En rask og effektiv metode for rensing av endoderm celler generert fra humane embryonale stamceller

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi metode til rent differensierte humane stamceller som begått mot definitive endoderm for forbedring nedstrøms søknader og ytterligere differentiations.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Differensieringen egenskapene til pluripotente stamceller som embryonale stamceller (ESCs) tillate en potensiell terapeutisk anvendelse for celle erstatning terapi. Terminalt differensierte celletyper kan brukes for behandling av forskjellige degenerative sykdommer. In vitro differensiering av disse cellene overfor vev i lunger, lever og bukspyttkjertel krever som et første trinn dannelsen av definitive endodermal celler. Dette trinnet er hastighetsbegrensende for ytterligere differensiering mot døds modnet celletyper som insulinproduserende betaceller, leverceller eller andre endoderm-avledet celletyper. Celler som er begått mot endoderm avstamning sterkt uttrykke et mangfold av transkripsjonsfaktorer som FOXA2, SOX17, HNF1B, medlemmer av GATA familien, og overflaten reseptor CXCR4. Men differensiering protokoller er sjelden 100% effektiv. Her beskriver vi en fremgangsmåte for rensing av en CXCR4 + cellepopulasjon etter differensieringinn i DE ved hjelp av magnetiske mikroperler. Dette rensing fjerner tillegg celler av uønskede linjer. Den milde rensemetode er rask og pålitelig og kan brukes til å forbedre nedstrøms applikasjoner og differensieringer.

Introduction

Pluripotente stamceller slik som embryonale stamceller (ESCS) har evnen til å differensiere i praktisk talt en hvilken som helst celletype av menneskekroppen. Således kan in vitro differensiering protokoller brukes til å generere en rekke voksen celletyper som for eksempel kardiomyocytter 1, hepatocytter 2, beta-cellene 3, lunge epitelial 4 eller 5 nevronale celler. Dette gjør ESCs et verdifullt verktøy for potensiell behandling av ulike degenerative sykdommer 3.

Den in vitro differensiering av ESCs mot voksent vev i lunge, lever og bukspyttkjertel krever en pseudo-gastrulation inn i celler som minner om den definitive endoderm (DE) 6. Siden nedstrøms differensiering mot de nevnte somatiske celletyper er betydelig mindre effektiv, er en optimal endoderm differensiering regnes som hastighetsbegrensende 7. Celler som er begått mot endoderm avstamning gjennomgå chagent endringer i genekspresjon profilen. Pluripotency stam regulatoriske gener er nedregulert, mens ekspresjonen av andre transkripsjonsfaktorer slik som FOXA2, SOX17, HNF1B, medlemmer av Gata familien og den overflatereseptoren CXCR4 er sterkt oppregulert 6, 8, 9. CXCR4 er kjent for å være transactivated ved SMAD2 / 3, nedstrøms Nodal / TGF-β signalering og SOX17 skyldes spesifikke bindingssteder i sin promoter region 10. Således er det et svært egnet markør som brukes i en rekke rapporter 6, 8, 11-13. Disse uttrykk endringene reflekterer en pseudo-gastrulation hendelse, der ESCs først få egenskapene til en primitiv strek-lignende cellepopulasjon og deretter begå inn i endoderm bakterie lag 6.

Men differensiering protokoller er sjelden 100% effektiv som noen celler kan motstå differensiering prosess eller skille mot andre utilsiktede linjene 14. Disse cellene kan ha negativ influensaNCE ytterligere differensiering. Videre gjenværende udifferensierte celler båtplass stor risiko for senere transplantasjon eksperimenter og kan gi opphav til teratomas 15-17.

For å fjerne disse uønskede celler tidlig på overflaten markør CXCR4 kan brukes for rensingen av celler som er begått mot DE 18. Her beskriver vi en fremgangsmåte for positiv utvelgelse av CXCR4 + -celler fra DE differensierings kulturer. For dette er den overflatemarkør CXCR4 bindes av et antistoff, som deretter i sin tur binder seg til magnetiske mikrokuler. I motsetning til de tøffe forholdene under FACS sortering, de magnetisk merket DE-lignende celler kan da lett bli renset i en benkeplate Bøk format med en mild rensemetode. Denne protokollen tilveiebringer en grei metode for fjerning av cellepopulasjoner som motsto DE differensieringsprosessen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Differensiering av menneskelig ESC mot Definitive endoderm

  1. Dyrke humane embryonale stamceller (ESCs) i en inkubator ved 37 ° C og 5% CO 2.
  2. Belegge en ny 6-brønners cellekulturplate med 1 ml av en basalmembran matrise og inkubere kulturen-ware i minst 30 minutter ved romtemperatur. For spesifikke detaljer vennligst slå til den respektive produsentens instruksjoner.
  3. Kontroller at dyrkede humane ESCs har nådd 80% -90% konfluens under mikroskopet ved hjelp av en lav forstørrelse (f.eks 4X). Aspirere mediet fra hulrommene ved å suge av det medium med en steril glass Pasteur pipette. Vask cellene en gang med fosfatbufret saltvann (PBS) løsning. For dette, tilsett 2 ml PBS til hver brønn sakte riste plate og suge ut løsningen for å fjerne døde celler og celleavfall.
  4. Tilsett 1 ml enzymfritt aging løsning reagent for skånsom dissosiasjon av cellegruppene. Inkuber cellene ved 37 ° C end 5% CO 2 til cellene viser klare tegn til avbrudd i små klynger.
    MERK: Inkubasjonstiden er avhengig av reagens. For enzym-fri aging oppløsning som er nevnt i materialseksjonen, er inkubasjonstid omtrent 7 min.
  5. Tilsett 1 ml DMEM / F-12 medium og forstyrre de resterende celleaggregater i enkeltceller ved å pipettere opp og ned ved hjelp av en 1 ml pipette. Bruk av dette for å skylle cellene fra overflaten og overføre cellene til en sentrifugering tube. For å hente alle celler, vask hver brønn med 1 ml DMEM / F-12 medium og tilsett medium til den sentrifugerøret.
  6. Sentrifuger cellene i 5 min ved 300 x g. Aspirer supernatanten og resuspender cellene i 5 ml ES-cellekulturmedium inneholdende 10 uM Rho-kinase (ROCK) inhibitor.
  7. Tell cellene i mikroskop ved bruk av et hemocytometer og frø 150000 - 400 000 celler per 6-brønn, eller i en annen plate layout, avhengig av ES-cellelinje som brukes. bruk culture medium inneholdende 10 uM ROCK-inhibitor for å unngå apoptose og kultur ble cellene i en inkubator ved 37 ° C og 5% CO2.
  8. Omtrent 24 timer etter såing aspirer mediet med en steril glass Pasteur pipette og tilsett 2 ml primitive streak induksjon medium.
    MERK: Dette mediet inneholder sluttkonsentrasjoner på 1% glutamin, 0,2% FCS, 5 mikrometer tsjir-99021 og 50 ng / ml activin A i Avansert RPMI-1640 medium. Vanligvis bruke 2 ml medium for dyrking i 6-brønns plater.
  9. 48 timer etter såing, erstatte mediet til endoderm induksjon medium. Dyrke celler i dette mediet for en annen 48 timer med daglig medium endring.
    MERK: Dette mediet inneholder 1% glutamin, 0,2% FCS og 50 ng / ml activin A i Avansert RPMI-1640 medium. Celler som er begått mot den definitive endoderm uttrykke overflaten markør CXCR4. Farging av CXCR4 kan brukes til å kvantifisere antallet DE-begått celler.
  1. For den endelige 24-timers men minst 1 time før innhøsting av cellene tilsettes 10 uM ROCK-inhibitor til kulturmediet.
  2. Coat cellekultur-ware som vil bli brukt for re-seeding med en basalmembran matrise, dvs. 12-brønners plater for qPCR analyse eller kammer lysbilder for immunfluorescens farging. Inkuber platene eller sider i minst 30 minutter ved romtemperatur.
  3. Aspirer medium med en steril glass Pasteur pipette fra brønnene til de differensierte celler som anvendes for farging og / eller sortering.
  4. Tilsett 1 ml enzym-fri aging løsning reagens for den milde dissosiasjon av cellegrupper. Inkuber cellene ved 37 ° C og 5% CO2 inntil cellene viser tydelige tegn til avbrudd i små klynger.
    MERK: Inkubasjonstiden er avhengig av reagens. For enzym-fri aging oppløsning som er nevnt i materials delen, er inkubasjonstiden omtrent 7 min.
  5. Tilsett 1 ml DMEM / F-12 medium og forstyrre resterende celleaggregater i enkeltceller ved å pipettere opp og ned ved hjelp av en 1 ml tips. Bruk av dette for å skylle cellene fra overflaten og overføre cellene til en sentrifugering tube. For å hente alle celler, vask hver brønn med 1 ml DMEM / F-12 medium w / o FCS og legge til mediet til den sentrifugerøret.
  6. Telle celler i mikroskop ved hjelp av en hemocytometer. Celler fra tre brønner i en 6-brønns plate bør resultere i 10-15 x 10 6-celler etter tre dager med differensiering. Sentrifuger cellene i 5 min ved 300 x g.
    NB: Det nøyaktige antallet som oppnås cellene vil avhenge av pluripotent cellelinje som brukes for differensiering.
  7. Aspirer supernatanten og resuspender cellene i PEB-buffer inneholdende 10 uM ROCK inhibitor. Bruk 100 ul av denne buffer i opptil 10 7 celler. Tilsett 10 uM ROCK-inhibitor på dagen for staining. Bruk denne buffer for alle nedstrømsapplikasjoner (referert til som PEB buffer + RI).
    MERK: PEB buffer inneholder 0,5% BSA og 2 mM EDTA i PBS. Dersom flere celler skal være farget, justere buffervolumet tilsvarende.
  8. Tilsett 10 pl av en CXCR4-APC-antistoff per 10 7-celler i 100 ul, dette utgjør omtrent en fortynning på 1:10.
    MERK: Bruken av en APC bundet antistoff er ikke obligatorisk. I stedet kan erstattes avhengig av mikroperler som brukes. Dersom flere celler skal være farget justere antistoffet volumet tilsvarende.
  9. Bland forsiktig ved å vende røret med fingrene og inkuber ved 4 ° C i et kjøleskap i 15 minutter. Resuspender cellene med 1-2 ml PEB buffer. Sentrifuger cellene i 5 min ved 300 x g.
  10. Aspirer supernatanten med en steril glass Pasteur pipette og cellepelleten suspenderes i 80 mL PEB per 10 7 celler og tilsett 20 mL anti-APC mikroperler.
    NOTAT:
  11. Bland forsiktig ved å vende røret med fingrene og inkuber ved 4 ° C i et kjøleskap i 15 minutter. Suspender cellene med 1-2 ml PEB buffer + RI. Sentrifuger cellene i 5 min ved 300 x g. Aspirer buffer. Resuspender i 500 mL PEB buffer + RI.

3. Magnetic Separasjon av CXCR4 + Cells

  1. Plasser en mellomstor magnetisk kolonne i et magnetisk felt i henhold til fabrikantens an-. Pre-skyll kolonnen med 500 mL PEB buffer + RI. Gjelde hele cellesuspensjonen til kolonnen. Samle strømmen gjennom ettersom ikke alle celler vil binde seg til kolonnen. Sørg for ikke å forstyrre kolonnene for optimal gjenfinning av CXCR4 + celler.
  2. Vask kolonnen tre ganger med 500 ul PEB buffer + RI. Samle den første strømmen gjennom og kombinere det med de innsamlede cellene fra trinn 3.1. Fjern den magnetiske kolonnen fra det magnetiske feltet og plassere den i enpassende oppsamlingsrør. Tilsett 1 ml PEB buffer + RI på kolonnen. For å eluere cellene bestemt trykk ned stempelet inn i kolonnen.
  3. Valgfritt: samle all strøm gjennom prøvene separat og bruke 20 mL hver for å analysere antall CXCR4 + celler ved hjelp av flowcytometri. Deres tall bør avta med hvert vasketrinn.
    MERK: Minst 2 x 10 4 levedyktig, gated celler skal regnes for pålitelige resultater.
  4. Gjenta trinn 3,1-3,3 med den oppsamlede-strømmen gjennom prøven fra trinn 3.1 og den første strømmen gjennom prøven fra trinn 3.2 ved hjelp av en ny kolonne. Ikke gjenbruke den forrige kolonnen. Ved hjelp av stempelet luft presses inn i søylen, som blokkerer den.
  5. Telle celler i mikroskop ved hjelp av en hemocytometer. Avhengig av effektiviteten av differensieringen opp til 6 x 10 6 celler kan sorteres initialt og en annen 1 x 10 6 celler ved hjelp av en andre kolonne ved bruk av 10 7-celler for prosedyren. Sentrifuger cellene ved 300 xg i 5 minutter. Aspirer supernatanten og med et sterilt glass Pasteur pipette og resuspender cellene i 1 ml endoderm induksjonsmedium fra trinn 1.9 med ytterligere 10 uM ROCK inhibitor.
  6. Telle celler i mikroskop ved hjelp av en hemocytometer. Seed cellene på et passende tetthet, dvs. ~ 4 x 10 5 celler per brønn i en 12-brønns plate (app. 3,6 cm 2 overflate) eller ~ 1,5 x 10 5 celler per brønn av en 8-brønn kammer-lysbilde.

4. Valgfritt: Analyse av renset Definitive endoderm Befolknings

  1. For immunfluorescens farging feste de rensede celler fra trinn 3.7 omtrent 24 timer etter utsåing med 4% paraformaldehyd og beis for definitiv endoderm (DE) og / eller pluripotency markørproteiner.
    MERK: Vanligvis brukes DE markører FOXA2 og SOX17, brukte pluripotency markører OCT3 / 4, Nanog og SOX2 6, 8.
  2. for RT-qPCR-analyse, høste de rensede celler direkte eller 24 timer etter såing, ekstrahere total-RNA og revers transkribere cDNA fra de ekstraherte total-RNA prøver. Bruk 10 ng cDNA som mal per RT-qPCR reaksjon (tre paralleller) for å analysere uttrykk for DE og pluripotency markørgener 6, 8.
    MERK: Vanlig brukte markørgener er nevnt i trinn 4.1. Syklus betingelser er 5 min ved 95 ° C og 40 sykluser med 15 sek ved 95 ° C og 1 min ved 60 ° C, etterfulgt av smelting kurve analyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ved differensiering ESCs gjennomgå drastiske endringer i genet og proteinekspresjon. Figur 1 viser typiske markørgener som kan brukes for å bekrefte en vellykket endoderm differensiering. Førsteklasses mål for en genekspresjonsanalyse er GSC, FOXA2, og SOX17. I en relativ genekspresjonsanalyser spesielt FOXA2 og SOX17 er økt med> 2000 ganger i forhold til udifferensierte ESCs. GSC allerede uttrykt veldig tidlig i 24-timers løpet primitive streak formasjon men det er likevel indusert> 100 ganger på dag fire. Ekspresjonen av disse genene er følgelig økes ved sortering ved hjelp av CXCR4 overflatemarkør 6. Pluripotency mester regulatorer som OCT3 / 4 (POU5F1) og Nanog er betydelig nedregulert selv om uttrykket av disse genene er fortsatt påvises etter fire dager. dette indicates at enkelte celler ikke tilstrekkelig på behandlingsregimet med tsjir-99021 og activin A. SOX7 genuttrykk er vanligvis adressert til diskriminere ekstra-embryonale endoderm formasjon mot DE. I det første tilfellet SOX17 er ko-uttrykt med SOX7 og i sistnevnte tilfelle SOX17 er ko-uttrykt med FOXA2. Resultatene i figur 1 viser at sammen med DE noen ekstra-embryonale celler kan ha dannet under differensiering, selv om vi ennå ikke har vært i stand til å farge SOX7 + celler.

Figur 2 illustrerer de forskjellige cellepopulasjoner som er til stede etter differensiering av ESCs inn i DE. I trinn 1 ESCs er seedet som enkeltceller og deretter differensiert ved behandling med tsjir-99021 og activin A for fire dager. IF farging av DE markører SOX17 og FOXA2 (figur 2A) viser at begge merkene er jevnt co-eksplisittd innenfor kjernene. Dette anses som et kjennetegn på DE engasjement. Men noen celler motstå differensiering prosessen og uttrykker ingen av de to DE markørproteiner (figur 2A). Faktisk er to distinkte cellepopulasjoner observert etter fire dagers differensiering. Mens mange celler uttrykker DE markør FOXA2 det fortsatt celler gjenværende som uttrykker pluripotency markør SOX2 (figur 2B). Disse to proteinene blir uttrykt i to atskilte populasjoner og ingen co-ekspresjon kan bli observert (figur 2B).

På dag tre eller fire av differensiering overflateproteinet CXCR4 brukes til å sortere DE-engasjerte CXCR4 + -populasjonen og derved fjerne de gjenværende pluripotente celler og andre uønskede linjene. Avhengig av differensiering effektiviteten av den anvendte cellelinjen> 80% CXCR4 + celler kan oppnås ved hjelp av differensiering protokollen som er beskrevet i trinn 1 8 Figur 3 viser flowcytometri data etter farging og MACS rensing av CXCR4 + -celler etter differensiering mot DE og viser ekspresjonen av vanlige dE og pluripotency markørproteiner ved hjelp av immunfluorescens (IF) farging før og etter MACS rensing. På dag tre av differensiering omtrent 60% CXCR4 + celler ved hjelp av immunfluorescens farging for CXCR4 beskrevet i trinn 2, ble erholdt (figur 3A, midtre panel). CXCR4 + celler flytte fra Q4 til Q1 på farging med en APC konjugert anti-CXCR4 antistoff. Etter MACS-rensningen beskrevet i trinn 3 CXCR4 + populasjonen er anriket til 85%. Renseprosessen, men ikke eliminere alle uønskede slektsnavn fra kulturer (figur 3A, høyre panel).

Etter MACS rensing,CXCR4 + -celler kan seeded for ytterligere analyse eller eventuelt en andre runde med sortering kan utføres for å gi høyere renhet, men redusert levedyktighet. Før Differensiering utbredt uttrykk for pluripotency markør SOX2 (farget i grønt) blir oppdaget av IF farging. I kontrast, kan DE markør FOXA2 (farget rødt) ikke oppdages (figur 3B). I figur 3C CXCR4 + cellene er farget med antistoffer for FOXA2 (grønn) og er co-farget for pluripotency markør SOX2 (rød). Etter såing av de rensede CXCR4 + -celler bare få SOX2 + celler er detektert. Flertallet av seeded cellene er positive for DE markør FOXA2.

Figur 1
Figur 1. Representative endringer i genuttrykk forskjellige pluripotency og endoderm markørgener i løpet av en fire dagers endoderm differensiering. (EN) 7, A en behandling med aktivin A alene, og CA-A (Chir-99021 og aktivin A) protokollen, som brukes for MACS sortering (se detaljer i åtte). Mediene brukes i CA-A-protokollen blir her omtalt som primitive streak induksjon medium og endoderm induksjon medium. (B) Avbildet er genuttrykk målt ved RT-qPCR av GSC, SOX17 og FOXA2, som er uttrykt ved definitive endoderm engasjement uten ytterligere MACS sortering. POU5F1 (OCT3 / 4) og Nanog er pluripotency regulatorer og vanligvis nedregulert på differensiering, mens SOX7 er uttrykt i ekstra-embryonale endoderm. Den genekspresjon ble normalisert mot tre stabilt uttrykt housekeeping gener (<em> TBP, TUBA1A, G6PD) resulterer i CNRQ verdier. Ekspresjonen av de ovenfor nevnte gener i udifferensierte celler ble satt til 1 og endringer er plottet som gangers skifte av genekspresjon. Verdier er gjennomsnitt ± SEM, n = 4-5. ANOVA pluss Bonferroni sin post hoc test. ** P ≤ 0,01 sammenlignet med tilfeldig og #P ≤ 0,05, ## P ≤ 0,01 sammenlignet med RP (alle data innenfor dette tallet har nylig blitt publisert i åtte). Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Ulike cellepopulasjoner etter endoderm differensiering. (A) Farging av DE markører SOX17 og FOXA2 med respektive antistoffer på d4 av differensiering avslører deres homogen samlokalisering. Men noenceller motsto differensiering prosess og ikke uttrykke disse markørene (blå kjernen farging only). Sammenslåingen av grønn og rød farging er vist i gult (B) Etter DE differensiering det er to forskjellige cellepopulasjoner.. DE-lignende celler uttrykker FOXA2 mens celler som motstått differensiering prosessen fortsatt uttrykker pluripotency markør SOX2. (AB) Kjerner ble kontra med DAPI (blå). Scale bar i panelet (A) er 50 mikrometer og i panelet (B) er 100 mikrometer. Imaging ble utført ved 670 nm (rød, Cy5), 520 nm (grønn, FITC) og 433 nm (blå, DAPI), henholdsvis. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. MACS sortering av differensierte DE celle populasjoner og representant stinnelukker etter sortering. (A) CXCR4 + fargede celler (Q1) er beriket etter MACS sortering. Antallet CXCR4- celler (Q4) er redusert. Avhengig av cellelinjen som brukes de differensiering-protokollen utbytter> 80% CXCR4-positive celler 8 og MACS kan anvendes for å berike dem. (B) udifferensierte celler uttrykker pluripotency markør SOX2 (grønn), men ikke den DE markør FOXA2 (rød ). (C) Etter MACS sorterings bare svært få udifferensiert SOX2 + celler forblir (rød), mens den sorterte befolkningen nesten jevnt uttrykker dE markør FOXA2 (grønn). (BC) Kjerner ble kontra med DAPI (blå). Scale bar i panelet (C) er 100 mikrometer og gjelder for alle paneler. Imaging ble utført ved 670 nm (rød, Cy5), 520 nm (grønn, FITC) og 433 nm (blå, DAPI), henholdsvis. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

For tiden anvendes differensieringsprotokoller sjelden resultere i 100% differensierte celler. Av grunner som fortsatt må tas opp noen celler motstå differensieringsprosessen. Avhengig av effektiviteten av den brukte protokoll differensiering og tilbøyelighet til ESC linje et visst antall av gjenværende pluripotente celler blir ofte observert selv etter differensiering til den definitive endoderm. Disse gjenværende cellene kan svekke nedstrøms differentiations eller videre analyse som transcriptomics, proteomikk og miRNA uttrykk analyse. Rest pluripotente celler eller andre uønskede linjer kan også vise paracrine effekter som kan forstyrre med differensiering mål. Følgelig kan fjerning av disse cellene føre til forbedret reproduserbarhet.

Rensingen av CXCR4 + uttrykk endoderm celler etter differensiering kan brukes for å anrike disse populasjonene, og for å fjerne celler som motstått den differensieringsprosessen.Overflaten DE markørprotein CXCR4 kan anvendes for den spesifikke rensing av endoderm celler. Den MACS renseprotokoll for hånden kan være ferdig i løpet av mindre enn to timer og kan utføres på en enkel benk topp format i hver celle kultur lab uten dyre laboratorieutstyr og enheter. FACS rensing er en vanlig brukt teknikk, men benytter tøffe forhold. Under FACS-rensinger celler blir vanligvis holdes i suspensjon i en forlenget tidsperiode, og cellene er utsatt for andre vanskelige forhold, for eksempel høyt trykk i dysen i FACS-enheten. Til sammenligning MACS prosedyren er rask og skånsom. Dette forbedrer cellenes evne til å feste løpet reseeding etter renseprosessen. For ytterligere å lette denne reattachment en ROCK-inhibitor tilsettes til kulturmediet etter og før rensingen for å forhindre apoptose. En annen viktig faktor som påvirker reattachment er densiteten ved hvilken celler blir sådd på nytt. Denne sterkt DEPENds på den anvendte cellelinjen. De celle tall som brukes til seeding i denne studien er representative celle tall som fungerer godt i våre hender. Imidlertid kan det være behov for å justere disse tallene for forskjellige cellelinjer. Begge tiltak, tillegg av en ROCK hemmer og evalueringen av celle tall for reseeding, er avgjørende for å lykkes i den videre cellekultur etter sortering.

Med brukes DE differensiering protokollen vanligvis> 70% CXCR4 + celler kan oppnås uten sortering 8. Utførelsen av protokollen som brukes for generering DE påvirker consequentially effektiviteten av den etterfølgende MACS renseprotokoll. Generelt er effektiv differensiering (> 80% CXCR4 + celler) gir en høyere renhet etter MACS sortering (opptil 95%). Således er bruken av denne rensemetode reduserer antallet udifferensierte celler i det vesentlige, men 100% renhet ikke kan oppnås. I fremtiden kan avstamning spesifikke overflatemarkører defineres tlue vil tillate rensing av flere terminalt differensierte celler. Den MACS sortering Prosedyren er den viktigste valget for dette formålet.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Den dyktige teknisk assistanse av Jasmin Kresse er takknemlig erkjent.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics