İnsan Embriyonik Kök Hücreleri Yaratılan Endoderm Hücrelerinin Saflaştırılması Hızlı ve Etkin Yöntem

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, alt uygulamalar ve diğer farklılıklar iyileştirilmesi için kesin endoderm doğru kararlı farklılaştırılmış insan embriyonik kök hücrelerinin saflaştırılması için bir yöntem açıklanmaktadır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

embriyonik kök hücrelerin (ESCs) halinde pluripotent kök hücrelerin farklılaşması yetenekleri hücre yenileme terapisi için potansiyel bir terapötik uygulama sağlar. Terminal olarak farklılaşmış hücre türleri., Çeşitli dejeneratif hastalıkların tedavisinde kullanılan, akciğer, karaciğer ve pankreas dokularında karşı bu hücrelerin in vitro farklılaşma, bir birinci basamak olarak kesin endodermal hücrelerinin üretilmesini gerektirir edilebilir. Bu adım, oran-sınırlayıcı insülin üreten beta hücrelerinin hepatositlere ya da diğer endoderm türetilmiş hücre türleri terminal olgun hücre tipleri yönünde daha fazla türev içindir. endoderm soy doğru kararlıyız Hücreler çok böyle FOXA2, SOX17, HNF1B GATA aile üyeleri ve yüzey reseptörü CXCR4 olarak transkripsiyon faktörlerinin çok sayıda ifade eder. Ancak, farklılaşma protokolleri nadiren% 100 etkilidir. Burada, farklılaşma sonra CXCR4 + hücre popülasyonunun saflaştırılması için bir yöntem açıklanmaktadırManyetik mikroboncuklarm kullanarak DE içine. Bu saflaştırma ek istenmeyen soy hücreleri ortadan kaldırır. yumuşak bir saflaştırma yöntemi, hızlı ve güvenilir olduğu ve aşağı doğru uygulamalar ve farklılaşmaları geliştirmek için kullanılabilir.

Introduction

embriyonik kök hücrelerin (ESCs) halinde pluripotent kök hücreleri, insan vücudunun hemen hemen herhangi bir hücre türü ayırt etmek yeteneğine sahiptir. Bu nedenle, in vitro farklılaşma protokolleri, kardiyomiyositlerde 1, hepatositler 2, beta hücreleri 3 akciğer epitelyal 4 ya da nöronal hücrelerin 5 gibi çok sayıda yetişkin hücre türleri oluşturmak için de kullanılabilir. Bu ESCS çeşitli dejeneratif hastalıkların 3 potansiyel tedavisi için değerli bir araç sağlar.

Akciğer, karaciğer ve pankreas yetişkin dokularda doğru EKH in vitro farklılaşma kesin endoderm (DE) 6 andıran hücreleri içine bir sözde Gastrulasyon gerektirir. Bahsedilen somatik hücre tiplerinin üzerinden aşağı doğru farklılaşma önemli ölçüde daha az etkili olduğu için, optimal bir endoderm farklılaşma 7 oran-sınırlayıcı olarak kabul edilir. endoderm soy doğru kararlıyız Hücreler cha geçmesigen ekspresyon profili Karakteristik değişir. Pluripotensin ana düzenleyici genler aşağı düzenlenir gibi 9. CXCR4 Smad2 tarafından Transaktive bilinmektedir FOXA2, SOX17, HNF1B GATA aile üyeleri ve CXCR4 yüksek 6 yukarı düzenlenen bir yüzey reseptörü, 8, diğer transkripsiyon faktörleri salınımı / 3, bağlı, destekleyici bölgesi 10'da spesifik bağlanma sitelerine düğüm / TGF-β sinyalizasyon ve SOX17 aşağı doğru. Böylece raporları 6, 8, 11-13, bir dizi kullanılan çok uygun bir belirtecidir. Bu sentezleme değişiklikler ESCs ilk ilkel bir çizgi-benzeri hücre popülasyonunun özelliklerini kazanmak ve daha sonra endoderm tohumu tabaka 6 olarak tamamlama olan bir sözde-Gastrulasyon etkinliği yansıtmaktadır.

Birkaç hücre farklılaşma sürecine karşı veya diğer istenmeyen soyları 14 doğru ayırt edilebilir Ancak, farklılaşma protokolleri nadiren% 100 etkilidir. Bu hücreler, negatif ha olabilirnce ileri farklılaşma. Ayrıca, artık farklılaşmamış hücreler daha sonra transplantasyon deneyler için büyük riskler barındıran ve teratom 15-17 sebebiyet verebilir.

Erken yüzey işaretleyici CXCR4 DE 18 doğru işlenen hücrelerin saflaştırılması için de kullanılabilir, bu istenmeyen hücreleri çıkarmak için. Burada, DE farklılaşma kültürlerinden CXCR4 + hücreleri pozitif seçim için bir yöntem tarif eder. Bunun için, yüzey işaretleyici CXCR4 daha sonra da manyetik mikro boncuklar bağlanan bir antikor ile bağlıdır. FACS sıralama sırasında zorlu koşullarda farklı olarak, manyetik olarak etiketlenmiş DE-benzeri hücreler, daha sonra kolayca hafif bir saflaştırma yöntemi kullanılarak bir tezgah üstü bir biçimde saflaştırılabilir. Bu protokol, DE farklılaşma sürecine karşı hücre popülasyonlarının çıkarılması için basit bir yöntem sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Kesin endoderm doğru İnsan ESC 1. Farklılaşma

  1. 37 ° C'de bir kuluçka insan embriyonik kök hücreleri (ESCs) yetiştirmek ve% 5 CO2.
  2. Coat bazal membran matris 1 ml yeni 6 oyuklu hücre kültürü plakasının ve oda sıcaklığında en az 30 dakika süre ile kültür eşya inkübe edin. Belirli ayrıntılar için ilgili üreticinin talimatlarına çevirmek lütfen.
  3. Kültürlü insan EKH (örneğin, 4X) düşük büyütme kullanılarak mikroskop altında% 80 -90% confluency ulaşmış emin olun. steril cam Pasteur pipetiyle orta kapalı emerek boşluklardan gelen orta aspire. Fosfat tamponlu tuz (PBS) çözeltisi ile bir kez hücreler yıkanır. Bunun için, usulca her kuyuya 2 ml PBS eklemek plaka sallamak ve ölü hücreleri ve hücre enkaz kaldırmak için çözüm emmek.
  4. hücre kümeleri nazik ayrışması için enzim içermeyen pasajlama çözüm reaktif 1 ml ekleyin. 37 ° C, bir hücreleri inkübed% 5 CO 2 hücreleri küçük kümeler halinde bozulma net işaretler göstermek kadar.
    NOT: İnkübasyon süresi kullanılan reaktif bağlıdır. malzemeler bölümünde belirtilen enzim içermeyen pasajlama çözümü için, kuluçka süresi yaklaşık 7 dk.
  5. 1 mi DMEM / F-12 ortamı ilave edin ve pipetleme ve 1 ml pipet ucu kullanarak aşağı tek bir hücre içine kalan hücre birikintisinin yok. yüzey hücreleri temizleme ve bir santrifüjleme tüp hücreleri aktarmak için kullanın. Tüm hücreler almak için, DMEM / F-12 ortamı, 1 ml her bir yıkama ve santrifüj tüpüne orta ekleyin.
  6. g x 300, 5 dakika boyunca hücreler santrifüj. Süpernatant aspire ve 10 uM, Rho-kinaz (rock) inhibitörü içeren 5 ml ES hücre kültürü ortamında tekrar süspansiyon hücreleri.
  7. hemasitometre kullanarak mikroskop altında hücrelerin sayısı ve 150.000 tohum - kullanılan ES hücre hattı bağlı, 6-kuyu başına ya da başka bir plaka taslağına 400.000 hücreleri. Kullanım cul37 ° C ve% 5 CO2 seviyesinde apoptozu ve kültür, bir kuluçka makinesi içinde hücreleri önlemek için orta ihtiva eden 10 uM ROCK inhibitörü Ture.
  8. Yaklaşık 24 saat steril cam Pasteur pipet ile orta aspirat tohumlama ve ilkel çizgi indüksiyon orta 2 ml ekleyin sonra.
    NOT: Bu ortam Gelişmiş RPMI-1640 ortamı içinde% 1 glutamin,% 0.2 FCS, 5 uM CHIR-99.021 ve 50 ng / ml, aktivin A'nın nihai konsantrasyonlar içerir. Genel olarak, 6 oyuklu plakalar içinde kültivasyonu için ortam 2 ml kullanın.
  9. 48 saat tohumlama sonra, indüksiyon orta endoderm için orta yerine. Günlük bir değiştirilen ortam içinde bir 48 saat daha, bu ortam içinde hücrelerin kültive edilmesi.
    NOT: Bu ortam Gelişmiş RPMI-1640 ortamı içinde% 1 glutamin,% 0.2 FCS ve 50 ng / ml aktivin A ihtiva etmektedir. Kesin endoderm doğru kararlıyız Hücreler yüzey işaretleyici CXCR4 ifade eder. CXCR4'ün boyama DE-işlenen hücrelerin sayısını belirlemek için kullanılabilir.
  1. hasat öncesi son 24 saatte, ancak en az 1 saat süre ile hücre kültür ortamına 10 uM ROCK önleyici.
  2. Kat yani bazal membran matrisi ile yeniden oluşturma, kullanılacak hücre kültürü ürünleri, immünofloresan boyama qPCR analiz veya oda slaytlar 12 oyuklu plakalar. Oda sıcaklığında en az 30 dakika boyunca plakaları veya slaytlar inkübe edin.
  3. boyama ve / veya sıralama için kullanılan farklılaşmış hücrelerin kuyulardan steril cam Pasteur pipet ile orta aspire.
  4. hücre kümeleri nazik ayrışması için enzim içermeyen pasajlama çözüm reaktif 1 ml ekleyin. Hücreler küçük kümeler halinde bozulma net belirtileri göstermeye kadar CO 2 37 ° C'de inkübe hücreleri ve% 5.
    NOT: İnkübasyon süresi kullanılan reaktif bağlıdır. Bakır Aynalar belirtilen enzim içermeyen pasajı çözümü içinals bölümü, kuluçka süresi yaklaşık 7 dk.
  5. 1 ml DMEM / F-12 orta ekleyin ve yukarı pipetleme ve 1 ml ucunu kullanarak aşağı tek hücre içine hücre agrega kalan bozabilir. yüzey hücreleri temizleme ve bir santrifüjleme tüp hücreleri aktarmak için kullanın. Tüm hücreler almak için, / FCS O W, DMEM / F-12 ortamı, 1 ml her bir yıkama ve santrifüj tüpüne orta ekleyin.
  6. hemasitometre kullanarak mikroskop altında hücreleri saymak. 6 yuvalı plaka üç kuyu hücre farklılaşmasının üç gün sonra 10-15 x 10 6 hücre ile sonuçlanmalıdır. g x 300, 5 dakika boyunca hücreler santrifüj.
    Not: Elde edilen hücreler tam sayısı ayırımında kullanılan pluripotent hücre hattına bağlıdır.
  7. Süpernatant aspire ve 10 uM ROCK inhibitörü içeren PEB tampon içinde tekrar süspansiyon hücreleri. 10'a kadar 7 hücreleri, bu tampon 100 ul kullanın. staini gününde 10 uM ROCK inhibitörü eklemeng. (PEB tamponu + UR olarak anılacaktır) tüm alt uygulamalar için bu tampon kullanın.
    NOT: PEB tamponu,% 0.5 BSA ve PBS içinde 2 mM EDTA içermektedir. daha fazla hücre lekeli isteniyorsa, buna göre tampon seviyesini ayarlamak.
  8. Bu kabaca 1:10 seyreltme temsil 100 ul 10 7 hücre başına bir CXCR4-APC antikoru 10 ul ekleyin.
    NOT: Bir APC bağlı antikor kullanımı zorunlu değildir. Bunun yerine kullanılan mikro-bağlı ikame edilebilir. daha fazla hücre lekeli gerekiyorsa buna göre antikor seviyesini ayarlamak.
  9. hafifçe parmak boru çevirerek karıştırın ve 15 dakika boyunca bir buzdolabında 4 ° C'de inkübe edin. 1-2 ml PEB tamponu ile tekrar süspansiyon hücreleri. g x 300, 5 dakika boyunca hücreler santrifüj.
  10. Steril cam Pasteur pipetle süpernatant aspire ve 10 7 hücre başına 80 ul PEB hücre pelletini ve 20 ul anti-APC mikroboncukları ekleyin.
    NOT:
  11. hafifçe parmak boru çevirerek karıştırın ve 15 dakika boyunca bir buzdolabında 4 ° C'de inkübe edin. 1-2 ml PEB tamponu + RI ile hücreleri tekrar süspansiyon. g x 300, 5 dakika boyunca hücreler santrifüj. tampon aspire. 500 ul PEB tamponu + RI içinde süspanse.

CXCR4'ün + Hücreleri 3. Manyetik Ayırma

  1. üretim talimatlarına göre bir manyetik alan içinde orta büyüklükte bir manyetik sütun yerleştirin. 500 ul PEB tamponu + RI ile sütun ön durulayın. sütun tüm hücre süspansiyonu uygulayın. kolona bağlanacağı şekilde tüm hücreler akışı toplamak. Emin CXCR4 + hücreler optimum alımı için sütunları rahatsız etmemek olun.
  2. sütun 500 ul PEB tamponu + RI ile üç kez yıkayın. üzerinden ilk akışını toplamak ve Adım 3.1 toplanan hücreler ile birleştirmek. manyetik alan manyetik sütun çıkarın ve koyunUygun toplama tüpü. kolona 1 mi PEB tamponu + RI ekleyin. Hücreler sıkıca sütuna pistonu bastırın Zehir için.
  3. İsteğe bağlı: ayrı ayrı örnekler üzerinden tüm akışını toplamak ve akım sitometri kullanarak CXCR4 + hücrelerin sayısını analiz etmek 20 ul her kullanın. Onların sayısı her yıkama adımda düşüş gerekir.
    NOT: En az 2 x 10 4 canlı, kapı hücreler güvenilir sonuçlar için sayılmalıdır.
  4. Tekrarlayın Adım 3.1 numune boyunca toplanan akışı ve yeni bir sütun kullanarak adım 3.2 numune boyunca ilk akışı ile 3.1-3.3 adımları tekrarlayın. Do not önceki sütun yeniden kullanın. piston havası kullanılarak bloke sütunun içine bastırılır.
  5. hemasitometre kullanarak mikroskop altında hücreleri saymak. 6 x 10 6 hücre farklılaşma kadar etkinliğine bağlı olarak, ilk kriteri ve işlem 10 7 hücreleri kullanıldığında, ikinci bir kolon kullanılarak bir 1 x 10 6 hücre olabilir. 5 dakika boyunca 300 xg'de hücreleri Santrifüj. Süpernatant aspire ve steril bir cam Pasteur pipetle ve ek 10 uM ROCK inhibitörü ile Adım 1.9 1 ml endoderm indüksiyon ortamı hücreleri tekrar süspansiyon.
  6. hemasitometre kullanarak mikroskop altında hücreleri saymak. Uygun bir yoğunlukta hücreler Tohum, yani ~ 12 oyuklu plakanın her bir kuyucuğu başına 4 x 10 5 hücre (app. 3.6 cm2 yüzey) ya da ~ 8 oyuklu odacık sürgünün oyuk başına 1.5 x 10 5 hücre.

4. İsteğe bağlı: Arıtılmış Kesin Endoderm Nüfus Analizi

  1. immünofloresan boyama kabaca 24 saat kesin endoderm (DE) ve / veya Pluripotency işaretleyici proteinleri% 4 formaldehit ve leke tohumlama sonra Adım 3.7 saflaştırılmış hücreleri düzeltmek.
    Not: Genellikle kullanılan DE belirteçler FOXA2 ve SOX17 arasında, yaygın olarak kullanılan pluripotense belirteçleri OCT3 / 4, Nanog ve Sox2 6, 8 bulunur.
  2. foR RT-qPCR analizi, doğrudan ya da 24 saat sonra tohumlama saflaştırılmış hücreler hasat Toplam RNA çıkarmak ve çıkarılan toplam RNA örneklerinden cDNA ters transkribe. DE ve pluripotense işaretçi genler 6, 8 ekspresyonunu analiz etmek için RT-qPCR reaksiyon (kopyaların) cinsinden kalıp olarak 10 ng cDNA kullanın.
    Not: Genellikle kullanılan marker genleri Aşama 4.1'de bahsedilmektedir. Döngü koşulları eğrisi analizi eriterek, ardından 95 ° C'de 5 dakika ve 95 ° C'de 15 saniye 40 döngü, 60 ° C'de 1 dakika, bulunmaktadır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

farklılaşma üzerine EKH gen ve protein ekspresyonu köklü değişim geçirirler. 1 başarılı endoderm farklılaşmasını kontrol etmek için kullanılabilecek tipik marker genleri tasvir etmektedir. Bir gen ekspresyon analizi için ana hedeflerdir GSC, FOXA2 ve SOX17 bulunmaktadır. Farklılaşmamış EKH karşılaştırıldığında göreceli gen ekspresyon analizi, özellikle FOXA2 ve SOX17> 2.000 kat artmıştır. GSC önce ilkel çizgi oluşumu sırasında çok erken 24 saat içinde ifade edilir ancak yine de dördüncü günde> 100 kat indüklenir. Bu genlerin sentezlenmesi Sonuç olarak CXCR4 yüzey işaretleyici 6 kullanılarak sıralama sonra artar. Bu genlerin ekspresyonu halen dört gün sonra tespit edilebilir, ancak bu OKT3 / 4 (POU5F1) ve NANOG olarak pluripotensinin ana regülatör önemli ölçüde aşağı regüle edilir. bu indicabazı hücreler yeterince CHIR-99021 ve aktivin A. SOX7 gen ifadesi ile tedavi rejimine yanıt vermeyen tes genellikle DE karşı ekstra-embriyonik endoderm oluşumunu ayırt hitap etmektedir. İlk durumda SOX17 birlikte ifade SOX7 ve ikinci durumda SOX17 birlikte ifade FOXA2 sahip olmasıdır. Şekil 1'deki sonuçlar henüz SOX7 + hücreleri boyamak için mümkün olmamıştır, ancak DE birlikte bazı ekstra embriyonik hücreler, farklılaşma sırasında meydana gelmiş olabileceğini göstermektedir.

Şekil 2 DE içine EKH farklılaşma sonra mevcut olan farklı hücre popülasyonları göstermektedir. Aşama 1 EKH tek hücreler olarak tohumlanır ve sonra dört gün CHIR-99.021 ve aktivin A ile muamele ile ayırt. DE lekelenme SOX17 ve FOXA2 (Şekil 2A) hem belirteçler eşit eş Expresse olduğunu göstermektedir işaretleyicileriçekirdek içindeki, d. Bu DE bağlılık damgasını olarak kabul edilir. Bununla birlikte, bazı hücreler farklılaşma sürecine karşı iki DE işaretleyici proteinler (Şekil 2A) ne de ifade eder. Aslında, iki farklı hücre popülasyonları dört günlük farklılaşmanın sonra gözlenir. Birçok hücre DE işaretleyici FOXA2 ifade ederken hala Pluripotency işaretleyici Sox2 (Şekil 2B) ifade kalan hücreler vardır. Bu iki protein, iki ayrı popülasyonları olarak ifade edilmiştir ve hiç birlikte ifadesi, (Şekil 2B) gözlenebilir.

gün üç veya farklılaşma dört yüzey proteini CXCR4 DE-taahhüt CXCR4 + nüfusu sıralamak ve böylece kalan pluripotent hücreler ve diğer istenmeyen soy kaldırmak için kullanılır. Kullanılan hücre dizisi farklılaşması verimliliğine bağlı olarak>% 80 CXCR4 + hücreleri Aşama 1. 8 de tarif farklılaşma protokolü kullanılarak elde edilebilir Şekil 3 daha önce% 66 ±% 3, CXCR4-pozitif hücrelerin vermiştir önce ve MACS saflaştırmadan sonra immünofloresan (IF) lekeleme kullanarak yaygın DE ve pluripotense markör proteinlerin ifadesini gösterir. Aşama 2'de tarif edilen CXCR4 için immünofloresan boyama ile yaklaşık% 60 CXCR4 + hücreleri (Şekil 3A, orta panel) ürün elde edilmiştir farklılaşma üçüncü günde. CXCR4 + hücreleri APC konjuge anti-CXCR4 antikoru ile boyanma üzerine Q1 Q4 hareket. MACS saflaştırma Aşama 3'te tarif sonra CXCR4 + popülasyonu% 85 zenginleştirilmiştir. Saflaştırma yöntemi özellikle, ancak, kültürlerden istenmeyen soyları (Şekil 3A, sağ panel) ortadan kaldırmaz.

MACS saflaştırmadan sonra,CXCR4 + hücreleri daha fazla analiz için ekilmiş edilebilir veya isteğe bağlı olarak sıralama bir ikinci tur yüksek saflık ancak daha az canlılığı elde etmek için gerçekleştirilebilir. (Yeşil lekeli) Pluripotency işaretleyici Sox2 ve yaygın ifadesini farklılaşmasını önce IF boyama ile tespit edilir. Buna karşılık, (kırmızı lekeli) DE markör FOXA2 (Şekil 3B) tespit edilemez. Şekil 3C CXCR4 +, hücreler FOXA2 (yeşil) için antikorlar ile boyandı ve pluripotense markör Sox2 (kırmızı) birlikte boyandı. Arıtılmış CXCR4 + hücreleri tohumlama sonra sadece birkaç Sox2 + hücreler tespit edilir. numaralı seribaşı hücrelerin çoğunluğu DE işaretleyici FOXA2 için olumludur.

Şekil 1
Dört günlük bir endoderm farklılaşması sırasında farklı pluripotense ve endoderm marker genlerinin gen ekspresyonu 1. Örnek değişiklikler Şekil. (A) 7, A yalnız aktivin ile bir tedavi ve CA-A kullanılarak farklılaşma gösterir, herhangi bir büyüme faktörleri olmadan kültür koşullarına gösterir (CHIR-99021 ve aktivin A) sıralama MACS için kullanılan protokol, (8 detaylara bakınız). CA-A protokolde kullanılan medya burada ilkel çizgi indüksiyon orta ve endoderm indüksiyon ortamı olarak adlandırılır. Tasvir (B) olmadan kesin endoderm taahhüt üzerine ifade GSC, SOX17 ve FOXA2 RT-qPCR tarafından ölçülen gen ifadesi daha fazla MACS sıralama. POU5F1 (Zeiss OCT3 / 4) ve Nanog Pluripotency düzenleyicileri ve SOX7 ekstra embriyonik endoderm ifade edilir ise genellikle aşağı, farklılaşma üzerine düzenlenir. gen ekspresyonu <(üç stabil olarak ifade edilen hazırlık geninin karşı normalize edildiem> CNRQ değerleri ile sonuçlanır TBP, TUBA1A, G6PD). farklılaşmamış hücreleri, yukarıda belirtilen genlerin ekspresyonu 1'e ayarlandı ve değişiklikler gen ekspresyonu kat değişiklik olarak çizilmiştir. Değerler ortalama ± SEM, n = 4-5. ANOVA artı Bonferroni post hoc testi. ** P ≤ 0.01 Rastgele ve #P ≤ 0.05 ile karşılaştırıldığında, RP (bu rakam içindeki tüm veriler son zamanlarda 8 yayınlanmıştır) ile karşılaştırıldığında 0.01 ≤ ## P. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Endoderm farklılaşma sonra 2. Farklı hücre popülasyonlarının Şekil. DE (A) ile boyanarak SOX17 ve farklılaşma d4 ilgili antikorlar ile FOXA2 kendi homojen birlikte-lokalizasyonunu ortaya işaretler. Bununla birlikte, bazıHücreler farklılaşma sürecini direndi ve (mavi çekirdek boyama için) bu belirteçler ifade etmezler. Yeşil ve kırmızı boyama birleştirme sarı gösterilir. (B), iki farklı hücre popülasyonları vardır DE farklılaşmadan sonra. farklılaşma sürecini direnen hücreler hâlâ Pluripotency işaretleyici Sox2 ifade oysa DE-benzeri hücreler FOXA2 ifade eder. (AB) Çekirdekler DAPI (mavi) ile zıt. Panel (A) 'deki ölçek çizgisi 50 um ve panelde (B), 100 uM'dir. Görüntüleme 670 nm (kırmızı, Cy5), 520 nm (yeşil FITC) ve 433 nm (mavi, DAPI) yürütülmüştür, sırasıyla. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Farklılaşmış DE hücre popülasyonlarının ve temsili st sıralama Şekil 3. MACSsıraladıktan sonra Aining. (A) CXCR4 + lekeli hücreler (Q1) sıralama MACS sonra zenginleştirilmiştir. CXCR4- hücreleri (Q4) sayısı azaltılır. Hücre hattı bağlı farklılaşma protokol verimleri>% 80 CXCR4-pozitif hücreler 8 ve MACS onları daha da zenginleştirmek için kullanılabilir. (B) ayrım hücreleri Pluripotency işaretleyici Sox2 (yeşil) ifade değil DE işaretleyici FOXA2 kullanılan (kırmızı sıralanan nüfus neredeyse eşit DE işaretleyici FOXA2 (yeşil) ifade oysa sadece çok az farklılaşmamış Sox2 + hücreler sıralama MACS sonra). (C), (kırmızı) kalır. (BC) Çekirdekler DAPI (mavi) ile zıt. Panel (C) 'deki ölçek çizgisi 100 mikron ve tüm paneller için geçerlidir. Görüntüleme 670 nm (kırmızı, Cy5), 520 nm (yeşil FITC) ve 433 nm (mavi, DAPI) yürütülmüştür, sırasıyla. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Şu anda kullanılan farklılaşma protokolleri nadiren% 100 farklılaşmış hücrelerin neden. hala ele alınması gereken nedenlerden dolayı bazı hücreler farklılaşma sürecini karşı. kullanılan farklılaşma protokolünün verimlilik ve ESC eğilimi bağlı kalan pluripotent hücrelerin belirli bir sayıda yaygın, hatta kesin endoderm içine farklılaşma sonra gözlenir hattı. Bunlar artık hücreler gibi transkriptomik, proteomik ve miRNA ifade analizi olarak aşağı farklılaşmaları veya daha fazla analiz bozabilir. Kalıntı pluripotent hücreler veya diğer istenmeyen soyların da farklılaşma hedefleri müdahale edebilir parakrin etkileri görülebilir. Sonuç olarak, bu hücrelerin çıkarılması daha iyi bir reprodüksiyon neden olabilir.

CXCR4 farklılaşma sonra endoderm hücreleri ifade eden + saflaştırılması bu popülasyonlarının zenginleştirmek ve farklılaşma sürecine direnen hücreleri çıkarmak için kullanılabilir.Yüzey DE markör proteinin CXCR4 endoderm hücrelerinin spesifik saflaştırılması için de kullanılabilir. eldeki MACS arıtma protokolü az 2 saat içinde tamamlanabilir ve pahalı laboratuar ekipman ve cihazlar olmadan her hücre kültürü laboratuvarında basit bir masa üstü formatında çalıştırılabilir. FACS arıtma yaygın olarak kullanılan bir tekniktir ancak sert koşullar kullanır. FACS sırasında saflaştırma hücreler genellikle uzun bir süre ile süspansiyon içinde muhafaza ve hücreler, diğer zor faktörler, FACS cihazının ağızlık örneğin, yüksek basınca tabi tutulmaktadır. Buna karşılık MACS prosedürü hızlı ve nazik. Bu saflaştırma işlemi sonrasında yeniden tohumlama esnasında iliştirmeniz hücrelerin yeteneğini geliştirir. daha bu tekrar tespit kolaylaştırmak için bir kaya önleyicisi sonra önce apoptozu önlemek için saflaştırma, kültür ortamına ilave edilir. yatıştırıldı etkileyen bir diğer önemli faktör hücrelerin reseeded edildikleri yoğunluğudur. Bu durum kuvvetle bağımlılığındakikullanılan hücre hattı üzerinde ds. Bu çalışmada ekim için kullanılan hücre sayıları elimizde iyi çalışır temsili hücre sayılardır. Bununla birlikte, farklı hücre hatları için bu numaraları ayarlamak için ihtiyacı olabilir. Her iki tedbir de, bir ROCK inhibitörü eklenmesi ve yeniden tohumlama için hücre sayıları değerlendirilmesi, sıralama sonra daha hücre kültürünün başarısı için kritik öneme sahiptir.

Kullanılan DE farklılaşma protokolü ile tipik>% 70 CXCR4 + hücreleri 8 sıralama olmadan elde edilebilir. DE üretimi için kullanılan protokol performans dolayısı ile de daha sonraki MACS arıtma protokolü verimliliğini etkiler. Genel, verimli farklılaşma (>% 80 CXCR4 + hücreleri) MACS (% 95 kadar) sıraladıktan sonra daha yüksek bir saflık verir. Bu durumda, bu saflaştırma yöntemi kullanım esas ancak% 100 saflıkta elde edilemez farklılaşmamış hücrelerin sayısını azaltır. Gelecekte, soy spesifik yüzey işaretleyicileri T tanımlanabilirşapka daha terminal farklılaşmış hücrelerin saflaştırılması izin verecektir. MACS sıralama prosedürü bu amaç için Başbakan seçim.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Jasmin Kresse usta teknik yardım minnetle kabul edilmektedir.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics