En hurtig og effektiv metode til rensning af endoderm celler Genereret fra menneskelige embryonale stamceller

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en metode til rensning af differentierede stamceller fra menneskelige embryonale, der er begået mod den endelige endoderm til forbedring af downstream-applikationer og yderligere opdelinger.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Differentieringen kapaciteter pluripotente stamceller såsom embryonale stamceller (EKSF) tillader en potentiel terapeutisk anvendelse for celle udskiftning behandlingsformer. Terminalt differentierede celletyper kan anvendes til behandling af forskellige degenerative sygdomme. In vitro differentiering af disse celler mod væv i lunge, lever og bugspytkirtel kræver som et første skridt generering af endelige endodermale celler. Dette trin er hastighedsbegrænsende for yderligere differentiering i retning terminalt modnet celletyper såsom insulinproducerende betaceller, hepatocytter eller andre endoderm-afledte celletyper. Celler, der er begået mod endoderm afstamning stærkt udtrykke en mangfoldighed af transkriptionsfaktorer, såsom FOXA2, SOX17, HNF1B, medlemmer af GATA-familien, og overfladen receptor CXCR4. Imidlertid, differentiering protokoller er sjældent 100% effektiv. Her beskriver vi en fremgangsmåde til oprensning af et CXCR4 + cellepopulation efter differentieringi DE ved anvendelse af magnetiske mikroperler. Denne oprensning desuden fjerner celler af uønskede afstamninger. Den blide rensningsmetode er hurtig og pålidelig og kan anvendes til at forbedre efterfølgende anvendelser og opdelinger.

Introduction

Pluripotente stamceller såsom embryonale stamceller (EKSF) har kapacitet til at differentiere til stort set enhver celletype af det menneskelige legeme. Således kan in vitro differentieringsfaktorer protokoller anvendes til at danne mange voksne celletyper såsom cardiomyocytter 1, hepatocytter 2, betaceller 3, lunge epitel 4 eller neuronale celler 5. Dette gør økonomiske og sociale råd et værdifuldt redskab til potentiel behandling af forskellige degenerative sygdomme 3.

In vitro differentiering af økonomiske og sociale råd i retning voksent væv i lunge, lever og bugspytkirtel kræver en pseudo-gastrulation i celler, der minder om den endelige endoderm (DE) 6. Da nedstrøms differentiering mod de førnævnte somatiske celletyper er betydeligt mindre effektiv, er en optimal endoderm differentiering betragtes som hastighedsbegrænsende 7. Celler, der er begået mod endoderm afstamning gennemgår characteristic ændringer i deres genekspressionsprofil. Pluripotens hovedregulator gener nedreguleret, mens ekspressionen af andre transkriptionsfaktorer, såsom FOXA2, SOX17, HNF1B, medlemmer af GATA familien og overfladen receptor CXCR4 er stærkt opreguleres 6, 8, 9. CXCR4 vides at blive transaktiveret ved SMAD2 / 3, neden for Nodal / TGF-β-signalering og SOX17 grundet specifikke bindingssteder i sin promoter region 10. Det er således en meget egnet markør, der anvendes i en række rapporter 6, 8, 11-13. Disse udtryk ændringer afspejler en pseudo-gastrulation begivenhed, hvor økonomiske og sociale råd først erhverve karakteristika for en primitivstriberne-lignende celle population og efterfølgende begå ind i endoderm kim lag 6.

Men differentiering protokoller er sjældent 100% effektiv som et par celler kan modstå differentiering proces eller differentiere til andre utilsigtede slægter 14. Disse celler kan have en negativ influeIOU yderligere differentiering. Desuden resterende udifferentierede celler havnen store risici for senere transplantation eksperimenter og kan give anledning til teratomer 15-17.

For at fjerne disse uønskede celler tidligt-på overfladen markør CXCR4 kan anvendes til oprensning af celler, der er begået mod DE 18. Her beskriver vi en fremgangsmåde til positiv udvælgelse af CXCR4 + -celler fra DE differentieringsfaktorer kulturer. Til dette er overfladen markør CXCR4 bundet af et antistof, som derefter på sin side binder til magnetiske mikroperler. I modsætning til de barske betingelser under FACS-sortering, de magnetisk mærkede DE-lignende celler kan derefter nemt oprenses i en benchtop format anvendelse af en forsigtig oprensningsmetode. Denne protokol giver en enkel metode til fjernelse af cellepopulationer, der modstod DE differentiering proces.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Differentiering for Human ESC mod Definitive endoderm

  1. Dyrk humane embryonale stamceller (EKSF) i en inkubator ved 37 ° C og 5% CO2.
  2. Coat en ny 6-cellekulturplade plade med 1 ml af en basalmembran matrix og inkubere kulturen-ware i mindst 30 minutter ved stuetemperatur. For specifikke oplysninger kan du henvende sig til de respektive producentens anvisninger.
  3. Bekræft, at de dyrkede humane økonomiske og sociale råd har nået 80% -90% sammenflydning under mikroskopet med en lav forstørrelse (f.eks 4X). Aspirer mediet fra hulrummene ved sugende off mediet med en steril glas Pasteur-pipette. Vask cellerne én gang med phosphatbufret saltvand (PBS) opløsning. Til dette tilsættes 2 ml PBS til hver brønd sagte ryste pladen og suge off løsning til at fjerne døde celler og cellerester.
  4. Der tilsættes 1 ml enzymfri passage løsning reagens til blid dissociation af celleklynger. Inkuber cellerne ved 37 ° C end 5% CO2 indtil cellerne viser klare tegn på forstyrrelser i små klynger.
    BEMÆRK: Inkubationstiden afhænger af det anvendte reagens. For enzymfri passage opløsning nævnt i afsnittet materialer, inkubationstid er ca. 7 min.
  5. Tilsæt 1 ml DMEM / F-12 medium og forstyrre de resterende celleaggregater i enkelte celler ved at pipettere op og ned med en 1 ml pipettespids. Bruge dette til at skylle af cellerne fra overfladen og overføre cellerne til et centrifugerør. For at hente alle celler, vask hver brønd med 1 ml DMEM / F-12 medium og tilsæt mediet til centrifugerør.
  6. Centrifuger cellerne i 5 minutter ved 300 x g. Aspirere supernatanten og resuspender cellerne i 5 ml ES cellekulturmedium indeholdende 10 uM Rho-kinase (ROCK) inhibitor.
  7. Tæl cellerne under mikroskopet med et hæmocytometer og frø 150.000 - 400.000 celler pr 6 brønde eller i en anden plade layout, afhængigt af ES-cellelinie anvendt. Brug culTURE medium indeholdende 10 uM ROCK inhibitor at undgå apoptose og dyrke cellerne i en inkubator ved 37 ° C og 5% CO2.
  8. Ca. 24 timer efter såning aspirat mediet med en steril glas Pasteur-pipette og tilsæt 2 ml primitivstriberne induktion medium.
    BEMÆRK: Dette medium indeholder slutkoncentrationer på 1% glutamin, 0,2% FCS, 5 pM CHIR-99.021 og 50 ng / ml activin A i Advance RPMI-1640 medium. Almindeligvis bruge 2 ml medium til dyrkning i 6-brønds plader.
  9. 48 timer efter såning, udskifte medium til endoderm induktion medium. Dyrk cellerne i dette medium i yderligere 48 timer med daglig udskiftning af mediet.
    BEMÆRK: Dette medium indeholder 1% glutamin, 0,2% FCS og 50 ng / ml activin A i Advanced RPMI-1640 medium. Celler, der er begået mod den endelige endoderm udtrykker overfladen markør CXCR4. Den farvning af CXCR4 kan bruges til at kvantificere antallet af DE-begået celler.
  1. For den endelige 24 timer men mindst 1 time før høst af cellerne tilsættes 10 uM ROCK inhibitor til dyrkningsmediet.
  2. Coat cellekulturen-ware, der vil blive anvendt til genbrug podning med en basalmembran matrix, dvs. 12-brønds plader for qPCR analyse eller kammerobjektglas til immunfluorescensfarvning. Inkubér pladerne eller lysbilleder i mindst 30 minutter ved stuetemperatur.
  3. Aspirer medium med en steril glas Pasteur-pipette fra brøndene i de differentierede celler, der anvendes til farvning og / eller sortering.
  4. Der tilsættes 1 ml enzymfri passage løsning reagens til den blide dissociation af celleklynger. Inkuber cellerne ved 37 ° C og 5% CO2, indtil cellerne viser klare tegn på forstyrrelser i små klynger.
    BEMÆRK: Inkubationstiden afhænger af det anvendte reagens. For enzymfri passage opløsning nævnt i materials sektion, inkubationstid er omkring 7 min.
  5. Tilsæt 1 ml DMEM / F-12 medium og forstyrre resterende celleaggregater i enkelte celler ved at pipettere op og ned med en 1 ml tip. Bruge dette til at skylle af cellerne fra overfladen og overføre cellerne til et centrifugerør. At hente alle celler, vask hver brønd med 1 ml DMEM / F-12-medium w / o FCS og tilføj mediet til centrifugerør.
  6. Tæl cellerne under mikroskop ved hjælp af en hæmocytometer. Celler fra tre brønde i en plade med 6 brønde bør resultere i 10-15 x 10 6 celler efter tre dages differentiering. Centrifuger cellerne i 5 minutter ved 300 x g.
    BEMÆRK: Det nøjagtige antal opnåede celler vil afhænge af den pluripotente cellelinie anvendes til differentieringen.
  7. Aspirere supernatanten og resuspender cellerne i PEB buffer indeholdende 10 uM ROCK inhibitor. Brug 100 pi af denne puffer i op til 10 7 celler. Tilsæt 10 uM ROCK inhibitor på dagen for staining. Brug denne buffer for alle downstream-applikationer (benævnt PEB buffer + RI).
    BEMÆRK: PEB buffer indeholder 0,5% BSA og 2 mM EDTA i PBS. Hvis flere celler skal farves, justere buffervolumenet tilsvarende.
  8. Tilsæt 10 gl af en CXCR4-APC antistof pr 10 7 celler i 100 pi dette omtrentligt betegner en fortynding på 1:10.
    BEMÆRK: Brugen af et APC-bundet antistof er ikke obligatorisk. I stedet kan være substitueret afhængigt mikroperlerne anvendte. Hvis flere celler skal farves justere antistof volumen tilsvarende.
  9. Bland ved forsigtigt at vende røret med fingrene og inkuberes ved 4 ° C i køleskab i 15 minutter. Resuspender cellerne med 1-2 ml PEB buffer. Centrifuger cellerne i 5 minutter ved 300 x g.
  10. Aspirer supernatanten med en steril glas Pasteur-pipette og resuspender cellepelleten i 80 pi PEB per 10 7 celler og tilsættes 20 pi anti-APC mikroperler.
    NOTE:
  11. Bland ved forsigtigt at vende røret med fingrene og inkuberes ved 4 ° C i køleskab i 15 minutter. Resuspender cellerne med 1-2 ml PEB buffer + RI. Centrifuger cellerne i 5 minutter ved 300 x g. Aspirere bufferen. Resuspender i 500 pi PEB buffer + RI.

3. Magnetisk separation af CXCR4 + -celler

  1. Placer en mellemstor magnetisk kolonne i et magnetfelt som pr fremstilling anvisninger. Pre-skyl kolonnen med 500 pi PEB buffer + RI. Påfør hele cellesuspensionen til søjlen. Saml strømmen gennem så ikke alle celler vil binde til søjlen. Sørg for ikke at forstyrre kolonnerne for optimal hentning af CXCR4 + celler.
  2. Kolonnen udvaskes tre gange med 500 pi PEB buffer + RI. Saml den første flow igennem og kombinere det med de indsamlede celler fra trin 3.1. Fjern den magnetiske kolonne fra magnetfeltet, og læg den i enegnet opsamlingsrør. Tilsæt 1 ml PEB buffer + RI på søjlen. Til eluering cellerne fast trykke ned stemplet ind i søjlen.
  3. Valgfrit: indsamle alle gennemstrømningen prøver separat og bruge 20 pi hver at analysere antallet af CXCR4 + celler ved anvendelse af flowcytometri. Deres nummer skal falde med hvert vaske trin.
    BEMÆRK: Mindst 2 x 10 4 levedygtige, gated celler bør tælles for pålidelige resultater.
  4. Gentages trin 3,1-3,3 med det opsamlede-strømningen gennem prøven fra trin 3.1 og den første strømning gennem prøven fra trin 3.2 under anvendelse af en ny kolonne. Må ikke genbruge tidligere kolonne. Ved at bruge stemplet luft presses ind i søjlen, som blokerer det.
  5. Tæl cellerne under mikroskop ved hjælp af en hæmocytometer. Afhængig af effektiviteten af differentiering op til 6 x 10 6 celler kan sorteres i første omgang og yderligere 1 x 10 6 celler ved anvendelse af en anden søjle ved brug 10 7 celler for proceduren. Centrifugeres cellerne ved 300 x g i 5 min. Aspirer supernatanten og med en steril glas Pasteur-pipette og resuspender cellerne i 1 ml endoderm induktion medium fra trin 1.9 med yderligere 10 pM ROCK inhibitor.
  6. Tæl cellerne under mikroskop ved hjælp af en hæmocytometer. Frø cellerne ved en passende densitet, dvs., ~ 4 x 10 5 celler pr brønd af en 12-brønds plade (app. 3.6 cm2 overflade) eller ~ 1,5 x 10 5 celler pr brønd af en 8-brønds kammer-objektglas.

4. Valgfrit: Analyse af renset Definitive endoderm Befolkning

  1. For immunfluorescensfarvning fastsætte de oprensede celler fra Trin 3.7 omtrent 24 timer efter podning med 4% paraformaldehyd og farves for definitiv endoderm (DE) og / eller pluripotens markørproteiner.
    BEMÆRK: Almindeligt anvendte DE markører omfatter FOXA2 og SOX17, almindeligt anvendte pluripotens markører omfatter OCT3 / 4, NANOG og SOX2 6, 8.
  2. foR RT-qPCR-analyse, høste oprensede celler direkte eller 24 timer efter såning, udtrække total-RNA og omvendt transskribere cDNA fra de ekstraherede total-RNA-prøver. Brug 10 ng cDNA som template pr RT-qPCR reaktion (triplikater) at analysere ekspressionen af DE og pluripotens markørgener 6, 8.
    BEMÆRK: Almindeligt anvendte markørgener er nævnt i trin 4.1. Cycle betingelser er 5 minutter ved 95 ° C og 40 cykler af 15 sekunder ved 95 ° C og 1 min ved 60 ° C, efterfulgt af smeltekurveanalyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

efter differentiering Økonomiske og sociale råd undergå drastiske ændringer i genet og proteinekspression. Figur 1 viser typiske markørgener, der kan bruges til at verificere en vellykket endoderm differentiering. Prime mål for en genekspression analyse er GSC, FOXA2, og SOX17. I en relativ genekspression analyse især FOXA2 og SOX17 er steget med> 2000 gange i forhold til udifferentierede økonomiske og sociale råd. GSC er allerede udtrykt meget tidligt inden 24 timer under primitivstriberne dannelse men det er ikke desto mindre induceret> 100 gange på dag fire. Ekspressionen af disse gener er følgelig forøget ved sortering ved hjælp af CXCR4 overflademarkør 6. Pluripotens master-regulatorer, såsom OCT3 / 4 (POU5F1) og NANOG er signifikant nedreguleret selvom ekspressionen af disse gener er stadig detekterbar efter fire dage. Denne indicates, at nogle celler ikke i tilstrækkelig grad reagerer på behandlingsregime med CHIR-99.021 og activin A. SOX7 genekspression typisk rettet at skelne ekstra embryonale endoderm dannelse mod DE. I det første tilfælde SOX17 er co-udtrykt med SOX7 og i sidstnævnte tilfælde SOX17 er co-udtrykt med FOXA2. Resultaterne i figur 1 viser, at sammen med DE nogle ekstra-embryonale celler kan have dannet under differentiering, selv om vi endnu ikke har været i stand til at farve SOX7 + celler.

Figur 2 illustrerer de forskellige cellepopulationer, der er til stede efter differentieringen af ØSR i DE. I trin 1 økonomiske og sociale råd er seedet som enkelte celler og derefter differentieret ved behandling med CHIR-99.021 og activin A i fire dage. IF farvning af DE markørerne SOX17 og FOXA2 (figur 2A) viser, at begge markører er ensartet co-expressed inden kernerne. Dette betragtes som et adelsmærke for DE engagement. Men nogle celler modstå differentieringsprocessen og hurtig Ingen af de to DE markørproteiner (figur 2A). Faktisk er to forskellige cellepopulationer observeret efter de fire dages differentiering. Mens mange celler udtrykker DE markør FOXA2 der stadig celler tilbage, der udtrykker pluripotens markør SOX2 (figur 2B). Disse to proteiner udtrykkes i to adskilte populationer og ingen co-ekspressionen kan observeres (figur 2B).

På dag tre eller fire af differentiering overfladeproteinet CXCR4 anvendes til at sortere frigøres CXCR4 + populationen og derved fjerne de resterende pluripotente celler og andre uønskede afstamninger. Afhængigt af differentiering effektivitet af det anvendte cellelinie kan opnås> 80% CXCR4 + -celler ved hjælp af differentiering protokollen beskrevet i trin 1 8 Figur 3 viser flowcytometri data efter farvning og MACS oprensning af CXCR4 + celler efter differentiering i retning DE og viser ekspressionen af ​​fælles dE og pluripotens markørproteiner der anvender immunofluorescens (IF) farvning før og efter MACS oprensning. På dag tre af differentiering omkring 60% CXCR4 + celler under anvendelse af immunfluorescensfarvning for CXCR4 beskrevet i trin 2 blev opnået (figur 3A, midterste panel). CXCR4 + celler flytte fra 4. kvartal til 1. kvartal efter farvning med en APC-konjugeret anti-CXCR4 antistof. Efter MACS oprensning beskrevet i trin 3 CXCR4 + populationen er beriget til 85%. Rensningsprocessen, imidlertid ikke fjerne alle uønskede slægter fra kulturerne (figur 3A, højre panel).

Efter MACS oprensningCXCR4 + celler kan podes til yderligere analyse eller eventuelt en anden runde af sortering kan udføres for at give et højere renheder men nedsat levedygtighed. Før Differentiering den udbredte udtryk for pluripotens markør SOX2 (farvet i grønt) detekteres af IF farvning. I modsætning hertil kan ikke registreres DE markør FOXA2 (farvet i rødt) (figur 3B). I figur 3C CXCR4 + celler farves med antistoffer til FOXA2 (grøn) og co-farvet for den pluripotens markør SOX2 (rød). Efter såning af de rensede CXCR4 + celler opdages kun få Sox2 + celler. Størstedelen af ​​podede celler er positive for DE markør FOXA2.

Figur 1
Figur 1. Repræsentative ændringer i genekspression af forskellige pluripotency og endoderm markørgener under en fire dag endoderm differentiering. (EN) 7, A en behandling med activin A alene, og CA-A (CHIR-99.021 og activin A) protokollen, som anvendes til MACS sortering (se detaljer i 8). De medier, der anvendes i CA-En protokol er her benævnt som primitivstriberne induktion medium og endoderm induktion medium. (B) Afbildet er genekspression målt ved RT-qPCR af GSC, SOX17 og FOXA2, som er udtrykt ved definitivt endoderm engagement uden yderligere MACS sortering. POU5F1 (OCT3 / 4) og NANOG er pluripotens regulatorer og typisk nedreguleret på differentiering, mens SOX7 udtrykkes i ekstra-embryonale endoderm. Genekspressionen blev normaliseret mod tre stabilt udtrykte husholdningsgener (<em> TBP, TUBA1A, G6PD), hvilket resulterer i CNRQ værdier. Ekspressionen af ​​de ovennævnte gener i udifferentierede celler blev indstillet til 1, og ændringer er plottet som gange ændring af genekspression. Værdier er middelværdier ± SEM, n = 4-5. ANOVA plus Bonferroni post hoc test. ** P ≤ 0,01 sammenlignet med Random og #P ≤ 0,05, ## P ≤ 0,01 sammenlignet med RP (alle data i dette tal er for nylig blevet offentliggjort i 8). Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Forskellige cellepopulationer efter endoderm differentiering. (A) Farvning af DE markørerne SOX17 og FOXA2 med respektive antistoffer på d4 differentiering afslører deres homogen co-lokalisering. Men nogleceller modstået differentiering proces og ikke udtrykker disse markører (kun blå kerne farvning). Sammenfletningen af grøn og rød farvning er vist med gult. (B) Efter DE differentiering er der to forskellige cellepopulationer. DE-lignende celler udtrykker FOXA2 hvorimod celler, der modstod differentieringsprocessen stadig udtrykke pluripotens markør SOX2. (AB) Kerner blev modfarvet med DAPI (blå). Scale bar i panel (A) er 50 um, og i panel (B) er 100 uM. Imaging blev udført ved 670 nm (rød, Cy5), 520 nm (grøn, FITC) og 433 nm (blå, DAPI), henholdsvis. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. MACS sortering af differentierede DE cellepopulationer og repræsentative staining efter sortering. (A) CXCR4 + farvede celler (Q1) er beriget efter MACS sortering. Antallet af CXCR4- celler (Q4) er faldet. Afhængigt af den cellelinie, der anvendes differentieringen protokol udbytter> 80% CXCR4-positive celler 8 og MACS kan anvendes til yderligere at berige dem. (B) udifferentierede celler udtrykker pluripotens markør SOX2 (grøn), men ikke den DE markør FOXA2 (rød ). (C) Efter MACS sortering kun meget få udifferentieret Sox2 + celler forbliver (rød), mens det sorterede befolkning næsten ensartet udtrykker dE markør FOXA2 (grøn). (BC) Kerner blev modfarvet med DAPI (blå). Scale bar i panel (C) er 100 um og gælder for alle paneler. Imaging blev udført ved 670 nm (rød, Cy5), 520 nm (grøn, FITC) og 433 nm (blå, DAPI), henholdsvis. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Øjeblikket anvendes differentieringsfaktorer protokoller sjældent resultere i 100% differentierede celler. Af grunde, der endnu skal løses nogle celler modstå differentiering proces. Afhængigt af effektiviteten af ​​den anvendte differentiering protokollen og tilbøjelighed ØSU linje et bestemt antal resterende pluripotente celler er almindeligt observeret selv efter differentiering i den endelige endoderm. Disse resterende celler kan forringe downstream opdelinger eller yderligere analyse såsom transcriptomics, proteomics og miRNA ekspressionsanalyse. Resterende pluripotente celler eller andre uønskede slægter kan også udvise parakrine virkninger, der kan forstyrre de differentiering mål. Derfor kan fjernelse af disse celler resultere i forbedret reproducerbarhed.

Oprensningen af ​​CXCR4 + udtrykkende endoderm celler efter differentiering kan anvendes til at berige disse populationer og for at fjerne celler, der modstod differentieringsprocessen.Overfladen DE-markørprotein CXCR4 kan anvendes til den specifikke oprensning af endoderm celler. Den MACS rensning protokol ved hånden kan være afsluttet inden for mindre end 2 timer og kan udføres på en enkel bænk top-format i hver celle kultur lab uden dyrt laboratorieudstyr og enheder. FACS rensning er en almindeligt anvendt teknik, men beskæftiger barske forhold. Under FACS oprensninger celler der normalt holdes i suspension i en længere periode, og cellerne er underkastet andre udfordrende faktorer, fx højt tryk i tuden af FACS-enheden. Til sammenligning er hurtig og skånsom MACS procedure. Dette forbedrer cellernes evne til at vedhæfte under reseeding efter oprensningsprocessen. For yderligere at lette denne refiksation en ROCK inhibitor tilsættes til dyrkningsmediet efter og før oprensningen for at forhindre apoptose. En anden vigtig faktor, der påvirker refiksation er massefylden ved hvilke celler reseeded. Denne stærkt DEPENds på den anvendte cellelinje. De celleantal anvendt til podning i denne undersøgelse er repræsentative celleantal, der fungerer godt i vores hænder. Men der kan være nødvendigt at justere disse numre for forskellige cellelinier,. Begge foranstaltninger, tilsætning af en ROCK inhibitor og evalueringen af ​​celleantal for tilsået, er afgørende for en vellykket gennemførelse af yderligere cellekultur efter sorteringen.

Med den anvendte DE differentiering protokol kan opnås typisk> 70% CXCR4 + celler uden at sortere 8. Udførelsen af ​​den anvendte protokol til DE generation følge heraf påvirker effektiviteten af ​​den efterfølgende MACS rensning protokol. Generelt effektiv differentiering (> 80% CXCR4 + celler) giver en højere renhed efter MACS sortering (op til 95%). Således brugen af ​​denne oprensningsmetode reducerer antallet af udifferentierede celler i det væsentlige, men 100% renhed ikke kan opnås. I fremtiden kan defineres linjespecifikke overflademarkører that vil tillade oprensningen af ​​flere terminalt differentierede celler. MACS sortering procedure er det primære valg til dette formål.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Den dygtige teknisk bistand fra Jasmin Kresse er taknemmeligt anerkendt.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics