтобы упростить этот воссоединении ингибитор ROCK добавляется в культуральную среду после того, как и до очистки для предотвращения апоптоза. Другим важным фактором, влияющим на воссоединении плотность, при которой пересевают клетки. Это сильно висимостьDS на используемой клеточной линии. Числа клеток, используемые для посева в этом исследовании, являются репрезентативными количество клеток, которые хорошо работают в наших руках. Тем не менее, может быть необходимо скорректировать эти цифры для различных клеточных линий. Обе эти меры, добавление ингибитора ROCK и оценка числа клеток для пересева, имеют решающее значение для успеха дальнейшей клеточной культуры после сортировки.

С помощью используемого протокола DE дифференцировке обычно> 70% CXCR4 + клетки могут быть получены без сортировки 8. Производительность протокола, используемого для генерации DE последовательно влияет на эффективность последующей очистки протокола MACS. В общем, эффективное дифференцировке (> 80% CXCR4 + клеток) приводит к более высокой чистоты после MACS сортировки (до 95%). Таким образом, использование этого метода очистки уменьшает количество недифференцированных клеток, но, по существу, чистота 100% не может быть достигнута. В будущем, линиеспецифический поверхностные маркеры могут быть определены тшляпа позволит очистку более терминально дифференцированных клеток. Сортировочный процедура MACS является основным выбором для этой цели.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Умелое техническая помощь Jasmin Kresse выражает искреннюю признательность.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics