Un metodo rapido ed efficace per la purificazione delle cellule endoderma generato da cellule staminali embrionali umane

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, si descrive un metodo per la purificazione delle cellule staminali embrionali differenziate umane che si sono impegnati verso l'endoderma definitivo per il miglioramento delle applicazioni a valle e ulteriori differenziazioni.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le capacità di differenziazione delle cellule staminali pluripotenti come le cellule staminali embrionali (ESC) permettono una potenziale applicazione terapeutica per le terapie di sostituzione cellulare. Terminally tipi di cellule differenziate potrebbero essere utilizzati per il trattamento di varie malattie degenerative. In vitro differenziazione di queste cellule verso tessuti del polmone, fegato e pancreas richiede come primo passo la generazione di cellule endodermico definitive. Questo passaggio è limitante per un'ulteriore differenziazione verso tipi di cellule terminalmente maturate come le cellule beta produttrici di insulina, epatociti o altri tipi di cellule endoderma-derivati. Le cellule che si sono impegnati nei confronti della stirpe endoderma altamente esprimono una moltitudine di fattori di trascrizione come Foxa2, SOX17, HNF1B era, i membri della famiglia GATA, e il recettore CXCR4 superficiale. Tuttavia, i protocolli di differenziazione sono raramente efficiente al 100%. Qui, si descrive un metodo per la purificazione di una popolazione di cellule CXCR4 + dopo la differenziazionenella DE utilizzando microsfere magnetiche. Questa purificazione elimina inoltre le cellule di linee indesiderate. Il metodo di purificazione delicata è veloce e affidabile e può essere utilizzata per migliorare le applicazioni a valle e differenziazioni.

Introduction

Le cellule staminali pluripotenti come le cellule staminali embrionali (ESC) hanno la capacità di differenziarsi in qualsiasi tipo di cellula del corpo umano. Così, in vitro protocolli di differenziazione possono essere utilizzati per generare numerosi tipi cellulari adulto come cardiomiociti 1, epatociti 2, cellule beta 3, epiteliale polmonare 4 o cellule neuronali 5. Questo rende CES uno strumento prezioso per il potenziale trattamento di diverse malattie degenerative 3.

La differenziazione in vitro dei CES verso tessuti adulti del polmone, del fegato e del pancreas richiede una pseudo-gastrulazione in cellule che ricordano l'endoderma definitivo (DE) 6. Poiché differenziazione valle verso i suddetti tipi di cellule somatiche è molto meno efficienti, una differenziazione endoderma ottimale è considerata limitante 7. Le cellule che si sono impegnati nei confronti della stirpe endoderma subiscono chacambiamenti racteristic nel loro profilo di espressione genica. Maestri pluripotenza geni regolatori sono giù regolati, mentre l'espressione di altri fattori di trascrizione, come Foxa2, SOX17, HNF1B era, i membri della famiglia GATA e il recettore di superficie CXCR4 è altamente upregulated 6, 8, 9. CXCR4 è noto per essere transactivated da SMAD2 / 3, a valle della nodale di segnalazione / TGF-β e SOX17 a causa di specifici siti di legame nella sua regione del promotore 10. Così è un marcatore molto adatto utilizzato in una serie di relazioni 6, 8, 11-13. Questi cambiamenti di espressione riflette un evento di pseudo-gastrulazione, in cui i CES prima acquisire caratteristiche di una popolazione di cellule striscia simile primitiva e, successivamente, si impegnano nello strato germinale endoderma 6.

Tuttavia, i protocolli di differenziazione sono raramente efficiente al 100% come poche cellule possono resistere al processo di differenziazione o differenziare verso altre linee non intenzionali 14. Queste cellule possono Influe negativamentence ulteriore differenziazione. Inoltre, le cellule indifferenziate residue porto grandi rischi per i successivi esperimenti di trapianto e possono dar luogo a teratomi 15-17.

Per rimuovere queste cellule indesiderate precoce sul marcatore CXCR4 superficie può essere utilizzato per la purificazione di cellule che si sono impegnati verso la DE 18. Qui, descriviamo un metodo per la selezione positiva di + cellule CXCR4 da De culture differenziazione. Per questo, il marcatore CXCR4 superficie è vincolato da un anticorpo che poi a sua volta si lega a microsfere magnetiche. A differenza delle dure condizioni durante FACS ordinamento, le cellule DE-come magneticamente etichettati possono quindi facilmente essere purificati in un formato da banco utilizzando un metodo di purificazione delicato. Questo protocollo fornisce un metodo semplice per la rimozione delle popolazioni cellulari che oppone il processo di differenziazione DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Differenziazione dei CES umana verso endoderma definitivo

  1. Coltivare cellule staminali embrionali umane (CES) in un incubatore a 37 ° C e 5% di CO 2.
  2. Coat una nuova piastra di coltura cellulare 6 pozzetti con 1 ml di una matrice membrana basale e incubare la coltura-ware per almeno 30 minuti a temperatura ambiente. Per informazioni specifiche si prega di girare le istruzioni del rispettivo produttore.
  3. Verificare che i CES umane coltivate hanno raggiunto l'80% -90% di confluenza al microscopio con un ingrandimento basso (ad esempio, 4X). Aspirare il supporto dalle cavità succhiando via del mezzo con un bicchiere sterile Pasteur pipetta. Lavare le cellule una volta con una soluzione tampone fosfato (PBS). Per questo, aggiungere 2 ml di PBS a ciascun pozzetto dolcemente agitare la piastra e succhiare la soluzione per rimuovere le cellule morte e detriti cellulari.
  4. Aggiungere 1 ml di reagente soluzione passaging senza enzima per dolce la dissociazione di gruppi di cellule. Incubare le cellule a 37 ° C und 5% di CO 2 fino a quando le cellule mostrano chiari segni di rottura in piccoli gruppi.
    NOTA: Il tempo di incubazione dipende dal reagente utilizzato. Per la soluzione passaging senza enzima citato nella sezione materiali, tempo di incubazione è di circa 7 min.
  5. Aggiungere 1 ml DMEM / F-12 di media e disturbare gli altri aggregati di cellule in singole cellule pipettando su e giù con una punta della pipetta 1 ml. Usare questo per irrigare le cellule dalla superficie e trasferire le cellule a un tubo di centrifugazione. Per recuperare tutte le celle, lavare i pozzetti con 1 ml di DMEM / F-12 medio e aggiungere il mezzo al tubo di centrifugazione.
  6. Centrifugare le cellule per 5 minuti a 300 x g. Aspirare il surnatante e risospendere le cellule in 5 ml di ES terreno di coltura cellulare contenente 10 mM Rho-chinasi (ROCK) inibitore.
  7. Contare le cellule al microscopio utilizzando un emocitometro e sementi 150.000 - 400.000 cellule per 6 pozzetti o in un altro layout di piastra, a seconda della linea cellulare utilizzata ES. Usa culture terreno contenente inibitore ROCK 10 pM di evitare l'apoptosi e la cultura nelle cellule in un incubatore a 37 ° C e 5% CO 2.
  8. Circa 24 ore dopo la semina aspirare il terreno con uno sterile pipetta Pasteur di vetro e aggiungere 2 ml di terreno striscia di induzione primitiva.
    NOTA: Questo mezzo contiene concentrazioni finali di 1% glutamina, 0,2% FCS, 5 micron CHIR-99021 e 50 ng / ml activin A in avanzata RPMI-1640. Comunemente, usare 2 ml di terreno per la coltivazione in 6 pozzetti.
  9. 48 ore dopo la semina, sostituire il mezzo per endoderma medio induzione. Coltivare le cellule in questo mezzo per altre 48 ore con cambio medio giornaliero.
    NOTA: Questo mezzo contiene 1% glutamina, 0,2% FCS e 50 ng / ml activina A in Advanced RPMI-1640. Le cellule che si sono impegnati verso l'endoderma definitivo esprimono il marcatore di superficie CXCR4. La colorazione di CXCR4 può essere utilizzato per quantificare il numero di cellule disimpegnati.
  1. Per la finale 24 hr ma almeno 1 ora prima della raccolta delle cellule aggiungono inibitore ROCK 10 pM al mezzo di coltura.
  2. Coat coltura-ware cellule che verrà utilizzato per la ri-semina con una matrice di membrana basale, cioè, piastre da 12 pozzetti per analisi qPCR o la camera di vetrini per immunofluorescenza. Incubare le piastre o le diapositive per almeno 30 minuti a temperatura ambiente.
  3. Aspirare il mezzo con uno sterile pipetta Pasteur di vetro dai pozzi delle cellule differenziate utilizzati per la colorazione e / o l'ordinamento.
  4. Aggiungere 1 ml di reagente soluzione passaging priva di enzimi per il dolce di dissociazione di gruppi di cellule. Incubare le cellule a 37 ° C e 5% CO 2 finché le cellule mostrano evidenti segni di rottura in piccoli gruppi.
    NOTA: Il tempo di incubazione dipende dal reagente utilizzato. Per la soluzione passaging senza enzima di cui al Materisezione als, tempo di incubazione è di circa 7 min.
  5. Aggiungere 1 ml DMEM / F-12 di media e disturbare restante aggregati di cellule in singole cellule pipettando su e giù con una punta di 1 ml. Usare questo per irrigare le cellule dalla superficie e trasferire le cellule a un tubo di centrifugazione. Per recuperare tutte le celle, lavare i pozzetti con 1 ml di DMEM / F-12 medio w / o FCS e aggiungere il mezzo al tubo di centrifugazione.
  6. Contare le cellule sotto il microscopio con un emocitometro. Le cellule provenienti da tre pozzetti di una piastra da 6 pozzetti dovrebbero portare a 10-15 x 10 6 cellule dopo tre giorni di differenziazione. Centrifugare le cellule per 5 minuti a 300 x g.
    NOTA: Il numero esatto di cellule ottenute dipenderà dalla linea cellulare pluripotenti utilizzato per la differenziazione.
  7. Aspirare il surnatante e risospendere le cellule in tampone PEB contenente inibitore ROCK 10 micron. Utilizzare 100 ml di questo buffer per un massimo di 10 7 cellule. Aggiungere l'inibitore ROCK 10 pM del giorno di staining. Utilizzare questo buffer per tutte le applicazioni a valle (di seguito PEB tampone + RI).
    NOTA: tampone PEB contiene 0,5% BSA e 2 mM EDTA in PBS. Se più celle devono essere macchiati, regolare il volume di accumulo di conseguenza.
  8. Aggiungere 10 ml di un anticorpo CXCR4-APC per 10 7 cellule in 100 microlitri, questo rappresenta circa una diluizione di 1:10.
    NOTA: L'utilizzo di un anticorpo APC-linked non è obbligatoria. Invece può essere sostituito a seconda delle microsfere utilizzate. Se più celle devono essere macchiati regolare il volume anticorpi conseguenza.
  9. Mescolare capovolgendo delicatamente il tubo con le dita e incubare a 4 ° C in frigorifero per 15 minuti. Risospendere le cellule con 1-2 ml di tampone PEB. Centrifugare le cellule per 5 minuti a 300 x g.
  10. Aspirare il surnatante con un bicchiere sterile Pasteur pipetta e risospendere il pellet cellulare in 80 microlitri PEB per 10 7 cellule e aggiungere 20 microlitri anti-APC microsfere.
    NOTA:
  11. Mescolare capovolgendo delicatamente il tubo con le dita e incubare a 4 ° C in frigorifero per 15 minuti. Risospendere le cellule con 1-2 ml di PEB tampone + RI. Centrifugare le cellule per 5 minuti a 300 x g. Aspirare il buffer. Risospendere in 500 microlitri di buffer PEB + RI.

3. La separazione magnetica di CXCR4 + cellule

  1. Posizionare una colonna magnetica di medie dimensioni in un campo magnetico come da istruzioni di fabbricazione. Pre-lavare la colonna con 500 microlitri di buffer PEB + RI. Applicare l'intera sospensione cellulare alla colonna. Raccogliere il flusso attraverso le cellule come non tutti lo legherà alla colonna. Fare attenzione a non disturbare le colonne per il recupero ottimale delle cellule CXCR4 +.
  2. Lavare la colonna tre volte con 500 microlitri di buffer PEB + RI. Raccogliere il primo flusso attraverso e combinarlo con le cellule raccolte dal punto 3.1. Rimuovere la colonna magnetica dal campo magnetico e metterla in untubo di raccolta adatto. Aggiungere 1 ml di PEB tampone + RI sulla colonna. Per eluire le cellule premere con forza il pistone nella colonna.
  3. Opzionale: Raccogliere tutte flusso attraverso campioni separatamente e 20 ml ciascuno di analizzare il numero di cellule CXCR4 + citometria a flusso. Il loro numero dovrebbe diminuire con ogni fase di lavaggio.
    NOTA: Almeno 2 x 10 4 praticabile, le cellule gated devono essere contati per ottenere risultati affidabili.
  4. Ripetere i punti 3.1-3.3 con il flusso raccolte attraverso campione dal punto 3.1 e il primo flusso attraverso campione dal punto 3.2 con una nuova colonna. Non riutilizzare la colonna precedente. Utilizzando l'aria stantuffo viene pressato nella colonna, che blocca.
  5. Contare le cellule sotto il microscopio con un emocitometro. A seconda della efficienza della differenziazione fino a 6 x 10 6 cellule possono essere ordinati inizialmente e altre 1 x 10 6 cellule utilizzando una seconda colonna utilizzando 10 7 cellule per la procedura. Centrifugare le cellule a 300 xg per 5 min. Aspirare il surnatante e con uno sterile Pasteur di vetro pipetta e risospendere le cellule in 1 ml di mezzo endoderma induzione dal punto 1.9 con l'aggiunta di inibitore ROCK 10 micron.
  6. Contare le cellule sotto il microscopio con un emocitometro. Seme le cellule ad una densità adeguata, vale a dire, ~ 4 x 10 5 cellule per pozzetto di una 12-pozzetti (app. 3,6 cm 2 di superficie) o ~ 1,5 x 10 5 cellule per pozzetto di un 8-ben camera-scivolo.

4. Opzionale: Analisi delle purificata Popolazione Endoderma definitiva

  1. Per immunofluorescenza fissare le cellule purificate dal punto 3.7 circa 24 ore dopo la semina con paraformaldeide al 4% e colorare per endoderma definitivo (DE) e / o proteine ​​marker pluripotenza.
    NOTA: comunemente usato DE marcatori includono Foxa2 e SOX17, marcatori pluripotenza comunemente usati includono Oct3 / 4, Nanog e SOX2 6, 8.
  2. foanalisi R RT-qPCR, raccogliere le cellule purificate direttamente o 24 ore dopo la semina, estratto totale-RNA e reverse trascrivere cDNA dai campioni totale-RNA estratto. Utilizzare 10 ng cDNA come modello per reazione RT-qPCR (triplicato) per analizzare l'espressione di DE e geni marcatori pluripotenza 6, 8.
    NOTA: i geni marcatori di uso comune sono menzionati al punto 4.1. condizioni del ciclo sono 5 min a 95 ° C e 40 cicli di 15 secondi a 95 ° C e 1 min a 60 ° C, seguita da analisi della curva di fusione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Su differenziazione CES subiscono drastici cambiamenti di espressione genica e proteica. La figura 1 illustra geni marcatori tipici che possono essere utilizzati per verificare una differenziazione endoderma successo. Obiettivi principali per l'analisi di espressione genica sono GSC, Foxa2 e SOX17. In un parente analisi di espressione genica in particolare Foxa2 e SOX17 sono aumentate di> 2.000 volte rispetto al CSE indifferenziate. GSC è già espresso molto presto entro 24 ore durante la formazione stria primitiva ma è comunque indotto> 100 volte il quarto giorno. L'espressione di questi geni è conseguentemente aumentato su ordinamento utilizzando il marcatore di superficie CXCR4 6. Regolatori di maestri pluripotenza, come Oct3 / 4 (POU5F1) e Nanog sono significativamente verso il basso regolati, anche se l'espressione di questi geni è ancora rilevabile dopo quattro giorni. Questo indicates che alcune cellule non rispondono adeguatamente al regime di trattamento con CHIR-99021 e activin A. espressione genica SOX7 è in genere rivolte a discriminare formazione endoderma extra-embrionali contro DE. Nel primo caso SOX17 è co-espresso con SOX7 e in quest'ultimo caso SOX17 è co-espresso con Foxa2. I risultati in figura 1 indicano che con DE alcune cellule extra-embrionali potrebbero essersi formati durante la differenziazione, anche se non abbiamo ancora avuto modo di colorare le cellule SOX7 +.

La figura 2 illustra le diverse popolazioni cellulari che sono presenti dopo la differenziazione dei CES nel DE. Nel passaggio 1 CES sono seminati come singole cellule e quindi differenziati per trattamento con CHIR-99021 e activin A per quattro giorni. La colorazione IF del DE marcatori SOX17 e Foxa2 (Figura 2A) mostra che entrambi i marcatori sono uniformemente co-expressed all'interno dei nuclei. Questo è considerato come un segno distintivo del DE impegno. Tuttavia, alcune cellule resistono il processo di differenziazione ed esprimono nessuno dei due proteine ​​DE marcatori (Figura 2A). Infatti, due distinte popolazioni cellulari vengono osservati dopo la differenziazione quattro giorni. Mentre molte cellule esprimono il marcatore Foxa2 DE ci sono ancora cellule rimanenti che esprimono il marcatore SOX2 pluripotenza (Figura 2B). Queste due proteine ​​sono espresse in due popolazioni separate e non co-espressione possono essere osservati (Figura 2B).

Il giorno tre o quattro di differenziazione proteina CXCR4 superficie viene utilizzato per ordinare popolazione CXCR4 + DE-impegnata e rimuovere quindi le cellule pluripotenti rimanenti e le altre linee indesiderate. A seconda della efficienza differenziazione della linea cellulare utilizzata> 80% di cellule CXCR4 + possono essere ottenuti utilizzando il protocollo differenziazione descritto nella Fase 1 8 La Figura 3 mostra la citometria a flusso di dati dopo colorazione e MACS purificazione di CXCR4 cellule + dopo la differenziazione verso DE e mostra l'espressione di proteine ​​comuni DE e marcatori pluripotenza con immunofluorescenza (IF) colorazione, prima e dopo la purificazione MACS. Il terzo giorno di differenziazione circa cellule CXCR4 + 60% utilizzando la colorazione immunofluorescenza per CXCR4 descritto al punto 2 sono stati ottenuti (figura 3A, pannello centrale). cellule CXCR4 + spostano da Q4 a Q1 su di colorazione con un coniugato anticorpo anti-CXCR4 APC. Dopo la purificazione MACS descritto al punto 3 della popolazione CXCR4 + è arricchito al 85%. Il processo di purificazione, tuttavia, non elimina tutte le linee cellulari indesiderati da culture (Figura 3A, pannello di destra).

Dopo la purificazione MACS,le cellule CXCR4 + possono essere seminati per ulteriori analisi o, in alternativa un secondo ciclo di smistamento possono essere eseguiti per produrre purezze più elevate, ma ridotta vitalità. Prima di differenziazione l'espressione a livello di diffusione della SOX2 marcatore pluripotenza (tinto in verde) viene rilevata da se la colorazione. Al contrario, il marcatore Foxa2 DE (colorato in rosso) non può essere rilevata (Figura 3B). Nella Figura 3C CXCR4 + cellule sono colorate con anticorpi per Foxa2 (verde) e sono co-colorate per la SOX2 marcatore pluripotenza (rosso). Dopo la semina delle cellule purificate CXCR4 + vengono rilevate cellule solo poche SOX2 +. La maggior parte delle cellule teste di serie sono positivi per il marcatore Foxa2 DE.

Figura 1
Figura 1. cambiamenti rappresentativi di espressione genica di geni differenti pluripotenza e marcatori endoderma durante una differenziazione endoderma quattro giorni. (UN) 7, A un trattamento con activina A solo e CA-A (CHIR-99021 e activina A) il protocollo, che viene utilizzato per MACS smistamento (vedi dettagli a 8). I media utilizzati nel CA-Un protocollo sono qui indicati come mezzo striscia di induzione primitiva e medie endoderma induzione. (B) rappresentata è l'espressione genica misurata mediante RT-qPCR di GSC, SOX17 e Foxa2, che si esprimono su di impegno definitivo endoderma senza ulteriori MACS l'ordinamento. POU5F1 (Oct3 / 4) e Nanog sono regolatori pluripotenza e tipicamente giù regolati sulla differenziazione, mentre SOX7 è espresso in endoderma extra-embrionali. L'espressione del gene è stata normalizzata contro tre geni housekeeping stabilmente espressi (<em> TBP, TUBA1A, G6PD) a valori CNRQ. L'espressione dei geni di cui sopra in cellule indifferenziate è stato fissato a 1 e le modifiche vengono tracciate come il cambiamento volte dell'espressione genica. I valori sono medie ± SEM, n = 4-5. ANOVA più Bonferroni di test post hoc. ** P ≤ 0,01 rispetto al caso e #P ≤ 0,05, ## P ≤ 0,01 rispetto al RP (tutti i dati all'interno di questa cifra sono stati recentemente pubblicati in 8). Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. popolazioni di cellule diverso dopo la differenziazione endoderma. (A) La colorazione della DE marcatori SOX17 e Foxa2 con rispettivi anticorpi in d4 di differenziazione rivela la loro omogeneità co-localizzazione. Tuttavia, alcunile cellule hanno resistito il processo di differenziazione e non esprimono questi marcatori (colorazione nucleo blu solo). La fusione di colorazione verde e rosso viene visualizzato in giallo. (B) Dopo la differenziazione ci sono due distinte popolazioni cellulari. cellule DE-come esprimono Foxa2 mentre le cellule che hanno resistito il processo di differenziazione ancora esprimono il marcatore SOX2 pluripotenza. (AB) I nuclei sono stati di contrasto con DAPI (blu). barra di scala nel pannello (A) è di 50 micron e nel pannello (B) è di 100 micron. Imaging è stata effettuata a 670 nm (rosso, Cy5), 520 nm (verde, FITC) e 433 nm (blu, DAPI), rispettivamente. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. MACS smistamento di popolazioni di cellule differenziate DE e st rappresentanteaining dopo la cernita. (A) CXCR4 + cellule colorate (1T) sono arricchiti dopo MACS ordinamento. Il numero di cellule CXCR4 (Q4) è diminuito. A seconda della linea cellulare in uso i rendimenti protocollo differenziazione> 80% di cellule CXCR4-positivo 8 e Mac può essere usato per arricchirli ulteriormente. (B) Le cellule indifferenziate esprimono il SOX2 marcatore pluripotenza (verde), ma non il marcatore Foxa2 DE (rosso ). (C) Dopo le MACS ordinamento cellule solo pochissimi SOX2 indifferenziata + rimanga (rosso), mentre la popolazione ordinata esprime quasi uniformemente il marcatore Foxa2 DE (verde). (BC) I nuclei sono stati di contrasto con DAPI (blu). barra di scala nel pannello (C) è di 100 micron e si applica a tutti i pannelli. Imaging è stata effettuata a 670 nm (rosso, Cy5), 520 nm (verde, FITC) e 433 nm (blu, DAPI), rispettivamente. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

protocolli di differenziazione Attualmente utilizzati raramente si traducono in 100% di cellule differenziate. Per ragioni che devono ancora essere affrontate alcune cellule resistono il processo di differenziazione. A seconda della efficienza del protocollo differenziazione utilizzato e la propensione del CES linea un certo numero di cellule pluripotenti residue vengono comunemente osservato anche dopo differenziamento in endoderma definitiva. Queste cellule residue possono compromettere differenziazioni a valle o ulteriori analisi, come trascrittomica, proteomica e analisi di espressione miRNA. cellule pluripotenti residui o altri lignaggi indesiderati possono presentare anche gli effetti paracrini che possono interferire con gli obiettivi di differenziazione. Di conseguenza, l'eliminazione di queste cellule può provocare migliore riproducibilità.

La purificazione di CXCR4 + cellule che esprimono endoderma dopo la differenziazione può essere utilizzato per arricchire queste popolazioni e per rimuovere le cellule che hanno resistito il processo di differenziazione.Il marcatore proteina di superficie DE CXCR4 può essere utilizzato per la purificazione di cellule endoderma. Il protocollo di purificazione MACS a portata di mano può essere completato in meno di 2 ore e può essere eseguito in un semplice formato da banco in ogni laboratorio di colture cellulari senza attrezzature di laboratorio costose e dispositivi. purificazione FACS è una tecnica comunemente usata, ma si avvale di condizioni difficili. Durante FACS cellule purificazioni sono normalmente tenuti in sospensione per un periodo prolungato di tempo e le cellule sono soggetti ad altri fattori stimolanti, ad esempio, ad alta pressione nell'ugello del dispositivo FACS. In confronto la procedura MACS è veloce e gentile. Questo migliora la capacità delle cellule di riattaccare durante reseeding dopo il processo di purificazione. Per facilitare ulteriormente questo riattacco un inibitore ROCK viene aggiunto al mezzo di coltura dopo e prima della purificazione per impedire l'apoptosi. Un altro fattore importante che influenza riattacco è la densità alla quale sono reseeded cellule. Questo fortemente Depends sulla linea cellulare utilizzato. Il numero di cellule utilizzate per la semina in questo studio sono il numero di cellule rappresentative che funzionano bene nelle nostre mani. Tuttavia, ci può essere necessario regolare questi numeri per differenti linee cellulari. Entrambe le misure, l'aggiunta di un inibitore ROCK e la valutazione dei numero di cellule per la nuova semina, sono fondamentali per il successo di un ulteriore coltura cellulare dopo l'ordinamento.

Con il protocollo di differenziazione utilizzato DE> 70% di cellule tipicamente CXCR4 + possono essere ottenuti senza l'ordinamento 8. Le prestazioni del protocollo utilizzato per la generazione DE influenza di conseguenza l'efficienza del successivo protocollo MACS purificazione. In generale, la differenziazione efficiente (> 80% di cellule CXCR4 +) produce una purezza superiore dopo MACS classificare (fino al 95%). Pertanto, l'utilizzo di questo metodo di purificazione riduce il numero di cellule indifferenziate sostanzialmente ma 100% di purezza non possono essere realizzati. In futuro, marcatori di superficie specifici lignaggio possono essere definiti tcappello permetterà la purificazione di cellule più differenziate. La procedura di ordinamento MACS è la selezione primaria per questo scopo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

L'assistenza tecnica abile di Jasmin Kresse è riconosciuto con gratitudine.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics