कैंसर की स्थापना मानव परम्परागत ऑस्टिओसारकोमाः से स्टेम सेल संस्कृतियों

Cancer Research

Summary

हड्डी sarcomas में (सीएससी) कैंसर स्टेम कोशिकाओं की उपस्थिति हाल ही में उनके रोगजनन से जोड़ा गया है। इस अनुच्छेद में, हम सीएससी की क्षमता nonadherent की शर्तों के तहत विकसित करने के लिए उपयोग करते हुए पारंपरिक osteosarcoma (ओएस) के मानव बायोप्सी से प्राप्त प्राथमिक सेल संस्कृतियों से सीएससी के अलगाव प्रस्तुत करते हैं।

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

osteosarcoma (ओएस) के खिलाफ उपचार में मौजूदा सुधार के कैंसर के रोगियों के जीवन में लंबे समय तक है, लेकिन पांच साल के जीवित रहने की दर गरीब बना रहता है जब मेटास्टेसिस हुई है। कैंसर स्टेम सेल (सीएससी) के सिद्धांत का मानना ​​है कि ट्यूमर क्षमता ट्यूमर बनाए रखने के लिए और बहुऔषध कीमोथेरेपी का विरोध करने सहित स्टेम तरह विशेषताओं, भीतर ट्यूमर कोशिकाओं के एक सबसेट है कि वहाँ। इसलिए, ओएस जीव विज्ञान और रोगजनन का एक बेहतर समझ आदेश लक्षित चिकित्सा के विकास के अग्रिम करने के लिए इस विशेष सबसेट उन्मूलन के लिए और मरीजों के बीच रुग्णता और मृत्यु दर को कम करने की जरूरत है। सीएससी अलग, सीएससी के सेल संस्कृतियों की स्थापना, और उनके जीव विज्ञान का अध्ययन ओएस जीव विज्ञान और रोगजनन की हमारी समझ में सुधार के लिए महत्वपूर्ण कदम उठाए हैं। ओएस की बायोप्सी से मानव व्युत्पन्न ओएस-सीएससी की स्थापना के लिए कई तरीकों का उपयोग कर संभव बनाया गया है, nonadhere के तहत 3 आयामी स्टेम सेल संस्कृतियों बनाने की क्षमता सहितNT की स्थिति। इन शर्तों के तहत सीएससी गोलाकार चल बेटी स्टेम कोशिकाओं द्वारा गठित कालोनियों बनाने में सक्षम हैं; इन कालोनियों "सेलुलर क्षेत्रों" कहा जाता है। यहाँ, हम पारंपरिक ओएस ओएस बायोप्सी से प्राप्त की प्राथमिक सेल संस्कृतियों से सीएससी संस्कृतियों की स्थापना के लिए एक विधि का वर्णन। हम स्पष्ट रूप से कई अलग और सीएससी को चिह्नित करने के लिए आवश्यक अंश का वर्णन है।

Introduction

Sarcomas भ्रूण mesoderm 1 से मुख्य रूप से होने वाले दुर्लभ घातक ट्यूमर संयोजी ऊतक का एक विषम समूह हैं। विभिन्न प्रकार की हड्डी sarcomas और कोमल ऊतक सार्कोमा शामिल हैं। अस्थि sarcomas, अपेक्षाकृत असामान्य प्राथमिक ट्यूमर के एक समूह, osteosarcoma (ओएस) सहित कई उपप्रकार, से मिलकर बनता है। ओएस, हड्डी का सबसे आम प्राथमिक ट्यूमर से एक, एक mesenchymal द्रोह कि व्यापक नैदानिक, ऊतकीय, और आणविक विषमताओं 2, 3 दर्शाती है। दुर्भाग्य से, ओएस मुख्य रूप से बच्चों और युवा वयस्कों 4 में होता है, 5 और 60% का प्रतिनिधित्व करता है बचपन में हड्डी सार्कोमा के आम histologic उपप्रकार 6, 7। ओएस आम तौर पर प्रभावित करता कंकाल क्षेत्रों, जो तेजी से हड्डियों के विकास की विशेषता है (जैसे, लंबी हड्डियों के रक्ताधान)। ओएस, पारंपरिक ओएस, भी दिमाग़ी या केंद्रीय ओएस कहा जाता है की histologically विभिन्न उपप्रकार के बीच, द्रोह का एक उच्च ग्रेड और एक कोटा शा है80% 8 की पुन। यह 80% से 60% पारंपरिक osteoblastic ओएस, 10% chondroblastic ओएस, और 10% fibroblastic ओएस 6, 8-10 से बना है। अन्य ओएस उपप्रकार anaplastic, telangiectatic, विशाल सेल से भरपूर और छोटे सेल ओएस शामिल हैं। संयुक्त सर्जरी और ओएस के प्रबंधन में कीमोथेरेपी के क्षेत्र में प्रगति के बावजूद, परिणाम मेटास्टेसिस 11, 12 के बिना गरीब बना रहता है, रोगियों में 65-70% की एक लंबी अवधि के जीवित रहने की दर के साथ। दूर पुनरावृत्ति अक्सर मेटास्टेसिस के रूप में या, कम बार फेफड़े के मेटास्टेसिस के रूप में हो, दूर हड्डियों और स्थानीय पुनरावृत्ति करने के लिए 13। मेटास्टेसिस अक्सर पारंपरिक उपचार के लिए प्रतिरोधी रहे हैं। यह प्रतिरोध कारण है कि 10 साल के रोग से मुक्त अस्तित्व निदान 14, 15 पर मेटास्टेटिक रोग के साथ रोगियों में लगभग 30% है।

सामान्य ऊतक के साथ के रूप में, कैंसर के ऊतकों सेल प्रकार की एक विषम संग्रह से बना है। ट्यूमर के भीतर कोशिकाओं के विकास के विभिन्न चरणों के अनुरूप करने लगते हैं। किसी भी n के भीतरormal ऊतक selfrenew करने की क्षमता के साथ कोशिकाओं के एक उप-जनसंख्या निवास करती है, इस प्रकार के ऊतकों homeostasis के लिए पूर्वज और परिपक्व कोशिकाओं को प्रदान करते हैं। इसी तरह, कैंसर की कोशिकाओं की एक ऐसी ही विषम आबादी के विकास के विभिन्न चरणों में, प्रसार और tumorigenic क्षमता के विभिन्न डिग्री के साथ बना है। इन कैंसर कोशिकाओं के एक सबसेट, करार दिया कैंसर स्टेम कोशिकाओं (सीएससी), selfrenew और ट्यूमर की घातक क्षमता बनाए रखने के लिए विशेष क्षमता के साथ कोशिकाओं selfsustaining, इस प्रकार पैदा अलग सेल प्रजातियों कि ट्यूमर थोक 16 गठन के एक जलाशय का गठन किया। 1990 के दशक में तीव्र myeloid लेकिमिया पर अध्ययन सीएससी उप-जनसंख्या 17, 18 के अस्तित्व के लिए पहली बार सम्मोहक सबूत प्रदान की है। सीएससी के बाद से ठोस ट्यूमर 19 की एक बड़ी संख्या से पृथक किया गया है, जिससे कैंसर अनुसंधान के क्षेत्र में सबसे अधिक शोध विषयों में से एक बन गया। सीएससी वास्तव में जीन है कि सामान्य बनाने में म्यूटेशन द्वारा सामान्य स्टेम कोशिकाओं से पैदा हो सकता हैकैंसर 20-23 स्टेम कोशिकाओं। एकाधिक बदलने म्यूटेशन और microenvironment के साथ बातचीत भी स्वस्थ पूर्वज और परिपक्व कोशिकाओं selfrenewal क्षमता और अमरत्व कि सीएससी पाई जाती प्राप्त करने के लिए योगदान कर सकता है। इस परिवर्तन के बारे में कई परिकल्पना कर रहे हैं। स्वस्थ पूर्वज, स्वस्थ परिपक्व कोशिकाओं, और कैंसर की कोशिकाओं, कोशिकाओं को स्टेम dedifferentiate कर सकते हैं, selfrenewal-जुड़े जीन 24-28 सक्रिय द्वारा एक स्टेम-तरह phenotype प्राप्त करने के। हाल ही में कई अध्ययनों के बावजूद, सीएससी के मूल अभी तक की खोज की जा करने के लिए है।

सीएससी की एक खास विशेषता है कि उनकी क्षमता बहु चिकित्सा दृष्टिकोण, संयुक्त सर्जरी और विभिन्न दवाओं के साथ कीमोथेरेपी के होते हैं जो विरोध करने के लिए है। हाल के अध्ययनों से पता चला है कि सीएससी भी कीमोथेरेपी एजेंटों साइटोटोक्सिक के लिए प्रतिरोध प्राप्त कर सकते हैं। इस प्रतिरोध के लिए संभव स्पष्टीकरण एटीपी बाध्यकारी कैसेट (एबीसी) बहुऔषध ट्रांसपोर्टर की overexpression शामिल हैं (यानी,MDR1 और BCRP1), ऐसे एल्डिहाइड डिहाइड्रोजनेज 1 (ALDH1), और / या सेल चक्र कैनेटीक्स 30-33 में परिवर्तन के रूप में कीमोथेरेपी metabolizing एंजाइमों की overexpression। इन सभी अवधारणाओं है कि इस प्रकार अब तक वर्णित किया गया है का सीधा परिणाम है कि एक कैंसर के उपचार कारगर होगा ही अगर सीएससी उप-जनसंख्या पूरी तरह से सफाया कर रहे थे, जबकि स्थानीय पुनरावृत्ति या दूर मेटास्टेसिस हो सकता है यदि एक भी सीएससी बच गया है।

क्योंकि यह रोगियों बाद में डूबने के लिए क्यों कई उपचार शुरू में प्रभावी होने लगते हैं के रूप में एक संभावित व्याख्या प्रदान करता है, लेकिन मानव sarcomas 34, विशेष रूप से ओएस 35, या किसी अन्य हड्डी और कोमल ऊतकों के कैंसर में, में सीएससी की खोज के महान नैदानिक महत्व है। इसलिए, पारंपरिक ओएस के खिलाफ लड़ाई भविष्य के लिए आशा अभिनव इस उप की आणविक लक्षण वर्णन करने के लिए ओएस सीएससी धन्यवाद के निर्देश पर दवाओं के विकास के आधार पर नए और विशिष्ट लक्षित चिकित्सा मिल रहा हैजनसंख्या और सीएससी जीव विज्ञान के अध्ययन के लिए।

1992 में, रेनॉल्ड्स और उनके सहयोगियों, जांच कर रहे थे जो कि क्या स्टेम कोशिकाओं के एक सबसेट वयस्क स्तनधारी मस्तिष्क में मौजूद था, स्टेम कोशिकाओं की तरह 36, 37 होने का संदेह कोशिकाओं को अलग करने के लिए एक विधि विकसित की है। इस विधि की विशेष क्षमता पर आधारित है जब nonadherent परिस्थितियों में विकसित इन कोशिकाओं गोलाकार कालोनियों के रूप में। इसी तरह की तकनीक हड्डी sarcomas 38 में स्टेम कोशिकाओं की तरह का एक उप-जनसंख्या अध्ययन करने के लिए 2005 में गिब्स और उनके सहयोगियों द्वारा कार्यरत थे। अलग और पारंपरिक ओएस के विभिन्न प्रकार के प्राथमिक सेल संस्कृतियों से विशेषताएँ ओएस सीएससी के लिए, हम ओएस सेल लाइनों के लिए इस तकनीक को अनुकूल करने के लिए फैसला किया।

यहाँ, हम क्षेत्र के गठन परख के इस अनुकूलित विधि, कहा "sarcosphere परख", जो परिमित प्राथमिक सेल पारंपरिक ओएस के मानव बायोप्सी से निकाली गई लाइनों से अलग करने के लिए ओएस सीएससी इस्तेमाल किया जा सकता का वर्णन है। हम यह भी सभी तकनीकों का वर्णन Uइस परख द्वारा पृथक सेल लाइनों के तने की तरह सीएससी phenotype मान्य करने के लिए sed:) 1) जीन है कि pluripotent भ्रूण स्टेम कोशिकाओं (ESCs विशेषताएँ की अभिव्यक्ति का मूल्यांकन और CD133 जीन है, जो सीएससी के एक मार्कर है; 2) कॉलोनी के गठन इकाई (CFU) परख; 3) इन कोशिकाओं की क्षमता उचित भेदभाव की शर्तों के तहत अस्थिकोरक और adipocytes में अंतर करने का मूल्यांकन; 4) mesenchymal स्टेम कोशिकाओं की सतह मार्कर (MSCs) (यानी, CD44, CD105 और Stro -1) immunofluorescence धुंधला द्वारा और प्रवाह cytometric विश्लेषण द्वारा के अध्ययन; 5) इन कोशिकाओं के ALDH गतिविधि का मूल्यांकन।

Protocol

यहाँ बताया मानव ऊतकों का उपयोग करते हुए सभी प्रयोगों स्थानीय नैतिक समिति (राइफल्स। एन 141/12) द्वारा अनुमोदित किया गया था। ऊतकों के नमूनों के संग्रह के लिए और उपयोग और नमूने के भंडारण के लिए सूचित सहमति AOUC पर दानदाताओं से प्राप्त हुई थी।

1. संस्कृति के लिए तैयारी

  1. 10% भ्रूण गोजातीय सीरम (FBS), 100 आइयू / एमएल पेनिसिलिन और 100 माइक्रोग्राम / कून के संशोधित हाम F12 मध्यम मिलीलीटर स्ट्रेप्टोमाइसिन जोड़कर विकास संस्कृति के माध्यम से (जीएम) तैयार करें। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग जीएम बाँझ। 1 महीने के लिए 4 डिग्री सेल्सियस पर स्टोर जीएम।
  2. कून के संशोधित हाम F12 मध्यम करने के लिए 20% FBS, 100 आइयू / एमएल पेनिसिलिन, 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन और 3 मिलीग्राम / एमएल collagenase प्रकार द्वितीय जोड़कर कोलैजिनेज़ मध्यम (मुख्यमंत्री) तैयार करें। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग कर मुख्यमंत्री बाँझ। 1 महीने के लिए -20 डिग्री सेल्सियस पर स्टोर मुख्यमंत्री।
  3. 40% FBS जोड़कर सेल ठंड (एफएम) के लिए मध्यम तैयार, 100 आइयू / एमएल पेनिसिलिन, 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन और 6.5% Dimethylsulfoxide (DMSO) कून के संशोधित हाम F12 मध्यम करने के लिए। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग एफएम बाँझ। 1 महीने के लिए 4 डिग्री सेल्सियस पर स्टोर एफएम।
  4. कून के संशोधित हाम F12 मध्यम करने के लिए 20% FBS, 100 आइयू / एमएल पेनिसिलिन और 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन जोड़कर CFU परख (CFUM) के लिए मध्यम तैयार करें। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग CFUM बाँझ। स्टोर CFUM 4 डिग्री सेल्सियस पर 1 महीने तक।
  5. मिलीलीटर Dulbecco फास्फेट buffered खारा (DPBS) के बिना सीए 2 और 2 मिलीग्राम + 1000 में ग्लूकोज निर्जल - 400 मिलीग्राम trypsin, 200 मिलीग्राम EDTA और 1000 मिलीग्राम डी (+) भंग द्वारा trypsin तैयार करें।
    नोट: अप करने के लिए 3 महीने के लिए -20 डिग्री सेल्सियस पर एक 0.22 माइक्रोन फिल्टर और फ्रीज का उपयोग कर 25 सेमी में 50 मिलीलीटर aliquots में ताजा trypsin-EDTA फूट डालो 2 बोतल। स्टोर गतिविधि की हानि के बिना 4 डिग्री सेल्सियस पर thawed फिल्टर निष्फल aliquots।
  6. , 100 आइयू / एमएल पेनिसिलिन, 100 माइक्रोग्राम / एमएल streptom 10% FBS जोड़कर स्टेम सेल के विकास मध्यम (SCGM) तैयारycin, और 10 एनजी / एमएल bFGF (25 माइक्रोग्राम / एमएल शेयर) कून के संशोधित हाम F12 मध्यम करने के लिए। 4 डिग्री सेल्सियस पर एक 0.22 माइक्रोन फिल्टर और दुकान SCGM 2 सप्ताह तक का उपयोग कर SCGM फ़िल्टर।
  7. के लिए 3 डी 4 डिग्री सेल्सियस पर ultrapure एच 2 ओ में एम सी भंग द्वारा 2% methylcellulose (एमसी) तैयार करें। जब एम सी पूरी तरह से भंग कर रहा है, यह आटोक्लेव और 4 डिग्री सेल्सियस पर स्टोर।
    ध्यान दें: के बाद एम सी निष्फल है, यह ठोस हो जाता है। 4 डिग्री सेल्सियस पर एक तरल अवस्था, स्टोर करने के लिए एम सी लाने के लिए।
  8. sarcosphere मध्यम विकास (एसजीएम) तैयार करें। 100 आइयू / एमएल पेनिसिलिन, 100 माइक्रोग्राम / एमएल मानव bFGF (25 माइक्रोग्राम / एमएल शेयर) जोड़कर इस माध्यम ताजा (न प्रयोग करने से पहले अधिक से अधिक 2 सप्ताह) तैयार, 20 एनएम प्रोजेस्टेरोन (10 माइक्रोन के शेयर), 100 माइक्रोन के प्यूटर्साइन, 30 एनएम सोडियम Selenite (30 माइक्रोन शेयर), 25 माइक्रोग्राम / एमएल transferrin (25 मिलीग्राम / एमएल शेयर), 20 माइक्रोग्राम / एमएल इंसुलिन (20 मिलीग्राम / एमएल शेयर), और 10 एनजी / एमएल मानव EGF (10 माइक्रोग्राम / एमएल शेयर) 2X को कून के संशोधित हाम F12 मध्यम। फिल्टर और एक 0.22 माइक्रोन fil का उपयोग कर SGM बाँझआतंकवाद। 4 डिग्री सेल्सियस पर 2 सप्ताह के लिए दुकान।
  9. 10% FBS (दक्षिण अमेरिकी मूल), 100 आइयू / एमएल पेनिसिलिन, 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन, 10 एनएम dexamethasone (100 माइक्रोन के शेयर), 0.2 मिमी सोडियम एल Ascorbyl-2-फॉस्फेट जोड़कर osteogenic मध्यम (ओम) तैयार (1 एम स्टॉक), 10 मिमी β-glycerophosphate (5 मिलीग्राम / एमएल शेयर) और कून के संशोधित हाम F12 मध्यम करने के लिए 1 माइक्रोग्राम / एमएल calcein (200 माइक्रोग्राम / एमएल शेयर)। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग ओम बाँझ। 4 डिग्री सेल्सियस पर स्टोर।
    नोट: तरल नाइट्रोजन के तहत स्टोर dexamethasone स्टॉक समाधान उनकी गतिविधियों को बनाए रखने के लिए। आदेश माध्यम की भेदभाव की क्षमता बनाए रखने के लिए dexamethasone की गतिविधि को बनाए रखने के लिए नए सिरे से ओम हर 2 सप्ताह तैयार करें।
  10. 0.2 मिलीग्राम कश्मीर 2 4 HPO और 200 मिलीलीटर में 0.007 मिलीग्राम EDTA आसुत जल (DH 2 हे) भंग 1.66 मिलीग्राम एनएच 4 सीएल द्वारा एरिथ्रोसाइट lysis बफर (ईएलबी) तैयार करें। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग ईएलबी बाँझ। 4 डिग्री पर स्टोरसी।
  11. जोड़कर adipogenic मध्यम (एएम) तैयार 10% FBS (दक्षिण अमेरिका मूल), 100 आइयू / एमएल पेनिसिलिन, 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन, 1 माइक्रोन dexamethasone (1 मिमी शेयर), 1 माइक्रोन गोजातीय इंसुलिन (10 मिमी शेयर), 0.5 मिमी isobutylmethylxanthine (IBMX) (500 मिमी शेयर), और 100 माइक्रोन के इंडोमिथैसिन (200 मिमी) कून के संशोधित हाम F12 मध्यम करने के लिए। फिल्टर और एक 0.22 माइक्रोन फिल्टर का उपयोग कर रहा बाँझ। 4 डिग्री सेल्सियस पर स्टोर।
    नोट: तरल नाइट्रोजन के तहत स्टोर dexamethasone स्टॉक समाधान उनकी गतिविधियों को बनाए रखने के लिए। आदेश माध्यम की भेदभाव की क्षमता बनाए रखने के लिए dexamethasone की गतिविधि को बनाए रखने के लिए ताजा कर रहा हूँ हर 2 सप्ताह तैयार करें।
  12. तैयार 2% DPBS में गोजातीय सीरम albumin (बीएसए) (बीएसए / DPBS)। 500 मिलीलीटर DPBS में 10 ग्राम बीएसए को भंग करने और 50 मिलीलीटर शंक्वाकार ट्यूब में 50 मिलीलीटर शेयर समाधान aliquotting द्वारा शेयर समाधान तैयार है। -20 डिग्री सेल्सियस पर स्टोर।
  13. DPBS (पीएफए / DPBS) में 4% paraformaldehyde (पीएफए) के घोल तैयार करें। एक चर्चा मेंemical डाकू, DPBS में paraformaldehyde पतला और 50 मिलीलीटर शंक्वाकार ट्यूब में 50 मिलीलीटर शेयर समाधान aliquotting द्वारा शेयर समाधान तैयार है। 4 डिग्री सेल्सियस पर स्टोर।

2. प्राथमिक ओएस सेल संस्कृतियों और ओएस परिमित सेल लाइनों की स्थापना (ओएसए)

नोट: प्राथमिक ओएस सेल संस्कृतियों "Unità ORTOPEDIA Oncologica ई Ricostruttiva", AOUC Careggi, फ्लोरेंस पर एकत्र पारंपरिक ओएस बायोप्सी की ताजा नमूनों से तैयार थे। सभी बायोप्सी, जो सुई आकांक्षा या ट्यूमर (चित्रा 1 ए, बी), के एक छोटे से हिस्से की शल्य लकीर द्वारा प्राप्त किया गया तुरंत संस्कृति के माध्यम से 100 आइयू / एमएल पेनिसिलिन और 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन (7.4 पीएच) और के साथ पूरक में रखा गया प्रयोगशाला, जहां वे प्रोसेस किया गया के लिए ले जाया। सभी वर्णित जोड़तोड़ एक लामिना का प्रवाह हुड का उपयोग कर सड़न रोकनेवाला की शर्तों के तहत आयोजित की गई।

  1. ओएस कोशिकाओं का अलगाव
    1. एक में बायोप्सी की जगहजीएम की एक छोटी मात्रा के साथ 100 मिमी पेट्री डिश। एक बाँझ नुकीला और पेरी चिमटी के साथ, उन्हें संभव के रूप में छोटे टुकड़ों में काटने से ओएस ऊतकों के नमूनों भरती (0.5 - 1 मिमी) (चित्रा 2A, बी)।
    2. Enzymatic पाचन (चित्रा 2 बी) के लिए 10 मिलीलीटर मुख्यमंत्री के साथ ऊतक टुकड़े कवर और एक 37 डिग्री सेल्सियस, 5% सीओ 2 इनक्यूबेटर में 3 घंटे के लिए सेते हैं। धीरे से एक पिपेट का उपयोग टुकड़े के निलंबन को दूर करने और तत्काल centrifugation (5 मिनट के लिए 400 XG) टुकड़े गोली के लिए एक 15 मिलीलीटर शंक्वाकार ट्यूब को हस्तांतरण।
      नोट: centrifugation के बाद, यदि बायोप्सी एरिथ्रोसाइट्स में अमीर हैं, एक लाल एरिथ्रोसाइट्स की रचना जमा टुकड़े पर देखा जा सकता है। इसलिए, यांत्रिक फैलाव के लिए आगे बढ़ने से पहले, एरिथ्रोसाइट lysis बफर के साथ नमूना इलाज करते हैं। आकांक्षा से सतह पर तैरनेवाला त्यागें और 5 मिलीलीटर ईएलबी जोड़ें।
    3. 1 मिनट के लिए गोली के टुकड़े को निलंबित और 2 के लिए 400 XG पर निलंबन अपकेंद्रित्रमि। आकांक्षा से सतह पर तैरनेवाला निकालें। 5 मिलीलीटर जीएम जोड़ें और यंत्रवत् एक 10 मिलीलीटर सीरम वैज्ञानिक पिपेट (खोलने आकार, 1.5 मिमी आंतरिक ओ) 10 का उपयोग टुकड़े को तितर-बितर - 20 बार।
    4. 5 मिनट के लिए 400 XG पर निलंबन अपकेंद्रित्र। आकांक्षा से सतह पर तैरनेवाला निकालें, 10 मिलीलीटर जीएम के साथ सेल गोली निलंबित, और फिर एक 100 मिमी पेट्री डिश में जिसके परिणामस्वरूप सेल निलंबन हस्तांतरण। एक 37 डिग्री सेल्सियस, 5% सीओ 2 इनक्यूबेटर में पेट्री डिश सेते हैं और ताजा पूरा जीएम हर 3 डी के साथ जीएम की जगह।
      नोट: अक्सर, ओएस ऊतक सुई आकांक्षा से प्राप्त नमूनों बहुत छोटे हैं और हड्डी के टुकड़े, जो कोलैजिनेज़ साथ enzymatic पाचन से पचता नहीं कर रहे होते हैं। इसलिए, के बाद सतह पर तैरनेवाला हटा दिया गया है, एक विंदुक के साथ गोली टुकड़े mashing द्वारा हड्डी के ऊतकों से कोशिकाओं को अलग करने का प्रयास।
  2. उपसंस्कृति
    नोट:
    एक ओएसए की स्थापना करने के लिए, जब कोशिकाओं अनुमानित संगम तक पहुँचते हैं, उन्हें उनके व्यापार से हटा देंआर संस्कृति पोत, पतला, और आगे के विकास को सक्षम करने के लिए एक ताजा प्लेट में रख दें। इस उपसंस्कृति प्रक्रिया enzymatic प्रक्रिया trypsinization करार दिया का उपयोग कर हासिल की है।
    1. आकांक्षा से मध्यम निकालें। - (20 डिग्री सेल्सियस अधिकतम 18) धीरे एक बार हिला, और आकांक्षा से तुरंत हटाने trypsin आरटी पर 3 मिलीग्राम trypsin - सेल monolayer अलग कर देना करने के लिए, 2 जोड़ें। दो बार दोहराएँ। 3 के लिए 37 डिग्री सेल्सियस पर कोशिकाओं को सेते - 4 मिनट तक वे अलग करने के लिए शुरू करते हैं।
      नोट: अच्छा trypsinization थोड़ा अपारदर्शी monolayer में बनाने जब पकवान प्रकाश में आयोजित किया जाता है छोटे छेद के रूप में अनुभवी उपयोगकर्ता के द्वारा देखा जा सकता है। इस हदबंदी भी एक औंधा माइक्रोस्कोप का उपयोग पर नजर रखी जा सकती है; इस दृष्टिकोण शुरुआती के लिए सिफारिश की है।
    2. 10 मिलीलीटर जीएम जोड़कर trypsin प्रतिक्रिया बंद करो और अच्छी तरह से पकवान धोने के सभी कोशिकाओं को अलग करने के लिए एक पिपेट का उपयोग। स्थानांतरण एक नया 100 मिमी पेट्री डिश के निलंबन के 1 मिलीलीटर और 9 मिलीलीटर जीएम (कोशिकाओं के विभाजन 1/10) जोड़ें।
      ध्यान दें:
  3. ओएस प्राथमिक संस्कृतियों और ओएसए की cryopreservation
    नोट: 4-5 cryovials में एक मिला हुआ 100 मिमी पेट्री डिश रुक। cryopreservation की प्रक्रिया जल्दी से किया जाना चाहिए, क्योंकि DMSO, जो ठंड के दौरान कोशिका झिल्ली की रक्षा करता है, गैर ठंड तापमान पर कोशिकाओं को विषैला होता है।
    1. trypsinization द्वारा monolayer से अलग कर देना सेल संस्कृतियों 5 मिनट के लिए 400 XG पर (धारा 2.2 देखें), गोली कोशिकाओं centrifugation द्वारा, आकांक्षा से सतह पर तैरनेवाला हटाने, और फिर जल्दी एफएम में सेल गोली निलंबित।
    2. अशेष क्रायोजेनिक शीशी प्रति इस निलंबन के 1 मिलीलीटर। इसके तत्काल बाद 2-propanol और दुकान immedia की एक जैकेट के साथ एक फ्रीजर बॉक्स में भरा शीशियों जगहtely -80 डिग्री सीओ / एन पर। स्थानांतरण तरल नाइट्रोजन के लिए लंबी अवधि के भंडारण के लिए अगले दिन cryovials।
  4. Defrost ओएस सेल लाइनों और प्राथमिक संस्कृतियों
    1. तरल नाइट्रोजन भंडारण से Defrost ओएस सेल लाइनों, 37 डिग्री सेल्सियस पर एक प्रयोगशाला नहाने के पानी में उन्हें रखने के द्वारा तेजी से विगलन cryovials। एक 15 मिलीलीटर शंक्वाकार ट्यूब में cryovials की सामग्री हस्तांतरण और जीएम के लगभग 10 मिलीलीटर (DMSO दूर करने के लिए खंड 2.3 देखें) जोड़ें। आकांक्षा से सतह पर तैरनेवाला निकालें और 10 मिलीलीटर जीएम में सेल गोली निलंबित। एक 100 मिमी पेट्री डिश में सेल निलंबन की थाली और एक 37 डिग्री सेल्सियस, 5% सीओ 2 इनक्यूबेटर में सेते हैं।

3. Sarcosphere परख पृथक ओएस सीएससी

नोट: इस प्रयोग ओएसए पर किया जाता है। इस प्रयोग की अवधि कोशिकाओं की क्षमता इन क्षेत्र कालोनियों (sarcospheres) के रूप में करने के लिए संबंधित है, और समय की सीमा के 7, 14, 21, और 28 घ है।

  1. estabsarcosphere परख के lishment
    1. रुधिरकोशिकामापी कक्ष और अग्रिम में सभी अभिकर्मकों तैयार करें।
    2. आकांक्षा से मध्यम निकालें और trypsinization द्वारा monolayer से कोशिकाओं को अलग कर देना (धारा 2.2 देखें)। सेल निलंबन अच्छी तरह मिक्स, pipetting किसी भी गुच्छों को तितर-बितर, और एक 20 μL विंदुक टिप का उपयोग 10 μL इकट्ठा करने के लिए।
    3. 10 μL सेल निलंबन रुधिरकोशिकामापी चैम्बर किनारे करने के लिए तुरंत स्थानांतरण, निलंबन को निष्कासित, और यह केशिका क्रिया द्वारा coverslip के तहत तैयार किया जा करने की अनुमति।
    4. चरण विपरीत तहत रुधिरकोशिकामापी कक्ष का निरीक्षण करें। एक 10X उद्देश्य का चयन करें और चैम्बर में ग्रिड लाइनों पर ध्यान केंद्रित। गिनती के लिए एक सहायता के रूप में उप विभाजनों का उपयोग कर इस 1 मिमी 2 क्षेत्र (भी तीन समानांतर लाइनों से बंधे) में झूठ बोल रही कोशिकाओं और एकल ग्रिड लाइन गणना।
    5. एकाग्रता उपाय और निम्न समीकरण लागू होते हैं: 1 मिलीलीटर = n * 10 4 / z (एन: सभी की गिनती में कोशिकाओं के पूरे नंबरचौराहों 1 मिमी 2; Z: गिना चौकों 1 मिमी 2) की संख्या। 6 अच्छी तरह से अल्ट्रा कम लगाव थाली में अच्छी तरह से प्रत्येक के लिए 40,000 कोशिकाओं में विभाजित 240,000 कोशिकाओं की कुल राशि थाली करने के लिए आवश्यक सेल निलंबन की मात्रा की गणना।
      नोट: एक अतिरिक्त अच्छी तरह से में चढ़ाना कोशिकाओं द्वारा कोशिकाओं का सही नंबर प्लेट के लिए सुनिश्चित करें। इसलिए, कोशिकाओं की कुल राशि चढ़ाया जा करने के लिए 280,000 कोशिकाओं है।
    6. एक 25 सेमी 2 फ्लास्क में 2% एम सी (SGM-एमसी) का 50% जोड़कर 35 मिलीलीटर SGM तैयार करें। आदेश में एक अतिरिक्त अच्छी तरह से थाली में SGM की कुल मात्रा 5 मिलीलीटर अतिरिक्त विचार को तैयार है।
    7. SGM-एम सी कुप्पी में तैयार करने के लिए सेल निलंबन की गणना की मात्रा में जोड़ें और किसी भी गुच्छों को फैलाने के लिए एक पिपेट का उपयोग धीरे मिश्रण। 6 अच्छी तरह से अल्ट्रा कम लगाव प्लेट में कोशिकाओं की थाली और निरीक्षण करने के लिए चढ़ाया जाने के बाद कैसे कोशिकाओं दिखाई एक औंधा माइक्रोस्कोप का उपयोग करें।
    8. एक 37 डिग्री सेल्सियस, 5% सीओ 2 इनक्यूबेटर में कोशिकाओं को सेते हैं। हर 3 डी, एफआर जोड़नेप्रत्येक अच्छी तरह से bFGF और EGF की esh aliquots वृद्धि कारकों की एकाग्रता ताज़ा करने के लिए। 2 μL bFGF और 5 μL EGF अच्छी तरह से प्रत्येक में 10 एनजी / एमएल के अंतिम एकाग्रता में दोनों बनाए रखने के लिए जोड़ें।
  2. Sarcospheres का अलगाव
    नोट: 7, 14, 21, और 28 डी sarcosphere परख की अच्छी प्रगति की निगरानी जब यह sarcospheres कि गठन को अलग-थलग करने के लिए आवश्यक है के बारे में फैसला करने के लिए।
    1. लामिना का प्रवाह हुड (चित्रा 3 ए, बी) में सभी अभिकर्मकों और उपकरण तैयार करें। 25 मिमी व्यास का शुद्ध फिल्टर और एक झिल्ली फिल्टर धारक में एक 40 माइक्रोन जाल रखकर निस्पंदन यूनिट इकट्ठा; autoclaving (चित्रा -4 ए-ई) द्वारा बाँझ।
    2. प्रत्येक कुएं के लिए, एक 1000 μL टिप के साथ एक बाँझ पिपेट का उपयोग कर एक बाँझ झिल्ली फिल्टर धारक के साथ एक सिरिंज के लिए sarcospheres युक्त मध्यम हस्तांतरण। पूरी तरह से sarcospheres युक्त मध्यम हटाने के बाद, ऐड से अच्छी तरह धो5 मिलीलीटर जीएम आईएनजी एक सिरिंज के लिए सभी क्षेत्रों हस्तांतरण करने के लिए सुनिश्चित किया जाना है। इस बात की पुष्टि करने के लिए सभी sarcospheres बरामद किया गया है कि क्या माइक्रोस्कोप का उपयोग करें। यदि नहीं, तो इस कदम को दोहराते हुए आगे बढ़ें।
    3. आदेश क्षेत्रों को नुकसान पहुँचाए को रोकने के लिए और फिल्टर के माध्यम से पार करते हैं, जिससे क्षेत्रों के नुकसान से बचने के होने sarcospheres से बचने के लिए दबाव के बिना एक झिल्ली फिल्टर केवल गंभीरता से धारक के साथ निलंबन फ़िल्टर। धीरे एक बाँझ गिलास पाश्चर विंदुक का उपयोग करके हवाई बुलबुले निकालें।
      नोट: कभी कभी निस्पंदन झिल्ली फिल्टर धारक में एक हवाई बुलबुले की उपस्थिति से अवरुद्ध है।
    4. सिरिंज के लिए 10 मिलीलीटर जीएम जोड़ने और यह दबाव बिना फिल्टर एकल कोशिकाओं को खत्म करने के लिए सुनिश्चित हो की अनुमति से निस्पंदन यूनिट धो लें। सिरिंज से फिल्टर यूनिट लेने के अलावा और यह एक पेट्री डिश में डाल दिया।
    5. पेरी चिमटी का उपयोग कर झिल्ली फिल्टर धारक से शुद्ध फिल्टर निकालें और एक 60 मिमी में धीरे यह मिलाते हुए चिमटी के साथ द्वारा इसे धोनेपेट्री डिश झिल्ली की उलझन से sarcospheres जारी करने के लिए। फिर, एक कुएं में डाल दिया है और झिल्ली सूक्ष्म अवलोकन द्वारा पुष्टि कोई और अधिक झिल्ली में उलझ क्षेत्रों रहे हैं। क्षेत्रों में अभी भी झिल्ली में उलझ रहे हैं, तो कदम 3.2.4 में वर्णित के रूप में एक और धोने के साथ आगे बढ़ें।
    6. एक माइक्रोस्कोप का उपयोग जारी किया sarcospheres का निरीक्षण करें। एक 37 डिग्री सेल्सियस, 5% सीओ 2 इनक्यूबेटर में जारी sarcospheres सेते हैं। 6 अच्छी तरह से अल्ट्रा कम लगाव थाली के प्रत्येक अच्छी तरह से करने के लिए सभी चरणों को दोहराएँ।

4. ओएस सीएससी लाइन्स

नोट: ओएस सीएससी sarcospheres कि reintroducing और एक monolayer में इन कोशिकाओं reculturing के बाद वे अब अल्ट्रा कम लगाव की शर्तों के तहत छोटे 60 मिमी पेट्री डिश में चढ़ाया जाता है द्वारा पक्षपाती विस्तार का प्रदर्शन से प्राप्त कर रहे हैं।

  1. ओएस सीएससी संस्कृतियों
    1. आगे के विकास, उपसंस्कृति कोशिकाओं को सक्षम करने के लिए जब वे एक 60 में लगभग 90% संगम तक पहुँचनेमिमी पेट्री डिश। दोहराएँ कदम 2.2.1 ओएस सीएससी संस्कृतियों की स्थापना।
    2. 4 मिलीलीटर SCGM जोड़कर trypsinization बंद करो और अच्छी तरह से पकवान धोने, सभी कोशिकाओं को अलग करने के लिए एक पिपेट का उपयोग। एक नया 100 मिमी पेट्री डिश सेल निलंबन स्थानांतरण और 6 मिलीलीटर SCGM जोड़ें। ओएस सीएससी खंड 2.2 दोहरा द्वारा 90% संगम, उपसंस्कृति तक पहुँचते हैं।
      नोट: इन विट्रो विश्लेषण अलग ओएस सीएससी के स्टेम सेल की तरह phenotype को चिह्नित करने के लिए, कोशिकाओं प्लेटों के विभिन्न प्रकारों में चढ़ाया जा सकता है।
    3. cryopreservation द्वारा स्थापित ओएस सीएससी लाइनों (धारा 2.3 के सभी चरणों को दोहराएँ) को बचाना। धारा 2.4 के सभी चरणों को दोहरा द्वारा cryopreserved ओएस सीएससी defrost।

5. इन विट्रो एक nalysis विशेषताएँ ओएस सीएससी:

  1. इम्यूनोफ्लोरेसेंस के लिए कोशिकाओं की तैयारी
    नोट: प्रकोष्ठों paraformaldehyde में तय कर रहे हैं, जब वे एक 24 अच्छी तरह से पीएलए के प्रत्येक कुएं में संगम के अधिकार ग्रेड तक पहुँचनेते। संगम के ग्रेड प्रयोगों के प्रकार से संबंधित है।
    1. प्लेट ओएस सीएससी एक 24 अच्छी तरह से थाली immunofluorescence द्वारा सतह mesenchymal स्टेम सेल (एमएससी) मार्कर का अध्ययन करने के लिए। प्रत्येक कुएं में कोशिकाओं को ठीक करें जब वे 50 तक पहुंच - 60% संगम। आकांक्षा से SCGM निकालें और एक DPBS 24 अच्छी तरह से थाली में दो बार धोने।
    2. एक रासायनिक हुड के तहत, प्रत्येक अच्छी तरह से करने के लिए 500 μL 4% पीएफए ​​/ DPBS जोड़ें। 10 मिनट के लिए आरटी पर सेते हैं। पीएफए / DPBS निकालें और ultrapure DH 2 ओ के साथ 3x धोने 24 अच्छी तरह से थाली धूआं हुड में सूखे की अनुमति दें।
  2. एमएससी मार्करों के लिए इम्यूनोफ्लोरेसेंस
    नोट: ओएस सीएससी के immunofluorescence धुंधला 4% पीएफए / DPBS में तय CD44, Stro -1 और CD105 के खिलाफ निर्देशित एंटीबॉडी का उपयोग ओएस सीएससी के एमएससी की तरह phenotype जांच करने के लिए इस्तेमाल किया जा सकता है। निम्न विधि लेखकों द्वारा नियमित तौर पर प्रयोग किया जाता है।
    1. एक रासायनिक हुड में, कि 4% पीएफए ​​/ DPBS में तय किया गया है कोशिकाओं permeabilize 500 μL जोड़ने 0.2% ट्राइटन X-100 / अच्छी तरह से प्रत्येक के लिए DPBS। 30 मिनट के लिए 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं। धीरे धोने कोशिकाओं DPBS के साथ 3x। कोशिकाओं के लिए 300 μL RNase 2% बीएसए से पतला 1 / 1,000 जोड़ें / DPBS और 30 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं।
    2. धीरे धोने कोशिकाओं 2% बीएसए / DPBS के साथ 3x। एमएससी मार्करों के लिए कोशिकाओं दाग। प्राथमिक एंटीबॉडी केवल प्रत्येक एंटीबॉडी के लिए सकारात्मक नियंत्रण के रूप में चुना कुओं में जोड़े।
      1. 300 जोड़े μL विरोधी CD105 2% बीएसए / DPBS, 300 μL विरोधी CD44 2% BSA के साथ 1/10 पतला / DPBS, 300 μL विरोधी Stro-1 से 2% बीएसए / DPBS के साथ 1/10 पतला साथ 1/10 पतला और केवल 200 μL 2% बीएसए / प्रत्येक एंटीबॉडी के लिए नकारात्मक नियंत्रण के रूप में चुना कुओं के लिए DPBS।
      2. 4 डिग्री सीओ / एन पर एक नम वातावरण में कोशिकाओं को सेते हैं। धो कुओं 2% बीएसए / DPBS के साथ दो बार DPBS के साथ 3x और उसके बाद।
    3. विशिष्ट माध्यमिक एंटीबॉडी जोड़कर प्राथमिक एंटीबॉडी पता चलता है।
      1. 300 μL विरोधी खरगोश आईजीजी (गधा विरोधी खरगोश आईजीजी [एच + L]) पतला 1/100 जोड़े2% BSA के साथ अच्छी तरह / CD44 और CD105 के लिए सकारात्मक और नकारात्मक नियंत्रण के रूप में चुना प्रत्येक में DPBS। 300 μL FITC विरोधी माउस आईजी (FITC-खरगोश विरोधी माउस आईजीजी [एच + L]) 2% BSA के साथ 1/100 पतला जोड़ें / प्रत्येक अच्छी तरह से Stro-1 के लिए सकारात्मक और नकारात्मक नियंत्रण के रूप में चुना में DPBS। 60 मिनट के लिए आरटी पर अंधेरे में कोशिकाओं को सेते हैं। धो कुओं DPBS के साथ 6x।
    4. दाग एमएससी मार्कर पॉजिटिव 2% BSA के साथ phalloidin पतला 1/100 300 μL जोड़कर cytoskeletal actin के लिए कोशिकाओं / अच्छी तरह एमएससी मार्कर immunofluorescence के लिए दाग प्रत्येक में DPBS।
    5. आरटी पर 40 मिनट के लिए कोशिकाओं को सेते हैं। धो कुओं DPBS के साथ 3x और फिर उन्हें ultrapure DH 2 ओ के साथ दो बार धोने immunofluorescence धुंधला ऊपर वर्णित के बाद नाभिक के counterstaining करने के लिए आगे बढ़ें। एक धूआं हुड में DPBS (शेयर 1.5 x 10 -3 एम) में एम propidium आयोडाइड समाधान 10 -5 तैयार करें।
      1. प्रत्येक अच्छी तरह से रंगीन के रूप में ऊपर वर्णित करने के लिए 200 μL propidium आयोडाइड समाधान जोड़ें। सेल सेतेआरटी पर 3 मिनट - 2 के लिए है। कुओं ultrapure DH 2 ओ के साथ दो बार धो
        नोट: - 5.2 सेल लाइन HCT8 पर, एक प्राथमिक निरंतर विभेदित पेट के कैंसर सेल लाइन है कि एक नकारात्मक नियंत्रण के रूप में प्रयोग किया जाता है वर्गों 5.1 के सभी चरणों को दोहराएँ।
  3. Osteogenic भेदभाव परख
    नोट:
    osteogenic भेदभाव 20 डी के लिए रहता है।
    1. 1 एक्स 10 4 कोशिकाओं / 2 सेमी SCCGM में से एक सेल घनत्व में 24 अच्छी तरह से प्लेटों में प्लेट ओएस सीएससी। अच्छी तरह से प्रत्येक में 90% confluency - कोशिकाओं SCGM में विकसित करने के लिए जब तक वे 80 तक पहुंचने की अनुमति दें।
    2. ओम को SCGM बदलकर osteogenic भेदभाव शुरू करो। 4 डी - कोशिकाओं ओम में आगे बढ़ने और मध्यम ताज़ा हर 3 करने की अनुमति दें। 10 डी में osteogenic भेदभाव बंद करो परख alkaline फॉस्फेट (एएलपी) की उपस्थिति का मूल्यांकन करने के लिए।
    3. 4% पीएफए ​​/ DPBS में कोशिकाओं को ठीक (धारा 5.1 देखें)। एएलपी के लिए और हा लिए cytochemical धुंधला द्वारा osteoblastic phenotype मूल्यांकनAlizarin लाल एस धुंधला का उपयोग।
    4. एएलपी cytochemical धुंधला
      ध्यान दें: तुरंत धुंधला शुरू करने से पहले एक रासायनिक हुड में डाई मिश्रण तैयार करें।
      1. 40 मिलीग्राम भंग तेजी ब्लू बी बी या 50 मिलीलीटर Tris एचसीएल में फास्ट लाल बैंगनी पौंड नमक, पीएच 9 (समाधान क)। 1 मिलीलीटर DMSO (समाधान बी) में 5 मिलीग्राम naphthol-AS-एमएक्स फॉस्फेट सोडियम नमक भंग। समाधान बी पूरी तरह समाधान एक में जोड़ें और मिश्रण अच्छी तरह से, DPBS के साथ दो बार धो समाधान सी कोशिकाओं को प्राप्त करने।
      2. अच्छी तरह से प्रत्येक के लिए 1 मिलीलीटर समाधान सी और 37 डिग्री सेल्सियस पर सेते हैं और 5% सीओ 2 - 500 μL जोड़ें। खुर्दबीन के नीचे कोशिकाओं को देख कर हर 10 मिनट धुंधला हो जाना बेशक मॉनिटर।
      3. धुंधला बंद करो जब एएलपी पॉजिटिव कोशिकाओं तीव्रता से है, जो आमतौर पर 30 मिनट के भीतर होता है (फास्ट ब्लू बी बी नमक या फास्ट लाल बैंगनी पौंड नमक के साथ लाल रंग के साथ नीले रंग) रंग का हो गया है। कोशिकाओं ultrapure धनबाद के साथ 3x धो 2 हे तो समाधान सी के सभी अवशेषों को हटाने के दाग मैं की तलछटवर्तमान है, पूर्ण इथेनॉल के साथ जल्दी से एक बार कोशिकाओं को धो लें।
      4. एएलपी धुंधला कदम 5.2.5 और 5.2.5.1 में वर्णित के रूप में के बाद नाभिक के counterstaining करने के लिए आगे बढ़ें।
    5. Alizarin लाल एस cytochemical धुंधला
      नोट: प्रयोग शुरू करने से पहले डाई मिश्रण तैयार करें।
      1. (Ultrapure एच 2 ओ की 100 मिलीलीटर में 2 जी Alizarin लाल एस) 2% Alizarin लाल एस तैयार करें। 2.5% राष्ट्रीय राजमार्ग 3 2% Alizarin लाल एस में जोड़े पीएच 6.0 तक पहुँचने के लिए। 4 डिग्री सेल्सियस पर स्टोर 2% Alizarin लाल समाधान। DPBS के साथ एक बार कोशिकाओं को धो लें।
      2. केवल कुछ ही सेकंड के लिए कोशिकाओं को Alizarin लाल एस जोड़ें।
      3. Ultrapure धनबाद के साथ धुंधला की डिग्री को नियंत्रित करने के ओ 2 कुओं धो; यदि हा जमा तीव्रता से रंग नहीं कर रहे हैं, कदम 5.3.5.2 दोहराएँ। धुंधला बंद करो जब हा जमा तीव्रता से लाल रंग का है, जो आम तौर पर कुछ ही मिनटों के भीतर होता हो जाते हैं। Ultrapure DH 2 ओ के साथ कुओं धो
    6. Adipogenic भेदभाव
      नोट: परख अवधि ओएस सीएससी तर्ज पर निर्भर करता है। परख कर सकते हैं पिछले 14 - 30 D।
      1. 1 एक्स 10 4 कोशिकाओं / 2 सेमी SCGM में से एक सेल घनत्व में 24 अच्छी तरह से प्लेटों में प्लेट ओएस सीएससी। अच्छी तरह से प्रत्येक में 90% confluency - कोशिकाओं SCGM में विकसित करने के लिए जब तक वे 80 तक पहुंचने की अनुमति दें। SCGM बजे तक बदलकर adipogenic भेदभाव आरंभ करें। कोशिकाओं को पूर्वाह्न में आगे बढ़ने और एक सप्ताह में दो बार AM ताज़ा करने के लिए अनुमति दें।
      2. adipogenic भेदभाव परख बंद करो जब लिपिड पुटिकाओं दिखाई दे रहे हैं। तेल लाल हे धुंधला द्वारा और haematoxylin नाभिक के लिए counterstaining द्वारा adipogenic phenotype का मूल्यांकन।
      3. नाभिक के लिए Haematoxylin counterstaining
        नोट: प्रयोग शुरू करने से पहले डाई मिश्रण तैयार करें।
        1. 5% haematoxylin समाधान, Emallume Carazzi 39 बुलाया तैयार करें। 4 डिग्री सेल्सियस पर समाधान स्टोर। केवल 2 मिनट के लिए Emallume Carazzi जोड़ें। ULT के साथ कुओं धोrapure DH 2
    7. CFU परख
      नोट: इस प्रयोग triplicates में किया जाना चाहिए।
      1. प्लेट ओएस सीएससी 100 मिमी पेट्री डिश में 450 कोशिकाओं / 2 सेमी CFUM में से एक सेल घनत्व पर। 4 सप्ताह के लिए एक 37 डिग्री सेल्सियस, 5% सीओ 2 इनक्यूबेटर में कोशिकाओं को सेते हैं। दो बार CFUM को रिफ्रेश एक सप्ताह।
      2. toluidine नीले रंग के साथ CFUs दाग। गणना एक औंधा माइक्रोस्कोप का उपयोग रंग का कालोनियों। निम्न सूत्र के अनुसार CFU दक्षता की गणना: (गठन कालोनियों की संख्या / कोशिकाओं की संख्या वरीयता प्राप्त) * 100।
    8. ALDH गतिविधि विश्लेषण
      नोट: ALDH गतिविधि दो ओएस सीएससी तर्ज पर और एक परिमित fibroblast लाइन है, जो एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था पर एक ALDH गतिविधि Colorimetric परख किट का उपयोग कर मूल्यांकन किया गया है। इस किट absorbance के 450 एनएम पर पढ़ने के द्वारा ALDH enzymatic गतिविधि quantifies। सभी परीक्षणों triplicates में प्रदर्शन किया गया है।
      1. trypsinization द्वारा monolayer से सेल संस्कृतियों अलग कर देना (धारा 2.2 देखें)। 5 मिनट के लिए 400 XG पर centrifugation द्वारा गोली कोशिकाओं। निर्माता प्रोटोकॉल का पालन करें।
    9. प्रवाह cytometric विश्लेषण:
      नोट: एकल कक्ष निलंबन से फ्लो के लिए नमूने का इष्टतम धुंधला के लिए आवश्यक हैं। एक एकल कक्ष निलंबन तैयार रहना चाहिए के लिए प्रत्येक एंटीबॉडी परीक्षण किया जाना है। trypsinization द्वारा monolayer से सेल संस्कृतियों अलग कर देना (धारा 2.2 देखें)।
      1. एक शंक्वाकार ट्यूब में सेल निलंबन की जगह, 1 x 10 5 कोशिकाओं के अंतिम सेल एकाग्रता में एक सेल निलंबन प्राप्त करने के लिए जुदाई बफर का एक उचित मात्रा में Bürker का उपयोग कर एक कोशिका गिनती चैंबर गिनती, 400 XG पर अपकेंद्रित्र कोशिकाओं और resuspend प्रदर्शन / मिलीलीटर।
      2. 4 डिग्री सेल्सियस पर 5 मिनट के लिए सेल निलंबन अपकेंद्रित्र। सतह पर तैरनेवाला त्यागें और जुदाई बफर के साथ गोली धोने। इस कदम दो बार दोहराएँ।
      3. एमएस के लिए कोशिकाओं दागसी मार्कर (यानी, CD44, CD105 और Stro -1) 40।
      4. एक प्रवाह कोशिकामापी में सकारात्मक दाग सेल निलंबन का विश्लेषण। 1 डी के भीतर चिह्नित नमूनों का विश्लेषण। विश्लेषण जब तक 4 डिग्री सेल्सियस पर इन नमूनों को सेते हैं।
    10. आरटी पीसीआर
      1. निष्कर्षण और शाही सेना के अलगाव
        1. ओएस सीएससी के सेलुलर जमे हुए पैक नमूने के 1 मिलीलीटर सेल अभिकर्मक जोड़ें और ऊपर और नीचे कई बार गोली pipetting द्वारा ट्यूब में सीधे कोशिकाओं lyse।
        2. 4 डिग्री सेल्सियस पर 1 मिनट के लिए 12,000 XG पर नमूने अपकेंद्रित्र। धीरे सतह पर तैरनेवाला हटा दें। , एक नया ट्यूब स्थानांतरण सतह पर तैरनेवाला 200 μL क्लोरोफॉर्म जोड़ने के लिए, और सुरक्षित रूप से ट्यूब टोपी। 15 सेकंड के लिए सख्ती ट्यूब हिला और आरटी पर 5 मिनट के लिए नमूना सेते हैं।
        3. 4 डिग्री सेल्सियस पर 15 मिनट के लिए 12,000 XG पर नमूने अपकेंद्रित्र। मिश्रण तीन अलग-अलग चरणों में अलग करती है। आरएनए बेरंग ऊपरी जलीय चरण में विशेष रूप से है।
        4. होने के नाते देहातrticularly सावधान, केवल जलीय चरण को हटाने और एक नया ट्यूब में इस चरण के हस्तांतरण शाही सेना के अलगाव के साथ आगे बढ़ना। जलीय चरण युक्त ट्यूब के लिए 500 μL isopropanol जोड़ें। हाथ से धीरे ट्यूब हिला। 10 मिनट के लिए आरटी पर नमूना सेते हैं। 4 डिग्री सेल्सियस पर 10 मिनट के लिए 12,000 XG पर नमूना अपकेंद्रित्र।
          नोट: के बाद नमूना centrifuged है, यह आरएनए, जो पक्ष पर और ट्यूब के तल पर एक जेल की तरह गोली रूपों को देखने के लिए संभव है।
        5. ट्यूब से सतह पर तैरनेवाला निकालें, तल पर शाही सेना की गोली छोड़ने के लिए सावधान किया जा रहा। ट्यूब के लिए 1 मिलीलीटर 75% इथेनॉल जोड़ें। भंवर में कुछ सेकंड के लिए हाथ से ट्यूब और फिर 4 डिग्री सेल्सियस पर 5 मिनट के लिए 7500 XG पर ट्यूब अपकेंद्रित्र।
        6. इथेनॉल त्यागें और हवा आरएनए गोली सूखी। ऊपर और नीचे कई बार समाधान pipetting द्वारा - (50 μL 10) जब गोली सूखा है, RNase मुक्त पानी में शाही सेना गोली resuspend।
        7. Meas से उपज और आरएनए की शुद्धता निर्धारित बनाने के लिए260 एनएम और 280 एनएम एक स्पेक्ट्रोफोटोमीटर का उपयोग पर absorbance uring। मानक 1% agarose जेल पर कुल शाही सेना की अखंडता का मूल्यांकन। -80 डिग्री सेल्सियस पर शाही सेना को स्टोर।
      2. रिवर्स पोलीमरेज़ चेन रिएक्शन
        1. एक रिवर्स प्रतिलेखन किट का उपयोग कर 500 एनजी शाही सेना के नमूने से पहले कतरा cDNAs synthesize। बर्फ पर पिघलना शाही सेना के नमूने और आरटी पर किट में शामिल आवश्यक समाधान पिघलना। निर्माता प्रोटोकॉल निम्नलिखित cDNAs के संश्लेषण के लिए आगे बढ़ें।
      3. अर्द्ध मात्रात्मक रिवर्स ट्रांसक्रिपटेस-पोलीमरेज़ चेन रिएक्शन (आरटी पीसीआर)
        1. 24 μL के अंतिम प्रतिक्रिया मात्रा में एक टेम्पलेट के रूप में प्रत्येक नमूना के लिए 1 μL सीडीएनए का उपयोग कर सभी PCRs प्रदर्शन करना। Nanog, अक्टूबर 3/4, Sox2 और CD133 जीनों के प्रवर्धन के लिए 1 टेबल में सूचीबद्ध प्राइमर दृश्यों का प्रयोग करें।
        2. ethidium ब्रोमाइड के साथ अलग 1.8% agarose जेल वैद्युतकणसंचलन और दाग से आरटी पीसीआर उत्पादों। यूवी आज के तहत फोटोग्राफination।

Representative Results

सुई आकांक्षा या ट्यूमर के एक छोटे से हिस्से की शल्य लकीर द्वारा प्राप्त ओएस के नमूने (चित्रा 1 ए, बी), (चित्रा 2A, बी) प्रोटोकॉल अनुभाग में वर्णित के रूप में केवल एक ओएसए के अलगाव की अनुमति यदि ठीक से इलाज किया। दुर्भाग्य से, बायोप्सी से अलग कक्षों की संख्या कम है, 30 से एक उत्पादन श्रृंखला के साथ - 50%। उत्पादन का प्रकार और बायोप्सी (चित्रा 5 ए, बी) के आयाम पर निर्भर करता है। इन कोशिकाओं को ठीक इलाज किया जाना चाहिए। नतीजतन, लगभग एक महीने के प्राथमिक संस्कृतियों एक 100 मिमी पेट्री डिश में confluency तक पहुँचने के लिए आवश्यक है। इस समय के बाद, ओएसए OSA5 और OSA6 (चित्रा 6A, बी) में चिह्नित दो ओएस के नमूनों से प्राप्त कर रहे हैं। तो फिर, यह प्राथमिक सेल लाइन उपसंस्कृति के लिए जरूरी है कि कोशिकाओं की एक पर्याप्त संख्या प्राप्त करने के लिए लक्षण वर्णन विश्लेषण करने के लिए और सेल cryopreserve करने के लिए लिनतों। उपसंस्कृति की 3 बीतने पर, जब दोनों ओएसए प्राथमिक सेल लाइनों confluency तक पहुँचते हैं, वे 6 अच्छी तरह से sarcosphere परख के लिए अल्ट्रा कम लगाव प्लेटों में चढ़ाया जाता है। प्लेट के इस प्रकार है क्योंकि यह हमें परमिट प्रयोग किया जाता है, एक निलंबित अवस्था में कोशिकाओं को बनाए रखने के लिए कुर्की की मध्यस्थता भेदभाव से स्टेम कोशिकाओं को रोकने के लिए, विभाजन से लंगर निर्भर कोशिकाओं को रोकने के लिए, और अंत में, सब्सट्रेट करने के लिए लगाव कम करने के लिए। इसलिए, उनके उपयोग कैंसर की कोशिकाओं के लिए एक तनावपूर्ण स्थिति है, जो सीएससी के चयन के लिए आवश्यक है बनाने के लिए हमें अनुमति देता है। परख की शुरुआत के बाद 24 घंटे में, कोशिकाओं को एक दूसरे (चित्रा 7) से अलग दिखाई देते हैं। बाद परख की प्रगति की निगरानी के 7 डी, छोटे गोलाकार कालोनियों के रूप में शुरू कर दिया है और दृश्य (8 चित्रा) कर रहे हैं। 28 डी में, कई बड़े गोलाकार कालोनियों कि प्रत्येक में अच्छी तरह का गठन किया है मनाया जा सकता है (चित्रा 9 ए, बी)। बाद sarcospheres हवलदारई के लिए 28 डी संवर्धित किया गया है, इन बड़े गोलाकार कालोनियों अलग किया जा सकता है। आंकड़ा 10 6 अच्छी तरह से अल्ट्रा कम लगाव प्लेटों से sarcospheres को अलग-थलग करने और उन्हें पक्षपाती की शर्तों के तहत reculturing के लिए कदम से पता चलता। चित्रा 11 अलगाव के बाद चल गोलाकार कालोनियों से पता चलता है। बड़े गोलाकार सामान्य लगाव प्लेटों में चढ़ाया कालोनियों अलगाव के बाद पक्षपाती विस्तार दिखाने (चित्रा 12A, बी)। कोशिकाओं है कि एकल sarcospheres से विस्तार शायद एक स्टेम सेल की तरह phenotype के साथ कैंसर कोशिकाओं रहे हैं। इसलिए, अलगाव के बाद, ओएस-सीएससी शायद प्राप्त किया गया। इन कोशिकाओं को OSA5-सीएससी और OSA6-सीएससी (चित्रा 13A, बी) के नाम हैं।

इस बिंदु पर, यह, जैसा कि ऊपर वर्णित प्राप्त दो ओएस सीएससी लाइनों के लिए स्टेम सेल की तरह phenotype के लक्षण वर्णन के साथ आगे बढ़ने के लिए आवश्यक है। स्टेम सेल की तरह phenotype wer के लक्षण वर्णन के लिए विश्लेषणई उपसंस्कृति के 4 वें पारित होने पर प्रदर्शन के बाद प्रत्येक ओएस सीएससी लाइन के लिए sarcospheres अलग थे। दो सेल लाइनों, OSA5-सीएससी और OSA6-सीएससी, सतह एमएससी मार्करों के लिए मजबूत सकारात्मकता (CD105 और CD44) (चित्रा 14A, बी और चित्रा 15A, बी) से पता चला है, जबकि वे सतह एमएससी मार्कर के लिए मध्यम सकारात्मकता से पता चला है Stro- 1 (चित्रा 16A, बी)। हमारी टिप्पणियों वाणिज्यिक और विभेदित पेट के कैंसर कोशिका लाइन HCT8 (चित्रा 14C, चित्रा 15C, चित्रा 16C) के साथ प्राप्त नकारात्मक परिणामों से इसकी पुष्टि की है। HCT8 सेल लाइन में इन सतह मार्करों के लिए विशिष्ट और अविशिष्ट धुंधला की कुल कमी मनाया गया।

दो ओएस सीएससी के एमएससी phenotype का मूल्यांकन करने के लिए, हम भी प्रदर्शन किया प्रवाह cytometric विश्लेषण करती है। दोनों ओएस-सीएससी लाइनों CD44 और CD105 के उच्च स्तर पर व्यक्त की है। हालांकि, दोनों सेल लाइनों में कोशिकाओं की, केवल 1.14% Stro -1 व्यक्त किया। इसलिए, इस पुनःके रूप में immunofluorescence धुंधला द्वारा प्रदर्शन Sult Stro -1 के उदारवादी उपस्थिति की पुष्टि की। इसके विपरीत, OSA5-सीएससी के 99.62% CD44 व्यक्त किया है और इन कोशिकाओं के 87.38% CD105 व्यक्त; OSA6-सीएससी के 99.88% में CD44 व्यक्त किया है और इन कोशिकाओं के 95.79% CD105 व्यक्त किया। इसके अतिरिक्त, दोनों सेल लाइनों CD45- हैं।

हम 3 ईएससी मार्कर (Nanog, अक्टूबर 3/4, Sox2) और CD133 जीन की, एक और सीएससी मार्कर, आरटी पीसीआर द्वारा की अभिव्यक्ति का आकलन किया। हमने देखा है कि इन जीनों के सभी दोनों ओएस सीएससी लाइनों (चित्रा 17) में व्यक्त किया गया। और adipocytes में (चित्रा 20A - डी) adipogenic और osteogenic भेदभाव assays दोनों अलग ओएसए-सीएससी लाइनों की क्षमता अस्थिकोरक (- - डी और चित्रा 19A डी चित्रा 18A) में अंतर करने के लिए दिखाया।

इसके अलावा, CFU एक ssay (चित्रा 21) OSA5-सीएससी के लिए 13% और OSA6-सीएससी के लिए 14% के साथ, clonogenic दक्षता का एक अच्छा दर दिखाया। हाल ही में कई अध्ययनों से पता चला है ALDH गतिविधि का उच्च स्तर कैंसर के विभिन्न प्रकार के लक्षण हैं। यह पैरामीटर एक कैंसर स्टेम सेल मार्कर के रूप में इस्तेमाल किया जा सकता है और एक गरीब रोग का निदान के साथ जोड़ा जाता है। ALDH गतिविधि परख दिखाया दोनों ओएस सीएससी लाइनों, ALDH गतिविधि (चित्रा 22) का उच्च स्तर है कि जबकि ALDH गतिविधि fibroblast लाइन है कि इस परख में एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था में कम मात्रात्मक सीमा पर मनाया गया।

आकृति 1
चित्रा 1. ओएस बायोप्सी नमूनों के उदाहरण हैं। (ए)। बायोप्सी नमूना सुई आकांक्षा से प्राप्त की। (बी)। बायोप्सी नमूना ट्यूमर का एक भाग की शल्य लकीर द्वारा प्राप्त की।884 / 53884fig1large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. यांत्रिक एक ओएस नमूना के disaggregation। (ए) एक नमूना पेरी चिमटी और एक नुकीला का उपयोग करने का विखंडन। (बी) के टुकड़े मुख्यमंत्री (तीर द्वारा संकेत) में निलंबित कर दिया। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. उपकरण और उपभोज्य Sarcospheres अलग करने की जरूरत। (ए)। सभी उपकरण सेल अलगाव के लिए आवश्यक है। एक बाँझ झिल्ली फिल्टर धारक के साथ 1. एक बाँझ सिरिंज; 2. दो अलग-अलग मीडिया: जीएम एकएन डी SCGM; 3. एक बाँझ कांच पाश्चर विंदुक। (बी) सिरिंज एक समर्थन पर इकट्ठे, झिल्ली फिल्टर धारक के साथ का विस्तार। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. निस्पंदन यूनिट। निस्पंदन यूनिट (ए) को इकट्ठा करने की जरूरत कई घटकों (शुद्ध फिल्टर तीर द्वारा संकेत दिया है)। शुद्ध फिल्टर (बी) के 40 माइक्रोन meshes (एक जाल तीर द्वारा संकेत दिया है) के चरण विपरीत अवलोकन। मूल बढ़ाई: 10X। निस्पंदन यूनिट इकट्ठे (सी - डी)। निस्पंदन इकाई निष्फल (ई)। एक बड़ा ve देखने के लिए यहाँ क्लिक करेंयह आंकड़ा की rsion।

चित्रा 5
चित्रा 5. पारंपरिक ओएस के प्राथमिक सेल संस्कृतियों। उच्च ग्रेड ओएस के प्राथमिक सेल संस्कृतियों के चरण विपरीत अवलोकन। (ए) में, कई उज्ज्वल हड्डी के टुकड़े (बी) में है, जबकि कई छोटे गोल और चल एरिथ्रोसाइट्स मौजूद हैं, दिखाई दे रहे हैं। मूल बढ़ाई: 10X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 6
चित्रा 6 परम्परागत ऑस्टिओसारकोमाः परिमित सेल लाइन्स (ओएसए)। (ए) OSA5 और (बी) OSA6। चरण विपरीत में अवलोकन।मूल बढ़ाई: 10X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 7
चित्रा 7. OSA5 और OSA6 की Sarcosphere परख। परख के शुरू से ही 24 घंटे के बाद, कोशिकाओं चल रहे थे और एक दूसरे से अलग-थलग (कोशिकाओं तीर द्वारा संकेत कर रहे हैं)। चरण विपरीत में अवलोकन। मूल बढ़ाई:। 20X यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

आंकड़ा 8
8 चित्रा OSA5 की Sarcosphere परख और OSA6 पर 7 डी 7 डी परख में, कई छोटे sphericaएल कालोनियों एकल कक्षों से घिरा हुआ देखा जा सकता है। sarcospheres (इन sarcospheres के कुछ तीर द्वारा संकेत कर रहे हैं) के माध्यम में तैरते दिखाई देते हैं या थोड़ा अच्छी तरह से नीचे में नीचे बसे। चरण विपरीत में अवलोकन। मूल बढ़ाई: 20X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

9 चित्रा
9 चित्रा OSA5 की Sarcosphere परख और OSA6 28 डी पर बाद 28 डी, कई बड़े एम्बर sarcospheres अच्छी तरह से प्रत्येक ओएसए सेल लाइन, OSA5 (ए) और OSA6 (बी) के लिए प्लेटों में से प्रत्येक में मनाया जाता है। पट्टी का आकार: 100 माइक्रोन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें। </ P>

चित्रा 10
चित्रा 10 Sarcospheres के अलगाव के लिए मार्ग 6 अच्छी तरह से अल्ट्रा कम लगाव प्लेटों से अलग-थलग sarcospheres के लिए कदम और पक्षपाती शर्तों के तहत उनके reculturing दिखाए जाते हैं (ए) के सभी उपकरण अलगाव के लिए की जरूरत है।।: 1. एक 6 अच्छी तरह से अल्ट्रा कम प्रत्येक अच्छी तरह से, 2. शुद्ध फिल्टर धारक, 3. पिपेट, 4. 1,000 μL बाँझ टिप्स, 5. 2 बाँझ पेरी चिमटी, 6. 2 अलग संस्कृति मीडिया के साथ सिरिंज में गठित sarcospheres के साथ थाली , 7. बाँझ पाश्चर विंदुक 8. पेट्री डिश। (बी) sarcospheres का संग्रह। मध्यम प्रत्येक कुएं में निहित एक बाँझ 1,000 μL टिप के साथ एक पिपेट का उपयोग कर एकत्र की है। (सी) सिरिंज में निलंबन लीजिए। एकत्र निलंबन सिरिंज को सौंप दिया है का उपयोग कर प्राकृतिक निस्पंदन प्रक्रिया शुरू करने के लिएझिल्ली फिल्टर धारक। (डी) प्राकृतिक निस्पंदन। (ई) सिरिंज से झिल्ली फिल्टर धारक disassembling। सब के बाद निलंबन फ़िल्टर किया जाता है, शुद्ध फिल्टर धारक अलग कर लिया और एक पेट्री डिश में डाल दिया जाता है; (एफ) झिल्ली फिल्टर धारक disassembling। Sarcospheres शुद्ध फिल्टर धारक में शुद्ध फिल्टर के छिद्रों में समाहित कर रहे हैं, ताकि वे पेरी चिमटी का उपयोग कर मुक्त कर दिया जाना चाहिए। (जी, एच) झिल्ली फिल्टर से sarcospheres का हटाया। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

11 चित्रा
चित्रा 11. Sarcosphere अलगाव। पृथक sarcospheres 60 मिमी पेट्री डिश में मध्यम में तैरने लगते हैं। चरण विपरीत में अवलोकन।मूल बढ़ाई: 40X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 12
चित्रा 12. Sarcosphere के बाद अलगाव। OSA5 (ए) और OSA6 (बी) के reintroduction के बाद और अलगाव के बाद 48 घंटे में पक्षपाती परिस्थितियों में एक monolayer में reculturing पक्षपाती विस्तार की शुरुआत में सेल लाइनों से Sarcospheres। चरण विपरीत में अवलोकन। मूल बढ़ाई: 20X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 13 चित्रा 7 डी में 13. Sarcospheres अलगाव के बाद। OSA5 (ए) और OSA6 (बी) सेल लाइनों से Sarcospheres reintroduction के बाद और अलगाव के बाद 7 डी पर पक्षपाती परिस्थितियों में एक monolayer में reculturing पक्षपाती विस्तार से पता चला है। चरण विपरीत में अवलोकन। मूल बढ़ाई: 20X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 14
चित्रा 14. इम्यूनोफ्लोरेसेंस धुंधला CD105 के लिए। ओएसए-सीएससी लाइनों में CD105 के लिए immunofluorescence धुंधला OSA5-सीएससी (ए) और OSA6-सीएससी (बी) और निरंतर सेल लाइन HCT8 (सी) है, जो एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था। पारंपरिक रंग में एल एस सी एम: CD105 के लिए हरी और cytoskeleton के लिए लाल। मूल बढ़ाई: 10X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 15
चित्रा 15. इम्यूनोफ्लोरेसेंस धुंधला CD44 के लिए। ओएसए-सीएससी लाइनों में CD44 के लिए immunofluorescence धुंधला OSA5-सीएससी (ए) और OSA6-सीएससी (बी) और निरंतर सेल लाइन HCT8 (सी) है, जो एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था। CD44 के लिए हरी और cytoskeleton के लिए लाल: पारंपरिक रंगों में एल एस सी एम। मूल बढ़ाई: 10X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।


Stro -1 ओएसए-सीएससी लाइनों में लिए Stro1। इम्यूनोफ्लोरेसेंस धुंधला की चित्रा 16. इम्यूनोफ्लोरेसेंस धुंधला OSA5-सीएससी (ए) और OSA6-सीएससी (बी) और निरंतर सेल लाइन HCT8 (सी) है, जो एक नकारात्मक रूप में इस्तेमाल किया गया था में नियंत्रण। पारंपरिक रंगों में एल एस सी एम: Stro-1 के लिए हरे और लाल cytoskeleton के लिए। मूल बढ़ाई: 10X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 17
परमाणु ईएससी मार्करों की और CD133 जीन। आरटी पीसीआर Nanog, अक्टूबर 3/4, Sox2 और OSA5-सीएससी (ए) में CD133 और OSA6-सीएससी में (की अभिव्यक्ति दिखाने का आंकड़ा 17. अभिव्यक्ति यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 18
चित्रा 18. osteogenic भेदभाव परख -। एएलपी 0 डी (ए, बी) पर और बाद के रूप में तेजी से ब्लू बी बी का उपयोग कर एएलपी के लिए cytochemical धुंधला द्वारा निर्धारित की प्रेरण के 10 डी (सी, डी) osteogenic भेदभाव। नीले, एएलपी + कोशिकाओं में; लाल रंग में, नाभिक propidium आयोडाइड के साथ counterstained। brightfield में और प्रतिदीप्ति में समग्र अवलोकन। मूल बढ़ाई: 20X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 19 चित्रा 19. osteogenic भेदभाव परख -। हा osteogenic पर 0 डी भेदभाव (ए, बी) और बाद के रूप में Alizarin लाल एस के साथ हाइड्रॉक्सियापटाइट (हेक्टेयर) के लिए cytochemical धुंधला द्वारा निर्धारित की प्रेरण के 20 डी (सी, डी) कोशिकाओं में विषम रहे हैं हा के नीले / ग्रे, और दानेदार जमा लाल रंग में दाग रहे हैं। चरण विपरीत में अवलोकन। मूल बढ़ाई: 40X। पट्टी का आकार:। 100 माइक्रोन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 20
चित्रा 20. Adipogenic भेदभाव परख। प्रेरण के रूप में cytoch द्वारा निर्धारित 0 डी (ए, बी) में और उसके बाद 14 डी (सी, डी) Adipogenic भेदभावतेल लाल ओ लाल के साथ emical धुंधला हो जाना, lipídic पुटिकाओं (बड़ा पुटिकाओं काला / लाल तीर द्वारा संकेत कर रहे हैं, छोटे फफोले सफेद / काला तीर द्वारा संकेत कर रहे हैं); नीले / बैंगनी में, नाभिक haematoxylin द्वारा counterstained। brightfield में अवलोकन। मूल बढ़ाई: 40X। पट्टी का आकार:। 100 सुक्ष्ममापी कृपया यहाँ यह आंकड़ा का एक बड़ा संस्करण देखने के लिए क्लिक करें।

चित्रा 21
चित्रा 21. CFU परख। ओएसए-सीएससी लाइनों toluidine नीले रंग के साथ दाग की CFU परख। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

आंकड़ा 22 /> चित्रा 22. ALDH गतिविधि परख। ALDH वर्णमिति परख का पता चला दो ओएस सीएससी लाइनों, OSA5-सीएससी और OSA6-सीएससी में ALDH गतिविधि का उच्च स्तर है, जबकि परख परिमित विभेदित सेल लाइन में इस गतिविधि के अभाव का पता चला fibroblasts की, झूठ बोलना। त्रुटि सलाखों: एसडी। **: पी <0.001 बनाम मिथ्या; *:। पी <0.01 बनाम मिथ्या यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
जीन ओलईगोन्युक्लियोटाईड्स अनुक्रम (5¹-3¹) Amplicon आकार (बीपी) Tₐ (डिग्री सेल्सियस)
Nanog आगे प्राइमर रिवर्स प्राइमर 87 60
अक्टूबर 3/2 आगे प्राइमर रिवर्स प्राइमर GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 आगे प्राइमर रिवर्स प्राइमर TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 आगे प्राइमर रिवर्स प्राइमर CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
बीपी, amplicon आकार के आधार जोड़े; Tₐ, annealingतापमान

तालिका 1 के साथ Amplicon आकार और annealing तापमान Nanog, अक्टूबर 3/4, Sox2 और CD133 के लिए प्राइमर दृश्यों की विस्तृत सूची

Discussion

सीएससी कई गुण है कि ट्यूमर थोक में इस विशेष सेलुलर सबसेट की पहचान की अनुमति है। इस तरह, एटीपी बाध्यकारी कैसेट बहुऔषध तपका ट्रांसपोर्टरों 28, 32, 33, या इस तरह के ALDH 32 के रूप में detoxification एंजाइमों की अभिव्यक्ति की upregulation के लिए की overexpression के लिए रसायन चिकित्सा एजेंटों साइटोटोक्सिक अभिव्यक्ति के लिए अधिग्रहीत प्रतिरोध के रूप में इन विशेषताओं के आधार पर ऐसे CD133, CD44, CD34, CD90, और दूसरों को 30, 34, 35, 41, कई अलग अलग तरीके के रूप में एक विशेष सतह मार्कर, सीएससी अलग-थलग करने की 42-44 विकसित किया गया है। इन तकनीकों में से एक क्षेत्र के गठन परख, जो सीएससी की क्षमता गैर पक्षपाती की शर्तों के तहत विकसित करने के लिए पर आधारित है।

क्षेत्रों के लिए फार्म ऊतक स्टेम कोशिकाओं और सीएससी की क्षमता पहले रेनॉल्ड्स एट अल। 37 से तंत्रिका स्टेम कोशिकाओं की पहचान पर अध्ययन में बताया गया था। इसके बाद गिब्स एट अल। हमें 38एड इन अध्ययनों ठोस ट्यूमर से सीएससी को अलग-थलग, विशेष रूप से, हड्डी सार्कोमा से शुरू करने के लिए। हम क्षेत्र के गठन परख विधि गिब्स एट अल द्वारा सचित्र का उपयोग करने के लिए। ओएसए सेल पारंपरिक ओएस बायोप्सी से प्राप्त लाइनों से सीएससी को अलग करने का फैसला किया है। हम मूल विधि इस परख के परिणामों में सुधार करने के लिए और अन्य कैंसर कोशिका लाइनों के लिए अपने reproducibility की सुविधा के लिए अनुकूलित। क्षेत्र के गठन परख की स्थापना के लिए संदर्भ के साथ, हम सत्यापित 40,000 चढ़ाना कोशिकाओं / अच्छी तरह से परख की शुरुआत में अलगाव में कोशिकाओं को बनाए रखने के लिए एक अच्छा अभ्यास है। इस चाल संभावना है कि गोलाकार कालोनियों सेलुलर एकत्रीकरण से और नहीं एक भी सीएससी की विशेष क्षमता और अनन्य गैर पक्षपाती शर्तों के अधीन हो जाना और एक गोलाकार कॉलोनी के लिए फार्म से ही शुरू से बचने के लिए बहुत महत्वपूर्ण है। इस क्षमता इस परख की एक विशेष रूप से महत्वपूर्ण बिंदु है।

हम यह भी प्रमाणित है कि क्षेत्र के गठन का एक अच्छा दर प्राप्त करने के लिए, यह मूल विधि में वर्णित के रूप में वृद्धि कारकों की aliquots हर दिन ताज़ा करने के लिए हर 3 डी और नहीं पर्याप्त है। इस अध्ययन में, हम भी स्थापित किया है और बड़े पैमाने पर गोलाकार कालोनियों कि जब गैर पक्षपाती की शर्तों के तहत सुसंस्कृत का गठन अलग-थलग करने के लिए एक अच्छा तरीका का वर्णन किया। यह कदम इस परख में महत्वपूर्ण है क्योंकि यह बहुत महत्वपूर्ण है अच्छी तरह से उन्हें नुकसान पहुँचाए बिना कि प्रत्येक में बनते हैं संभव के रूप में क्षेत्रों के रूप में कई अलग-थलग करने की कोशिश है। यह भी केवल क्षेत्रों और न ही कोशिकाओं है, जो परख की अवधि के लिए निलंबन में रह सकता है अलग करने के लिए महत्वपूर्ण है। इन महत्वपूर्ण बिंदुओं पर काबू पाने के लिए, हम एक विशेष अलगाव विधि है, जो, जैसा कि ऊपर दिखाया गया है, सीएससी अलगाव के लिए अच्छा परिणाम दे दी है विकसित किया है। जाहिर है, वहाँ संभावना है कि सभी क्षेत्रों कि गठन बरामद किया जा सकता है, लेकिन नुकसान का प्रतिशत बहुत कम है। दरअसल, हम भी क्षेत्रों को अलग-थलग करने के लिए 40 माइक्रोन pores के साथ एक फिल्टर का उपयोग करने के बाद वे बड़े हो जाते हैं (फार्म की संभावना हैएड लगभग 100 - 200 कोशिकाओं)।

इस अलगाव क्षेत्र गठन बंद हो जाता है, लेकिन एकल कक्षों, methylcellulose अवशेषों का हिस्सा है, और सबसे छोटी क्षेत्रों फ़िल्टर करने के लिए अनुमति देता है। यह उन्मूलन प्रोटोकॉल में वर्णित के रूप में पूरी तरह से निस्पंदन द्वारा किया जाता है।

इसके अलावा, सबसे छोटी गोलाकार कालोनियों के फलस्वरूप नुकसान के साथ 40 माइक्रोन जाल के माध्यम से सबसे बड़ा गोलाकार कालोनियों का चयन एक गोलाकार कालोनियों के रूप में करने के लिए उच्चतम क्षमता के साथ और अधिक से अधिक stemness साथ सीएससी चयन करने के लिए अनुमति देता है। इन संशोधनों के सभी परख में सुधार लाने और सीएससी का अध्ययन करने को समझते हैं और क्षेत्र के गठन परख की मूल विधि का सबसे महत्वपूर्ण कदम पुन: पेश करने के लिए शोधकर्ताओं ने मदद करने के लिए प्रदर्शन किया गया।

अलग-थलग सीएससी के लिए इन विट्रो तरीकों में के बारे में अध्ययन के अलावा, इस अध्ययन को दिखाने के लिए सीएससी से अलग-थलग करने के लिए कि यह कैसे अनुकूलित क्षेत्र गठन परख एक अच्छा तरीका हो सकता है, जिसका उद्देश्यओएसए सेल लाइनों। मूल विधि और विस्तृत अलगाव तकनीक के रूपांतरों इसकी क्षमता में सुधार का वर्णन किया। एक कम समय में, सीएससी की अच्छी संख्या में प्राप्त की और कई प्रयोगों के लिए इस्तेमाल किया जा सकता है। इसलिए, यह तेजी से स्टेम तरह phenotypes की पुष्टि करें और, विशेष रूप से, डबल स्टेम तरह phenotype कि विशेषता ओएस सीएससी का अध्ययन करने के लिए संभव है। इस प्रकार, इस संशोधित परख सीएससी को अलग-थलग करने और उनके जीव विज्ञान के अध्ययन के लिए एक अच्छी तकनीक हो सकता है। भविष्य में, इस विधि, अतिरिक्त रूपांतरों के साथ, यह भी अन्य परिमित कैंसर कोशिका दुर्लभ ठोस ट्यूमर की बायोप्सी से प्राप्त लाइनों से सीएससी को अलग-थलग करने के लिए इस्तेमाल किया जा सकता है।

ऐसे ओएस के रूप में दुर्लभ ठोस ट्यूमर, सीएससी से अलग-थलग करने की संभावना है, न केवल यह विशेष रूप से कैंसर के बारे में अध्ययन के सुधार परमिट बल्कि उनके अलगाव के लिए बेहतर तरीकों को विकसित करने के लिए कैंसर के विभिन्न प्रकार के अध्ययन के लिए और के जीव विज्ञान के भविष्य के अध्ययन के लिए प्रदान करता है इस महत्वपूर्ण सेलुलर सबसेट। इसलिए, हम के रूप मेंइस अध्ययन में किया है, यह आणविक लक्ष्य पाने के लिए और एक बहुत ही विशेष कैंसर विरोधी थेरेपी इस विशेष सेलुलर सबसेट के खिलाफ निर्देशित है, जो शायद के लिए जिम्मेदार है के विकास के अंतिम लक्ष्य के साथ सीएससी जीव विज्ञान के अध्ययन के माध्यम से सीएससी अलगाव के तरीकों में सुधार करने के लिए महत्वपूर्ण है प्राथमिक ट्यूमर के रखरखाव, इसकी पुनरावृत्ति के विकास, और कई अंगों में मेटास्टेसिस के मूल। सीएससी जीव विज्ञान के अध्ययन में यह भी चिकित्सा कि इस तरह के ओएस के रूप में कैंसर,, जिसके लिए neoadjuvant उपचार के बाद जीवित रहने की दर बहुत ही खराब रहता है के इलाज में तीक्ष्ण हो सकता है खोजने के लिए महत्वपूर्ण है।

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics