Une méthode rapide et efficace pour la purification des cellules endoderme Généré à partir d'embryons humains Cellules souches

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous décrivons une méthode pour la purification de cellules embryonnaires humaines différenciées souches qui se sont engagés envers l'endoderme définitif pour l'amélioration des applications en aval et d'autres différenciations.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les capacités de différenciation des cellules souches pluripotentes telles que des cellules souches embryonnaires (CSE) permettent une application thérapeutique potentielle pour les thérapies de remplacement cellulaire. Terminalement types de cellules différenciées peuvent être utilisés pour le traitement de diverses maladies dégénératives. In vitro la différenciation de ces cellules vers les tissus du poumon, du foie et du pancréas nécessite dans un premier temps la production de cellules endodermiques définitives. Cette étape est limitante pour une différenciation plus poussée vers des types de cellules matures en phase terminale comme les cellules bêta productrices d'insuline, les hépatocytes ou d'autres types de cellules endoderme dérivés. Les cellules qui se sont engagés envers la lignée endoderme expriment fortement une multitude de facteurs de transcription tels que FOXA2, Sox17, HNF1B, membres de la famille GATA, et le récepteur de surface CXCR4. Cependant, les protocoles de différenciation sont rarement efficaces à 100%. Ici, nous décrivons un procédé pour la purification d'une population de cellules CXCR4 + après différenciationdans le DE en utilisant des microbilles magnétiques. Cette purification élimine en outre des cellules de lignées indésirables. Le procédé de purification douce est rapide et fiable et peut être utilisé pour améliorer les applications en aval et différenciations.

Introduction

Les cellules souches pluripotentes telles que des cellules souches embryonnaires (CSE) ont la capacité de se différencier en pratiquement tout type de corps humain de la cellule. Ainsi, les protocoles de différenciation in vitro peuvent être utilisés pour produire de nombreux types cellulaires adultes , tels que des cardiomyocytes 1, 2, hépatocytes cellules bêta 3, 4 épithéliale pulmonaire ou des cellules neuronales 5. Cela rend CES un outil précieux pour le traitement potentiel de diverses maladies dégénératives 3.

La différenciation in vitro des CES vers les tissus adultes du poumon, du foie et du pancréas nécessite une pseudo-gastrulation dans des cellules qui rappellent l'endoderme définitif (DE) 6. Etant donné que la différenciation en aval vers les types de cellules somatiques ci - dessus est nettement moins efficace, une différenciation endoderme optimale est considérée comme limitant la vitesse 7. Les cellules qui se sont engagés envers la lignée endoderme subissent chachangements racteristic dans leur profil d'expression génique. Gènes régulateurs maîtres pluripotent sont régulés à la baisse, tandis que l'expression d'autres facteurs de transcription tels que FOXA2, Sox17, HNF1B, les membres de la famille GATA et le récepteur de surface de CXCR4 est fortement régulée à la hausse 6, 8, 9. CXCR4 est connu pour être transactivé par SMAD2 / 3, en aval de la signalisation Nodal / TGF-β et Sox17 due à des sites de liaison spécifiques dans la région promotrice 10. Il est donc un marqueur très approprié utilisé dans un certain nombre de rapports 6, 8, 11-13. Ces changements d'expression reflète un événement pseudo-gastrulation, dans lequel les CES acquièrent première caractéristiques d'une population de cellules de série comme primitive et engagent ensuite dans la couche de germe de endoderme 6.

Cependant, les protocoles de différenciation sont rarement efficaces à 100% en quelques cellules peuvent résister au processus de différenciation ou de se différencier vers d' autres lignées 14 non souhaitées. Ces cellules peuvent Influe négativementnce autre différenciation. En outre, des cellules indifférenciées résiduelles abritent de grands risques pour les expériences de transplantation ultérieures et peuvent donner lieu à des tératomes 15-17.

Pour supprimer ces cellules indésirables précoce sur le marqueur CXCR4 de surface peut être utilisé pour la purification de cellules qui se sont engagés vers le DE 18. Ici, nous décrivons une méthode pour la sélection positive des cellules CXCR4 + provenant de Cultures de différenciation. Pour cela, le marqueur de surface de CXCR4 est liée par un anticorps qui se lie à son tour à des microbilles magnétiques. Contrairement aux conditions sévères au cours de tri FACS, les cellules telles que le document DE-magnétiquement marquées peuvent ensuite être facilement purifiées dans un format de paillasse en utilisant un procédé de purification délicat. Ce protocole fournit une méthode simple pour l'élimination des populations de cellules qui a résisté au processus de différenciation DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Différenciation des ESC humain vers le Endoderme Definitive

  1. Cultiver des cellules souches embryonnaires humaines (CES) dans un incubateur à 37 ° C et 5% de CO 2.
  2. Enduire un nouveau 6 puits plaque de culture cellulaire avec 1 ml d'une matrice de membrane basale et incuber la culture-ware pendant au moins 30 min à température ambiante. Pour plus de détails s'il vous plaît tourner vers les instructions du fabricant respectif.
  3. Vérifiez que les CES de l' homme de culture ont atteint 80% -90% de confluence sous le microscope à l' aide d' un faible grossissement (par exemple, 4X). Aspirer le milieu des cavités par aspiration du milieu avec une pipette Pasteur stérile en verre. Laver les cellules une fois avec une solution saline (PBS), une solution de phosphate tamponnée. Pour cela, ajoutez 2 ml de PBS à chaque puits doucement agiter la plaque et aspirer la solution pour éliminer les cellules mortes et les débris cellulaires.
  4. Ajouter 1 ml de réactif de solution de repiquage sans enzyme pour la dissociation douce des amas de cellules. Incuber les cellules à 37 ° C, und 5% de CO 2 jusqu'à ce que les cellules présentent des signes évidents de perturbation en petites grappes.
    NOTE: Le temps d'incubation dépend du réactif utilisé. Pour la solution de passages sans enzyme mentionnée dans la section des matériaux, la durée d'incubation est d'environ 7 min.
  5. Ajouter 1 ml de DMEM / F-12 et de perturber les agrégats de cellules restantes dans des cellules individuelles par pipetage de haut en bas à l'aide d'une pipette de 1 ml. Utiliser cette fonction pour rincer les cellules de la surface et de transférer les cellules dans un tube de centrifugation. Pour récupérer toutes les cellules, laver chaque puits avec 1 ml de DMEM / F-12 et ajouter le support au tube de centrifugation.
  6. Centrifuger les cellules pendant 5 min à 300 x g. Aspirer le surnageant et remettre en suspension les cellules dans 5 ml ES milieu de culture cellulaire contenant 10 pM de la Rho-kinase (Roche) inhibiteur.
  7. Compter les cellules au microscope en utilisant un hémocytomètre et épépiner 150.000 - 400.000 cellules par 6 puits ou dans une autre disposition de la plaque, en fonction de la lignée cellulaire ES utilisée. Utilisez culture du milieu contenant l' inhibiteur de ROCK 10 um pour éviter l' apoptose et la culture des cellules dans un incubateur à 37 ° C et 5% de CO 2.
  8. Environ 24 heures après l'ensemencement Aspirer le milieu avec une pipette Pasteur en verre stérile et ajouter 2 ml de primitive moyenne série d'induction.
    Remarque: Ce milieu contient des concentrations finales de 1% de glutamine, 0,2% de FCS, 5 uM CHIR-99021 et 50 ng / ml d' activine A à l' avance du milieu RPMI-1640. Généralement, utiliser 2 ml de milieu de culture dans des plaques 6 puits.
  9. 48 heures après l'ensemencement, remplacer le milieu de l'endoderme milieu d'induction. Cultiver les cellules dans ce milieu pendant encore 48 heures avec changement de milieu par jour.
    Remarque: Ce milieu contient 1% de glutamine, 0,2% de FCS et 50 ng / ml d' activine A dans Advanced milieu RPMI-1640. Les cellules qui se sont engagés envers l'endoderme définitif expriment le marqueur de surface CXCR4. La coloration de CXCR4 peut être utilisé pour quantifier le nombre de cellules DE-commis.
  1. Pour la dernière 24 heures, mais au moins 1 heure avant la récolte des cellules, ajouter un inhibiteur de ROCK 10 uM au milieu de culture.
  2. Enduire la culture cellulaire-ware qui sera utilisé pour re-semis avec une matrice de membrane basale, à savoir, des plaques à 12 puits pour qPCR analyse ou chambre diapositives pour immunofluorescence. Incuber les plaques ou lames pendant au moins 30 min à température ambiante.
  3. Aspirer le milieu avec une pipette Pasteur en verre stérile, à partir des puits des cellules différenciées utilisées pour la coloration et / ou de tri.
  4. Ajouter 1 ml de réactif de la solution de passages sans enzyme pour la dissociation douce des amas de cellules. Incuber les cellules à 37 ° C et 5% de CO2 jusqu'à ce que les cellules présentent des signes évidents de perturbation en petites grappes.
    NOTE: Le temps d'incubation dépend du réactif utilisé. Pour la solution de passages sans enzyme mentionnée dans la materisection als, le temps d'incubation est d'environ 7 min.
  5. Ajouter 1 ml de DMEM / F-12 et de perturber restant agrégats de cellules dans des cellules individuelles par pipetage de haut en bas à l'aide d'une pointe de 1 ml. Utiliser cette fonction pour rincer les cellules de la surface et de transférer les cellules dans un tube de centrifugation. Pour récupérer toutes les cellules, laver chaque puits avec 1 ml de DMEM / F-12 w / o FCS et ajouter le support au tube de centrifugation.
  6. Compter les cellules au microscope en utilisant un hémocytomètre. Les cellules provenant de trois puits d'une plaque à 6 puits devraient aboutir à 10-15 x 10 6 cellules après trois jours de différenciation. Centrifuger les cellules pendant 5 min à 300 x g.
    NOTE: Le nombre exact de cellules obtenues dépendra de la lignée cellulaire pluripotente utilisée pour la différenciation.
  7. Aspirer le surnageant et remettre en suspension les cellules dans un tampon PEB contenant un inhibiteur de ROCK 10 uM. Utiliser 100 pl de ce tampon pour 10 7 cellules. Ajouter l'inhibiteur de ROCK 10 uM au jour de staining. Utilisez ce tampon pour toutes les applications en aval (appelés PEB tampon + RI).
    REMARQUE: tampon PEB contient 0,5% de BSA et 2 mM EDTA dans du PBS. Si plusieurs cellules doivent être colorées, régler le volume de la mémoire tampon en conséquence.
  8. Ajouter 10 ul d'un anticorps CXCR4 APC pour 10 7 cellules dans 100 ul, ce qui représente à peu près une dilution de 1:10.
    NOTE: L'utilisation d'un anticorps APC lié est pas obligatoire. Au contraire, il peut être remplacé en fonction des microbilles utilisées. Si plusieurs cellules sont colorées à ajuster le volume d'anticorps en conséquence.
  9. Mélanger doucement par retournement du tube avec les doigts et laisser incuber à 4 ° C dans un réfrigérateur pendant 15 min. Resuspendre les cellules avec PEB tampon de 1-2. Centrifuger les cellules pendant 5 min à 300 x g.
  10. Aspirer le surnageant avec une pipette Pasteur stérile en verre et remettre en suspension le culot cellulaire dans 80 ul PASE par 10 7 cellules et ajouter 20 ul de microbilles anti APC.
    REMARQUE:
  11. Mélanger doucement par retournement du tube avec les doigts et laisser incuber à 4 ° C dans un réfrigérateur pendant 15 min. Resuspendre les cellules avec PEB tampon de 1-2 + RI. Centrifuger les cellules pendant 5 min à 300 x g. Aspirer le tampon. Remettre en suspension dans 500 ul PEB tampon + RI.

3. Séparation magnétique de CXCR4 + Cellules

  1. Placez une colonne magnétique de taille moyenne dans un champ magnétique selon les instructions du fabricant. Pré-rincer la colonne avec 500 ul PEB tampon + RI. Appliquer la suspension de cellule entière à la colonne. Recueillir l'écoulement à travers les cellules car tous vont se lier à la colonne. Assurez-vous de ne pas perturber les colonnes pour une récupération optimale des cellules CXCR4 +.
  2. Laver la colonne trois fois avec 500 ul PEB tampon + RI. Recueillir le premier écoulement à travers et les combiner avec les cellules recueillies à l'étape 3.1. Retirer la colonne magnétique du champ magnétique et placez-le dans untube de collecte approprié. Ajouter 1 ml PEB tampon + RI sur la colonne. Pour éluer les cellules appuyez fermement sur le piston dans la colonne.
  3. Facultatif: Collecter tous les flux à travers des échantillons séparément et utiliser 20 pi chacun pour analyser le nombre de CXCR4 + cellules en utilisant la cytométrie de flux. Leur nombre devrait diminuer à chaque étape de lavage.
    REMARQUE: Au moins 2 x 10 4 viable, les cellules bloquées doivent être comptés pour obtenir des résultats fiables.
  4. Répétez les étapes 3.1-3.3 avec le flux collecté à travers l'échantillon de l'étape 3.1 et le premier écoulement à travers l'échantillon de l'étape 3.2 en utilisant une nouvelle colonne. Ne pas réutiliser la colonne précédente. En utilisant l'air de piston est pressée dans la colonne, ce qui le bloque.
  5. Compter les cellules au microscope en utilisant un hémocytomètre. En fonction de l'efficacité de la différenciation jusqu'à 6 x 10 6 cellules peuvent être triées d' abord et l' autre 1 x 10 6 cellules à l'aide d' une seconde colonne lors de l' utilisation de 10 7 cellules de la procédure. Centrifuger les cellules à 300 xg pendant 5 min. Aspirer le surnageant et avec un verre pipette Pasteur stérile, et remettre en suspension les cellules dans 1 ml de milieu d'induction endoderme à l'étape 1.9 avec un inhibiteur supplémentaire de 10 uM de roche.
  6. Compter les cellules au microscope en utilisant un hémocytomètre. Ensemencer les cellules à une densité appropriée, soit ~ 4 x 10 5 cellules par puits d'une plaque de 12 puits (app. 3,6 cm 2 de surface) ou ~ 1,5 x 10 5 cellules par puits d'une chambre-slide 8 puits.

4. Facultatif: Analyse de Purifié Population Endoderme Definitive

  1. Pour immunofluorescence fixer les cellules purifiées de l'étape 3.7 à peu près 24 heures après l'ensemencement avec 4% de paraformaldehyde et tache pendant endoderme définitif (DE) et / ou des protéines marqueurs de pluripotence.
    NOTE: Généralement utilisé DE marqueurs comprennent FOXA2 et Sox17, les marqueurs de pluripotence couramment utilisés comprennent OCT3 / 4, NANOG et SOX2 6, 8.
  2. foanalyse r RT-qPCR, récolter les cellules purifiées directement ou 24 heures après l'ensemencement, l'extrait total d'ARN et d'inverser la transcription d'ADNc à partir des échantillons d'ARN totale extraites. En utilisant 10 ng d' ADNc en tant que matrice pour la réaction de RT-PCR quantitative (triplicats) pour analyser l'expression de DE et les gènes marqueurs de la pluripotence 6, 8.
    NOTE: Les gènes marqueurs couramment utilisés sont mentionnés dans l' étape 4.1. les conditions de cycle sont 5 min à 95 ° C et 40 cycles de 15 s à 95 ° C et 1 min à 60 ° C, puis en faisant fondre l'analyse de la courbe.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

lors de la différenciation CES subissent des changements drastiques dans le gène et l' expression de la protéine. La figure 1 illustre les gènes marqueurs typiques qui peuvent être utilisés pour vérifier une différenciation endoderme réussie. Les principales cibles pour une analyse d'expression génique sont CGC, FOXA2 et Sox17. Dans une analyse relative expression du gène particulier FOXA2 et Sox17 sont augmentés de> 2.000 fois par rapport à CES indifférenciées. CGC est déjà exprimé très tôt dans les 24 heures pendant la formation de la ligne primitive mais il est néanmoins induit> 100 fois sur quatre jours. L'expression de ces gènes est par conséquent augmentée lors de tri en utilisant la surface CXCR4 marqueur 6. Les régulateurs maîtres pluripotent tels que OCT3 / 4 (POU5F1) et NANOG sont considérablement régulés à la baisse , bien que l'expression de ces gènes est encore détectable au bout de quatre jours. Cette indicates que certaines cellules ne répondent pas de manière adéquate au régime de traitement avec CHIR-99021 et activine A. expression du gène SOX7 est généralement adressée à discriminer la formation de l' endoderme extra-embryonnaire contre DE. Dans le premier cas Sox17 est co-exprimé avec SOX7 et dans ce dernier cas , Sox17 est co-exprimé avec FOXA2. Les résultats de la figure 1 indiquent que, avec DE certaines cellules extra-embryonnaires ont pu se former lors de la différenciation, même si on n'a pas encore été en mesure de colorer les cellules de SOX7 +.

La figure 2 illustre les différentes populations de cellules qui sont présentes après la différenciation des CES dans le DE. Dans l'étape 1 CES sont ensemencées en cellules individuelles et différenciées par traitement avec CHIR-99021 et activine A pendant quatre jours. La coloration IF du DE marqueurs et Sox17 FOXA2 (figure 2A) montre que les deux marqueurs sont uniformément co-exprimd dans les noyaux. Ceci est considéré comme une marque de DE engagement. Cependant, certaines cellules résistent au processus de différenciation et expriment aucun des deux protéines DE marqueurs (figure 2A). En fait, les deux populations cellulaires distinctes sont observées après la différenciation de quatre jours. Alors que de nombreuses cellules expriment le marqueur DE FOXA2 il existe encore des cellules restantes qui expriment le marqueur pluripotent SOX2 (figure 2B). Ces deux protéines sont exprimées dans deux populations distinctes et sans co-expression peut être observée (figure 2B).

Le troisième jour ou quatre de différenciation la protéine CXCR4 de surface est utilisée pour trier le CXCR4 + population DE-engagé et ainsi éliminer les cellules pluripotentes restantes et les autres lignées indésirables. En fonction de l'efficacité de la différenciation de la lignée cellulaire utilisée> 80% des cellules CXCR4 + peuvent être obtenus en utilisant le protocole de différenciation soulignée dans l' étape 1 8 figure 3 représente la cytométrie de flux de données après coloration et MACS purification de CXCR4 + cellules après différenciation vers DE et montre l'expression de dE et marqueurs de pluripotence protéines communes utilisant immunofluorescence (IF) coloration avant et après purification MACS. Le troisième jour de différenciation environ CXCR4 + cellules de 60% ​​en utilisant la coloration d'immunofluorescence pour CXCR4 décrit à l' étape 2 ont été obtenues (figure 3A, panneau du milieu). CXCR4 + les cellules se déplacent de T4 à T1 lors de la coloration avec un anticorps anti-CXCR4 conjugué à l'APC. Après la purification MACS décrit dans l'étape 3 de la population CXCR4 + est enrichi à 85%. Le procédé de purification, cependant, ne supprime pas toutes les lignées indésirables des cultures (figure 3A, panneau de droite).

Après la purification MACS,les CXCR4 + cellules peuvent être ensemencées pour analyse ultérieure ou éventuellement un second tour de tri peuvent être effectuées pour obtenir des puretés plus élevés, mais la viabilité réduite. Avant la différenciation de l'expression à grande échelle de l'SOX2 de marqueur pluripotent (teinté en vert) est détecté par IF coloration. Par contraste, le marqueur FOXA2 DE (teinté en rouge) ne peut être détectée (figure 3B). Dans la figure 3C CXCR4 + cellules sont colorées avec des anticorps pour FOXA2 (vert) et sont co-colorées pour l'SOX2 de marqueur pluripotent (rouge). Après l'ensemencement des CXCR4 + cellules purifiées cellules seulement peu de SOX2 + sont détectées. La majorité des cellules ensemencées sont positives pour le marqueur FOXA2 DE.

Figure 1
Figure 1. Changements représentatifs dans l' expression des gènes de différents gènes de pluripotence et marqueurs endoderme lors d' une différenciation de l' endoderme de quatre jours. (UNE) 7, A un traitement avec activine A seul, et CA-A (CHIR-99021 et activine A) le protocole, qui est utilisé pour MACS tri (voir détails dans 8). Les supports utilisés dans le CA-Un protocole sont ici désignés comme primitifs moyen série d'induction et moyenne endoderme d'induction. (B) Représenté est l'expression génique mesurée par RT-qPCR de la CGC, Sox17 et FOXA2, qui sont exprimées sur l' engagement de l' endoderme définitif sans d' autres MACS tri. POU5F1 (OCT3 / 4) et NANOG sont des régulateurs de pluripotence et typiquement régulés à la baisse lors de la différenciation, alors que SOX7 est exprimé dans l' endoderme extra-embryonnaire. L'expression génique a été normalisée par rapport à trois gènes de ménage de manière stable exprimés (<em> TBP, TUBA1A, G6PD) résultant des valeurs CNRQ. L'expression des gènes mentionnés ci-dessus dans des cellules indifférenciées a été fixée à 1 et les changements sont tracés comme facteur de variation de l'expression génique. Les valeurs sont des moyennes ± SEM, n = 4-5. ANOVA plus de Bonferroni de test post-hoc. ** P ≤ 0,01 par rapport à aléatoire et #P ≤ 0,05, ## P ≤ 0,01 par rapport à RP (toutes les données au sein de ce chiffre ont été publiés récemment dans 8). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Les populations cellulaires différentes après la différenciation de l' endoderme. (A) Coloration du DE marqueurs Sox17 et FOXA2 avec des anticorps respectifs sur d4 de différenciation révèle leur co-localisation homogène. Cependant, certainesles cellules ont résisté au processus de différenciation et ne reflètent pas ces marqueurs (coloration au bleu de noyau seulement). La fusion de la coloration verte et rouge est représenté en jaune. (B) Après DE différenciation , il existe deux populations cellulaires distinctes. cellules DE-comme expriment FOXA2 tandis que les cellules qui ont résisté le processus de différenciation expriment toujours le SOX2 de marqueur pluripotent. (AB) Les noyaux ont été DAPI (bleu). Barre d'échelle dans le panneau (A) est de 50 um et dans le panneau (B) est de 100 uM. L' imagerie a été effectuée à 670 nm (rouge, Cy5), 520 nm (vert, FITC) et 433 nm (bleu, DAPI), respectivement. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. MACS de tri des populations de cellules différenciées DE et représentant staining après le tri. (A) CXCR4 + cellules colorées (Q1) sont enrichis après MACS de tri. Le nombre de cellules CXCR4 (Q4) est diminuée. En fonction de la lignée cellulaire étant utilisé les rendements du protocole de différenciation> 80% de cellules CXCR4 positives 8 et MACS peut être utilisé pour enrichir eux. (B) cellules indifférenciées exprimant le SOX2 de marqueur pluripotent (vert) , mais pas le marqueur FOXA2 DE (rouge ). (C) Après les MACS de tri des cellules seulement très peu de SOX2 indifférenciée + restent (rouge), alors que la population triée exprime presque uniformément le marqueur FOXA2 dE (vert). (BC) Les noyaux ont été DAPI (bleu). Barre d'échelle dans le panneau (C) est de 100 um et applique à tous les panneaux. L' imagerie a été effectuée à 670 nm (rouge, Cy5), 520 nm (vert, FITC) et 433 nm (bleu, DAPI), respectivement. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

protocoles de différenciation utilisés actuellement aboutissent rarement à 100% de cellules différenciées. Pour des raisons qui restent à aborder certaines cellules résistent au processus de différenciation. En fonction de l'efficacité du protocole de différenciation utilisé et la propension de l'ESC aligner un certain nombre de cellules pluripotentes résiduelles sont couramment observée même après différenciation dans l'endoderme définitif. Ces cellules résiduelles peuvent affecter différenciations en aval ou d'autres analyses telles que la transcriptomique, protéomique, et miRNA analyse de l'expression. cellules pluripotentes résiduelles ou d'autres lignées indésirables peuvent également présenter des effets paracrines qui peuvent interférer avec les objectifs de différenciation. Par conséquent, l'élimination de ces cellules peut entraîner une amélioration de la reproductibilité.

La purification de CXCR4 + cellules exprimant endoderme après différenciation peut être utilisée pour enrichir ces populations et pour éliminer les cellules qui ont résisté le processus de différenciation.Le DE surface CXCR4 protéine marqueur peut être utilisé pour la purification spécifique de cellules de l'endoderme. Le protocole de purification MACS à portée de main peut être complété en moins de 2 heures et peut être exécuté dans un format paillasse simple dans chaque laboratoire de culture cellulaire sans équipement et appareils de laboratoire coûteux. purification FACS est une technique couramment utilisée, mais emploie des conditions difficiles. FACS des cellules pendant purifications sont généralement maintenues en suspension pendant une période de temps prolongée , et les cellules sont soumises à d' autres facteurs stimulants, par exemple, haute pression dans la buse du dispositif FACS. En comparaison, le procédé MACS est rapide et douce. Cela améliore la capacité des cellules à refixer pendant réensemencement après le processus de purification. Pour faciliter davantage ce recollement un inhibiteur de ROCK est ajouté au milieu de culture après et avant la purification pour empêcher l'apoptose. Un autre facteur important qui influence recollement est la densité à laquelle les cellules sont réensemencées. Cette forte Depends sur la lignée cellulaire utilisée. Les nombres de cellules utilisées pour l'ensemencement dans cette étude sont le nombre de cellules représentatives qui fonctionnent bien dans nos mains. Cependant, il peut être nécessaire d'ajuster ces chiffres pour différentes lignées cellulaires. Ces deux mesures, l'addition d'un inhibiteur de ROCK et l'évaluation du nombre de cellules pour réensemencement, sont essentiels pour le succès de la culture cellulaire en outre, après le tri.

Avec le DE protocole de différenciation utilisé> 70% CXCR4 cellules typiquement + peuvent être obtenus sans tri 8. Les performances du protocole utilisé pour la génération DE influence par voie de conséquence l'efficacité du protocole MACS de purification ultérieure. D'une manière générale, la différenciation efficace (> cellules CXCR4 + 80%), on obtient une plus grande pureté après le tri MACS (jusqu'à 95%). Ainsi, l'utilisation de ce procédé de purification permet de réduire le nombre de cellules non différenciées, mais pratiquement 100% de pureté ne peuvent pas être obtenus. Dans le futur, les marqueurs de surface spécifiques de la lignée peuvent être définies tchapeau permettra la purification des cellules plus différenciées. La procédure de tri MACS est la sélection de choix pour cette fin.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

L'assistance technique habile de Jasmin Kresse est grandement appréciée.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics