En snabb och effektiv metod för rening av endoderm celler genereras från mänskliga embryonala stamceller

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här beskriver vi en metod för rening av differentierade stamceller från mänskliga embryon som begås mot den slutgiltiga endoderm för förbättring av tillämpningar i efterföljande led och ytterligare indelningar.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Differentieringen kapacitet pluripotenta stamceller som embryonala stamceller (ESC) att en potentiell terapeutisk tillämpning för cellersättningsbehandlingar. Terminalt differentierade celltyper skulle kunna användas för behandling av olika degenerativa sjukdomar. In vitro-differentiering av dessa celler mot vävnader i lunga, lever och pankreas kräver som ett första steg generering av slutgiltiga endodermala celler. Detta steg är hastighetsbegränsande för ytterligare differentiering mot terminalt mognade celltyper såsom insulinproducerande betaceller, hepatocyter eller andra endoderm-härledda celltyper. Celler som begås mot endoderm linjen uttrycker starkt en mängd transkriptionsfaktorer såsom FOXA2, SOX17, HNF1B medlemmar av GATA familjen, och ytreceptor CXCR4. Emellertid differentieringsprotokoll är sällan 100% effektiv. Här beskriver vi en metod för rening av en CXCR4 + cellpopulation efter differentieringi DE med hjälp av magnetiska mikropärlor. Denna rening avlägsnar dessutom celler av oönskade härstamningar. Den milda reningsmetoden är snabb och tillförlitlig och kan användas för att förbättra applikationer och indelningar nedströms.

Introduction

Pluripotenta stamceller t.ex. embryonala stamceller (ESCS) har förmågan att differentiera till praktiskt taget alla celltyper i den mänskliga kroppen. Sålunda kan differentiering in vitro protokollen användas för att generera ett stort antal vuxna celltyper såsom kardiomyocyter 1, hepatocyter 2, betaceller 3, lung epithelial 4 eller neuronala celler 5. Detta gör ekonomiska och sociala råd ett värdefullt verktyg för potentiell behandling av olika degenerativa sjukdomar 3.

In vitro-differentiering av ekonomiska och sociala råd till vuxna vävnader i lungorna, levern och bukspottkörteln kräver en pseudo-gastrulation i celler som påminner om den slutgiltiga endoderm (DE) 6. Eftersom nedströms differentiering mot nämnda somatiska celltyper är betydligt mindre effektiva, är en optimal endoderm differentiering betraktas som hastighetsbegränsande 7. Celler som begås mot endoderm härstamning genomgå characteristic förändringar i deras genuttryck profil. Pluripotens masterregulatorn gener ner reglerad, medan uttrycket av andra transkriptionsfaktorer såsom FOXA2, SOX17, HNF1B medlemmar av GATA familjen och ytreceptor CXCR4 är mycket uppregleras 6, 8, 9. CXCR4 är känt att transaktiveras av Smad2 / 3, nedströms Nodal / TGF-β signalering och SOX17 på grund av specifika bindningsställen i sin promotorregion 10. Det är således en mycket lämplig markör som används i ett antal rapporter 6, 8, 11-13. Dessa uttryck förändringar återspeglar en pseudo-gastrulation händelse, där ekonomiska och sociala råd först förvärva egenskaperna hos en primitivstrimman liknande cellpopulationen och därefter begå i endoderm GRODDBLAD 6.

Men differentieringsprotokoll är sällan 100% effektiv som ett fåtal celler kan motstå differentieringsprocess eller skilja mot andra oavsiktliga linjer 14. Dessa celler kan negativt influeiou ytterligare differentiering. Dessutom kvarvarande odifferentierade celler hyser stora risker för senare transplantation experiment och kan ge upphov till teratom 15-17.

För att avlägsna dessa oönskade celler tidigt på ytan markör CXCR4 kan användas för rening av celler som begås mot DE 18. Här beskriver vi en metod för positiv selektion av CXCR4 + celler från DE differentierings kulturer. För detta är ytan markör CXCR4 bindas av en antikropp, som sedan i sin tur binder till magnetiska mikropärlor. Till skillnad från de svåra förhållandena under FACS-sortering, de magnetiskt märkta DE-liknande celler kan sedan enkelt renas i en bordsformat med användning av en mild reningsmetod. Detta protokoll ger en enkel metod för avlägsnande av cellpopulationer som motstod differentieringsprocessen DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Differentiering av Human ESC mot definitiva endoderm

  1. Odla mänskliga embryonala stamceller (ESC) i en inkubator vid 37 ° C och 5% CO2.
  2. Belägga en ny 6-brunnars cellodlingsplatta med 1 ml av en basalmembranmatris och inkubera kulturen-ware under åtminstone 30 min vid RT. För specifika detaljer vänd dig till respektive tillverkarens anvisningar.
  3. Bekräfta att de odlade humana ekonomiska och sociala råd har nått 80% -90% konfluens i mikroskop med hjälp av en låg förstoring (t.ex. 4X). Aspirera mediet från håligheterna genom att suga bort mediet med en steril glas Pasteur-pipett. Tvätta cellerna en gång med fosfatbuffrad saltlösning (PBS) lösning. För detta, tillsätt 2 ml PBS till varje brunn mjukt skaka plattan och suga ut lösningen för att avlägsna döda celler och cellrester.
  4. Tillsätt 1 ml enzymfri passaging lösning reagens för skonsam dissociation av cellkluster. Inkubera cellerna vid 37 ° C end 5% CO2 tills cellerna visar tydliga tecken på störningar i små kluster.
    OBS: Inkubationstiden beror på reagens som används. För den enzymfria passage lösning som nämns i avsnittet material, är inkubationstiden ungefär 7 minuter.
  5. Tillsätt 1 ml DMEM / F-12-medium och störa de återstående cellaggregat till enstaka celler genom pipettering upp och ned med hjälp av en 1 ml pipettspets. Använda detta för att spola cellerna från ytan och överföra celler till ett centrifugrör. Att hämta alla celler, tvätta varje brunn med 1 ml DMEM / F-12-medium och tillsätt mediet till centrifugeringsröret.
  6. Centrifugera cellerna under 5 min vid 300 x g. Aspirera supernatanten och återsuspendera cellerna i 5 ml ES-cellkulturmedium innehållande 10 ^ M Rho-kinas (ROCK) hämmare.
  7. Räkna cellerna under mikroskop med användning av en hemocytometer och utsäde 150.000 - 400.000 celler per 6-brunn eller i en annan plattslayouten, beroende på ES-cellinjen användes. användning culture medium innehållande 10 | iM ROCK-inhibitor för att undvika apoptos och odla cellerna i en inkubator vid 37 ° C och 5% CO2.
  8. Approximativt 24 h efter sådd aspirera mediet med en steril glas Pasteurpipett och tillsätt 2 ml primitivstrimman induktionsmedium.
    OBS: Detta medium innehåller slutliga koncentrationer av 1% glutamin, 0,2% FCS, 5 | iM CHIR-99021 och 50 ng / ml aktivin A i Advanced RPMI-1640-medium. Vanligen använda 2 ml medium för odling i 6-brunnars plattor.
  9. 48 timmar efter sådd, byta mediet till endoderm induktionsmedium. Odla cellerna i detta medium under ytterligare 48 h med daglig mediumbyte.
    OBS: Detta medium innehåller 1% glutamin, 0,2% FCS och 50 ng / ml aktivin A i Advanced RPMI-1640-medium. Celler som begås mot den slutgiltiga endoderm uttrycker ytan markör CXCR4. Färgningen av CXCR4 kan användas för att kvantifiera antalet DE-begåtts celler.
  1. För den slutliga 24 h men åtminstone 1 h före skörd av cellerna tillsätt 10 ^ M ROCK-inhibitor till kulturmediet.
  2. Belägga cellkultur-ware som kommer att användas för återsådd med ett basalmembran matris, dvs., 12-brunnars plattor för qPCR analys eller kammare diabilder för immunofluorescensinfärgning. Inkubera plattorna eller glider under minst 30 min vid RT.
  3. Aspirera mediet med en steril glas Pasteur-pipett från brunnarna i de differentierade celler som används för färgning och / eller sortering.
  4. Tillsätt 1 ml enzymfri passaging lösning reagens för den milda dissociation av cellkluster. Inkubera cellerna vid 37 ° C och 5% CO2 tills cellerna visar tydliga tecken på störningar i små kluster.
    OBS: Inkubationstiden beror på reagens som används. För enzymet fria passaging lösning nämns i materials avsnitt, är inkubationstiden ungefär 7 min.
  5. Tillsätt 1 ml DMEM / F-12-medium och störa återstående cellaggregat till enstaka celler genom pipettering upp och ned med hjälp av en 1 ml tips. Använda detta för att spola cellerna från ytan och överföra celler till ett centrifugrör. Att hämta alla celler, tvätta varje brunn med 1 ml DMEM / F-12-medium w / o FCS och tillsätt mediet till centrifugeringsröret.
  6. Räkna cellerna under mikroskop med hjälp av en hemocytometer. Celler från tre brunnar i en 6-brunnsplatta bör resultera i 10-15 x 10 6 celler efter tre dagar av differentiering. Centrifugera cellerna under 5 min vid 300 x g.
    OBS: Det exakta antalet erhållna celler kommer att bero på den pluripotenta cellinjen som används för differentieringen.
  7. Aspirera supernatanten och återsuspendera cellerna i PEB-buffert innehållande 10 ^ M ROCK-inhibitor. Använda 100 | il av denna buffert för upp till 10 7-celler. Tillsätt 10 ^ M ROCK-hämmare på dagen för staining. Använd denna buffert för alla tillämpningar nedströms (benämnda PEB buffert + RI).
    OBS: PEB-buffert innehåller 0,5% BSA och 2 mM EDTA i PBS. Om fler celler skall färgas, justera buffertvolym i enlighet därmed.
  8. Tillsätt 10 mikroliter av en CXCR4-APC-antikropp per 10 7 celler i 100 ^, detta motsvarar ungefär en utspädning av 1:10.
    Märk: Användning av en APC-kopplad antikropp är inte obligatoriskt. I stället kan det ersättas beroende på mikropärlor som används. Om fler celler skall färgas justera antikroppvolymen i enlighet därmed.
  9. Blanda genom att försiktigt vända röret med fingrarna och inkubera vid 4 ° C i ett kylskåp i 15 min. Resuspendera cellerna med 1-2 ml PEB buffert. Centrifugera cellerna under 5 min vid 300 x g.
  10. Aspirera supernatanten med en steril glas Pasteurpipett och resuspendera cellpelleten i 80 pl PEB per 10 7 celler och tillsätt 20 pl anti-APC mikropärlor.
    NOTERA:
  11. Blanda genom att försiktigt vända röret med fingrarna och inkubera vid 4 ° C i ett kylskåp i 15 min. Resuspendera cellerna med 1-2 ml PEB buffert + RI. Centrifugera cellerna under 5 min vid 300 x g. Aspirera bufferten. Resuspendera i 500 pl PEB buffert + RI.

3. Magnetisk separation av CXCR4 + celler

  1. Placera en medelstor magnetisk kolonn i ett magnetfält som per tillverkning instruktioner. Pre-skölj kolonnen med 500 | j, l PEB-buffert + RI. Tillämpa hela cellsuspensionen till kolonnen. Samla flödet genom, då inte alla celler kommer att binda till kolonnen. Se till att inte störa kolumnerna för optimal hämtning av CXCR4 + celler.
  2. Tvätta kolonnen tre gånger med 500 | il PEB-buffert + RI. Samla in det första flödet genom och kombinera den med de uppsamlade cellerna från steg 3,1. Ta bort den magnetiska kolonnen från magnetfältet och placera den i enlämplig provröret. Tillsätt 1 ml PEB-buffert + RI på kolonnen. Att eluera cellerna Pressa nedåt kolven in i kolonnen.
  3. Valfritt: Samla allt flöde genom prov separat och använda 20 pl vardera för att analysera antalet CXCR4 + celler genom att använda flödescytometri. Deras antal ska minska med varje tvättsteg.
    OBS: Minst 2 x 10 4 livskraftig, gated celler bör räknas för tillförlitliga resultat.
  4. Upprepa steg från 3,1 till 3,3 med det insamlade-flödet genom provet från steg 3,1 och det första flödet genom prov från steg 3,2 med hjälp av en ny kolumn. Återanvänd inte använda den tidigare kolumnen. Genom att använda kolven luft pressas in i kolonnen, som blockerar den.
  5. Räkna cellerna under mikroskop med hjälp av en hemocytometer. Beroende på effektiviteten av differentiering upp till 6 x 10 6 celler kan sorteras initialt och ytterligare 1 x 10 6 celler genom användning av en andra kolonn vid användning av 10 7-celler för att utföra proceduren. Centrifugera cellerna vid 300 xg under 5 min. Aspirera supernatanten och med en steril glas Pasteurpipett och återsuspendera cellerna i en ml endoderm induktionsmedium från steg 1,9 med ytterligare 10 pM ROCK-inhibitor.
  6. Räkna cellerna under mikroskop med hjälp av en hemocytometer. Ympa cellerna vid en lämplig densitet, dvs ~ 4 x 10 5 celler per brunn i en 12-brunnars platta (app. 3,6 cm 2 yta) eller ~ 1,5 x 10 5 celler per brunn i en 8-brunnars kammarobjektglas.

4. Valfritt: Analys av renat definitiva endoderm Population

  1. För immunofluorescensinfärgning fastställa renade celler från steg 3,7 ungefär 24 timmar efter sådd med 4% paraformaldehyd och fläck för definitiv endoderm (DE) och / eller pluripotens markörproteiner.
    OBS: Vanligen används DE markörer inkluderar FOXA2 och SOX17, som vanligen används pluripotens markörer inkluderar OCT3 / 4, NANOG och Sox2 6, 8.
  2. for RT-qPCR analys, skörda de renade cellerna direkt eller 24 timmar efter sådd, extrahera total-RNA och omvänt transkribera cDNA från de extraherade total-RNA-prov. Använd 10 ng cDNA som mall per RT-qPCR reaktion (tre exemplar) för att analysera uttrycket av DE och pluripotens markörgener 6, 8.
    OBS: Vanligen använda markörgener nämns i steg 4,1. Cykelförhållanden är 5 min vid 95 ° C och 40 cykler av 15 sek vid 95 ° C och 1 min vid 60 ° C, följt av smältkurvanalys.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

vid differentiering ESCs genomgår drastiska förändringar i gen- och proteinuttryck. Figur 1 visar typiska markörgener som kan användas för att kontrollera en framgångsrik endoderm differentiering. Primära mål för ett genuttryck analys GSC, FOXA2 och SOX17. I en relativ genexpressionsanalys särskilt FOXA2 och SOX17 ökas med> 2000-faldigt jämfört med odifferentierade ekonomiska och sociala råd. GSC uttrycks redan tidigt inom 24 timmar under primitivstrimman bildning men det är icke desto mindre induceras> 100-faldigt på dag fyra. Uttrycket av dessa gener är följaktligen ökas vid sortering med användning av CXCR4 ytmarkören 6. Pluripotens master- regulatorer såsom OCT3 / 4 (POU5F1) och NANOG är signifikant nedreglerade även om uttrycket av dessa gener är fortfarande detekterbar efter fyra dagar. denna indicates att vissa celler inte tillräckligt svarar på behandlingsregimen med CHIR-99021 och aktivin A. SOX7 genuttryck typiskt riktar sig till diskriminera extra embryonala endoderm bildning mot DE. I det första fallet är SOX17 samuttrycktes med SOX7 och i det senare fallet SOX17 samuttrycks med FOXA2. Resultaten i figur 1 visar att tillsammans med DE några extra-embryoniska celler kan ha bildats under differentiering, även om vi ännu inte har kunnat färga SOX7 + celler.

Figur 2 illustrerar de olika cellpopulationer som är närvarande efter det att differentiering av ESCs in i DE. I Steg 1 ESCs ympas som enskilda celler och sedan differentieras genom behandling med CHIR-99021 och aktivin A i fyra dagar. IF-färgningen av den DE markörer SOX17 och FOXA2 (figur 2A) visar att båda markörerna är enhetligt sam-expressed inom kärnorna. Detta anses vara ett kännetecken för DE engagemang. Men vissa celler motstå differentieringsprocess och uttrycker ingen av de två DE markörproteiner (Figur 2A). I själva verket är två distinkta cellpopulationer observerades efter fyra dagars differentiering. Medan många celler uttrycker DE markör FOXA2 det fortfarande finns celler kvar som uttrycker pluripotens markör Sox2 (Figur 2B). Dessa två proteiner uttrycks i två separata populationer och ingen samexpression kan observeras (Figur 2B).

På dag tre eller fyra av differentiering ytproteinet CXCR4 används för att sortera återtas CXCR4 + befolkningen och därigenom avlägsna de återstående pluripotenta celler och andra oönskade linjerna. Beroende på differentieringseffektiviteten hos den använda cellinjen> 80% CXCR4 + celler kan erhållas med hjälp av differentiering protokoll som beskrivs i Steg 1 8 Figur 3 visar flödescytometri data efter färgning och MACS rening av CXCR4 + celler efter differentiering mot DE och visar expressionen av gemensamma dE och pluripotens markörproteiner med användning av immunfluorescens (IF) färgning före och efter MACS rening. På dag tre av differentiering ungefär 60% CXCR4 + celler med immunofluorescens färgning för CXCR4 beskrivs i steg 2 erhölls (figur 3A, mellersta panel). CXCR4 + celler flyttar från Q4 till Q1 vid färgning med en APC konjugerad anti-CXCR4 antikropp. Efter MACS rening beskrivs i steg 3 CXCR4 + populationen anrikas till 85%. Reningsprocessen är emellertid inte eliminerar alla oönskade härstamningar från kulturerna (Figur 3A, höger panel).

Efter MACS rening,CXCR4 + celler kan sås för ytterligare analys eller eventuellt en andra omgång av sortering kan utföras för att ge högre renheter men minskad livsduglighet. Före differentiering utbredda uttryck för pluripotens markör Sox2 (färgade i grönt) detekteras av IF färgning. I motsats härtill kan den DE markör FOXA2 (färgade i rött) inte detekteras (figur 3B). I figur 3C CXCR4 + celler färgas med antikroppar för FOXA2 (grön) och är co-färgades för pluripotens markör Sox2 (röd). Efter ympning av de renade CXCR4 + celler endast ett fåtal Sox2 + celler detekteras. Majoriteten av de sådda cellerna är positiva för DE markör FOXA2.

Figur 1
Figur 1. Representativa förändringar i genuttryck av olika pluripotens och endoderm markörgener under en fyra dagars endoderm differentiering. (EN) 7, A en behandling med aktivin A ensam, och CA-A (CHIR-99021 och aktivin A) protokollet, som används för MACS sortering (se detaljer i 8). De medier som används i CA-A-protokollet är här kallad primitivstrimman induktionsmedium och endoderm induktion medium. (B) avbildas den genuttryck mätt med RT-qPCR av GSC, SOX17 och FOXA2, som uttrycks på definitiv endoderm åtagande utan ytterligare MACS sortering. POU5F1 (OCT3 / 4) och NANOG är pluripotens regulatorer och typiskt nedreglerade vid differentiering, medan SOX7 uttrycks i extra-embryo endoderm. Genuttrycket normaliserades mot tre stabilt uttryckta housekeeping-gener (<em> TBP, TUBA1A, G6PD), vilket gav CNRQ värden. Uttrycket av de ovan nämnda generna i odifferentierade celler var satt till 1 och förändringar plottas som faldig förändring av genuttryck. Värden är medelvärden ± SEM, n = 4-5. ANOVA plus Bonferronis post hoc-test. ** P ≤ 0,01 jämfört med Random och #P ≤ 0,05, ## P ≤ 0,01 jämfört med RP (alla data i denna siffra har nyligen publicerats i 8). Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Olika cellpopulationer efter endoderm differentiering. (A) Färgning av DE markörer SOX17 och FOXA2 med respektive antikroppar på d4 av differentiering avslöjar deras homogen samlokalisering. Emellertid vissaceller motstod differentieringsprocessen och inte uttrycker dessa markörer (blå kärna endast färgning). Sammanslagningen av grönt och rött färgning visas i gult. (B) Efter DE differentiering finns två distinkta cellpopulationer. DE-liknande celler uttrycker FOXA2 medan celler som motstånd differentieringsprocessen uttrycker fortfarande pluripotens markör Sox2. (AB) Kärnor motfärgades med DAPI (blå). Skalstrecket i panel (A) är 50 um och i panel (B) är 100 ^ M. Imaging utfördes vid 670 nm (röd, Cy5), 520 nm (grön, FITC) och 433 nm (blå, DAPI), respektive. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. MACS sortering av differentierade DE cellpopulationer och representativ staining efter sortering. (A) CXCR4 + färgade celler (Q1) anrikas efter MACS sortering. Antalet CXCR4-celler (Q4) minskas. Beroende på cellinje som används för differentiering protokollet ger> 80% CXCR4-positiva celler 8 och Mac kan användas för att ytterligare berika dem. (B) odifferentierade celler uttrycker pluripotens markör Sox2 (grön) men inte DE markör FOXA2 (röd ). (C) Efter MACS sortering endast mycket få odifferentierade Sox2 + celler förblir (röd), medan den sorterade populationen uttrycker nästan jämnt dE markör FOXA2 (grön). (BC) Kärnor motfärgades med DAPI (blå). Skala bar i panelen (C) är 100 pm och gäller för alla paneler. Imaging utfördes vid 670 nm (röd, Cy5), 520 nm (grön, FITC) och 433 nm (blå, DAPI), respektive. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

För närvarande används differentieringsprotokoll sällan resulterar i 100% differentierade celler. Av skäl som fortfarande måste lösas vissa celler motstå differentieringsprocessen. Beroende på effektiviteten av den använda differentieringsprotokoll och benägenheten hos ESK linje ett visst antal kvarvarande pluripotenta celler är vanliga även efter differentiering till den slutgiltiga endoderm. Dessa kvarvarande celler kan försämra indelningar nedströms eller ytterligare analys såsom transkriptomik, proteomik och miRNA expressionsanalys. Kvarvarande pluripotenta celler eller andra oönskade linjer kan också uppvisa parakrina effekter som kan störa de differentierings mål. Följaktligen kan avlägsnande av dessa celler resultera i förbättrad reproducerbarhet.

Reningen av CXCR4 + uttrycka endoderm celler efter differentiering kan användas för att berika dessa populationer och för att avlägsna celler som motstånd differentieringsprocessen.Ytan DE markörproteinet CXCR4 kan användas för specifika rening av endoderm celler. MACS reningsprotokollet till hands kan slutföras inom mindre än två timmar och kan utföras på ett enkelt bänk format i varje cellodling labb utan dyra laboratorieutrustning och anordningar. FACS rening är en ofta använd teknik men använder svåra förhållanden. Under FACS renings celler vanligtvis hålls i suspension under en längre tid och cellerna är föremål för andra utmanande faktorer, t ex högt tryck i munstycke FACS anordningen. I jämförelse MACS förfarande är snabb och skonsam. Detta förbättrar cellernas förmåga att återansluta under återsådd efter reningsprocessen. För att ytterligare underlätta detta återfästning en ROCK-inhibitor tillsätts till odlingsmediet efter och före reningen för att förhindra apoptos. En annan viktig faktor som påverkar återfäst är densiteten vid vilken cellerna reseeded. Detta depen starktds på den använda cellinjen. Siffrorna cell som används för sådd i denna studie är representativa cellantal som fungerar bra i våra händer. Emellertid kan det finnas behov av att justera dessa siffror för olika cellinjer. Båda åtgärderna, tillsats av en ROCK-inhibitor och utvärdering av cellnummer för omläggning, är kritiska för framgången för den ytterligare cellkultur efter sorteringen.

Med den använda DE differentieringsprotokoll typiskt> 70% CXCR4 + celler kan erhållas utan sortering 8. Utförandet av protokoll som används för DE generation påverkar följdriktigt effektiviteten i efterföljande MACS reningsprotokollet. I allmänhet, effektiv differentiering (> 80% CXCR4 + celler) ger en högre renhet efter MACS sortering (upp till 95%). Således, användningen av denna reningsmetod minskar antalet odifferentierade celler väsentligen men 100% renhet inte kan uppnås. I framtiden kan härstamningsspecifika ytmarkörer definieras thatt kommer att möjliggöra rening av fler terminalt differentierade celler. MACS sorteringsproceduren är det viktigaste urvals för detta ändamål.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Skicklig tekniskt bistånd från Jasmin Kresse är tacksamma.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics