Etablering af Cancer Stem Cell Cultures fra Menneskelig Konventionel Osteosarkom

Cancer Research
 

Summary

Tilstedeværelsen af ​​cancer stamceller (CSCS) i knoglesarkomer er for nylig blevet forbundet med deres patogenese. I denne artikel præsenterer vi isolering af CSCS fra primære cellekulturer opnået fra menneskelige biopsier af konventionel osteosarkom (OS) ved hjælp evne CSCS til at vokse under ikke-vedhæftende betingelser.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De nuværende forbedringer i terapi mod osteosarkom (OS) har forlænget livet for kræftpatienter, men overlevelsesraten på fem år er fortsat dårlig, når metastaser er opstået. Cancer Stem Cell (CSC) teori hævder, at der er en delmængde af tumorceller i tumoren, der har stamceller-lignende egenskaber, herunder evnen til at opretholde tumoren og til at modstå multilægemiddelresistens kemoterapi. Derfor er der behov for en bedre forståelse af OS biologi og patogenese for at fremme udviklingen af ​​målrettede behandlinger for at udrydde denne delmængde og reducere sygelighed og dødelighed blandt patienter. Isolering CSCS, oprettelse cellekulturer af CSCS, og studere deres biologi er vigtige skridt til at forbedre vores forståelse af OS biologi og patogenese. Etableringen af ​​humanafledt OS-CSCS fra biopsier af OS er blevet gjort muligt ved hjælp af flere metoder, herunder evnen til at skabe 3-dimensionelle stamcellekulturer under nonadherent forhold. Under disse betingelser CSCS kan skabe sfæriske flydende dannede kolonier af datterceller stamceller; disse kolonier betegnes "cellulære kugler". Her beskriver vi en fremgangsmåde til at etablere CSC kulturer fra primære cellekulturer af konventionel OS opnået fra OS biopsier. Vi beskriver klart de mange passager, der er nødvendige for at isolere og karakterisere CSCS.

Introduction

Sarkomer er en heterogen gruppe af sjældne maligne bindevævsceller tumorer med oprindelse overvejende fra det embryoniske mesoderm 1. De forskellige typer omfatter knoglesarkomer og bløddelssarkomer. Knoglesarkomer, en gruppe af relativt ualmindelige primære tumorer, består af flere undertyper, herunder osteosarcom (OS). OS, en af de mest almindelige primære tumorer i knogler, er en mesenchymal malignitet som udviser omfattende klinisk, histologiske og molekylære heterogeniteter 2, 3. Desværre OS forekommer overvejende hos børn og unge voksne 4, 5 og repræsenterer 60% af de fælles histologiske undertyper af knogle sarkom i barndommen 6, 7. OS normalt påvirker skeletområder, der er kendetegnet ved hurtig vækst knogle (f.eks den metafyse af lange knogler). Blandt de histologisk forskellige undertyper af OS, konventionel OS, også kaldet medullær eller central OS, har en høj grad af malignitet og en kvote share på 80% 8. Dette 80% er sammensat af 60% konventionel osteoblastisk OS, 10% chondroblastic OS, og 10% fibroblastisk OS 6, 8-10. Andre OS undertyper omfatter anaplastisk, telangiectatic, kæmpe celle-rige og småcellet OS. Trods fremskridt i kombineret kirurgi og kemoterapi i OS ledelse, resultatet forbliver fattige, med en langsigtet overlevelse på 65-70% hos patienter uden metastaser 11, 12. Distant gentagelser ofte forekomme som pulmonale metastaser eller, mindre hyppigt, som metastaser til fjerne knogler og lokale gentagelser 13. Metastaser er ofte resistente over for konventionelle behandlinger. Denne modstand er grunden til, at 10-års sygdomsfri overlevelse er ca. 30% hos patienter med metastatisk sygdom på diagnosetidspunktet 14, 15.

Som med normalt væv, er cancervæv sammensat af en heterogen samling af celletyper. Celler i tumoren synes at svare til forskellige udviklingsstadier. Inden enhver normal væv bor en subpopulation af celler med evnen til at selfrenew, hvilket giver progenitorer og modne celler til vævshomeostase. Tilsvarende er cancer sammensat af en lignende heterogen population af celler på forskellige udviklingsstadier, med forskellige grader af proliferation og tumorigene potentiale. En undergruppe af disse cancerceller, betegnet cancerstamceller (CSCS), udgør et reservoir af selfsustaining celler med den eksklusive evne til selfrenew og opretholde maligne potentiale af tumorer, hvorved der genereres af de forskellige cellelinier, der udgør tumormasse 16. I 1990'erne, undersøgelser af akut myeloid leukæmi forudsat den første overbevisende beviser for eksistensen af CSC subpopulationer 17, 18. CSCS er siden blevet isoleret fra et stort antal solide tumorer 19 og blev dermed en af de mest undersøgte emner i kræftforskning. CSCS kan faktisk skyldes normale stamceller ved mutationer i gener, der gør det normalestamceller cancrøse 20-23. Flere omdanne mutationer og interaktioner med mikromiljø kunne også bidrage til sunde stamfædre og modne celler erhverver den selfrenewal kapacitet og udødelighed som typiske CSCS. Der er flere hypoteser om denne transformation. Sunde progenitorer, sunde modne celler, og cancerceller, kan dedifferentiere til stamceller, opnåelse af et stem-lignende fænotype ved at aktivere selfrenewal-associerede gener 24-28. Trods flere nylige undersøgelser, oprindelsen af ​​CSCS endnu at blive opdaget.

Et særligt kendetegn ved CSCS er, at deres evne til at modstå den multi-terapi tilgang, som består af kombineret kirurgi og kemoterapi med forskellige lægemidler. Nylige undersøgelser har vist, at CSCS også kan erhverve resistens over for cytotoksisk kemoterapi agenter. Mulige forklaringer på denne modstand omfatter overekspression af ATP-bindende kassette (ABC) multilægemiddeltransportøren (dvs.MDR1 og BCRP1), overekspression af kemoterapi enzymer såsom aldehyd dehydrogenase 1 (ALDH1), og / eller ændringer i cellecykluskinetikken 30-33. Den direkte konsekvens af alle disse begreber, der er beskrevet indtil nu er, at en cancerterapi ville være effektiv, hvis CSC subpopulation blev fuldstændigt elimineret, mens lokalt recidiv eller fjernmetastaser kunne opstå, hvis blot en enkelt CSC overlevede.

Opdagelsen af CSCS i menneskelig sarkomer 34, især OS 35, eller i nogen anden knogle og blødt væv kræft, har stor klinisk betydning, fordi det giver en mulig forklaring på, hvorfor mange behandlinger synes at være effektive i første omgang, men patienterne senere tilbagefald. Derfor er håb for fremtiden kamp mod konventionel OS er at finde nye og specifikke målrettede behandlinger baseret på udvikling af innovative lægemidler rettet mod OS-CSCS takket være den molekylære karakterisering af denne subbefolkning og til studiet af CSC biologi.

I 1992 Reynolds og kolleger, som var at undersøge, om en undergruppe af stamceller var til stede i et voksent pattedyr hjerne, udviklet en metode til isolering af celler, der formodes at være stamme-lignende celler 36, 37. Denne metode er baseret på den særlige evne disse celler til dannelse af sfæriske kolonier ved dyrkning under ikke-adhærerende betingelser. Lignende teknikker blev ansat af Gibbs og kolleger i 2005 for at studere en subpopulation af stamceller-lignende celler i knogler sarkomer 38. For at isolere og karakterisere OS-CSCS fra primære cellekulturer af forskellige typer af konventionelle OS, besluttede vi at tilpasse denne teknik til OS cellelinjer.

Her beskriver vi denne tilpassede fremgangsmåde af kuglen dannelse assay betegnet "sarcosphere assay", som kan anvendes til isolering OS-CSCS af finite primære cellelinjer afledt af humane biopsier af konventionel OS. Vi beskriver også alle de teknikker used at validere stamme-lignende CSC fænotype af cellelinierne isoleret ved denne analyse: 1) vurdering af ekspressionen af ​​gener, der kendetegner pluripotente embryonale stamceller (EKSF) og CD133-genet, som er en markør for CSCS; 2) kolonidannende enhed (CFU) assay; 3) evaluering af evnen af ​​disse celler til at differentiere til osteoblaster og adipocyter under passende differentieringstilstande; 4) Undersøgelse af overflademarkører af mesenchymale stamceller (MSC'er) (dvs. CD44, CD105 og Stro-1) efter immunfluorescensfarvning og ved hjælp af flow cytometrisk analyse; 5) evaluering af ALDH aktivitet af disse celler.

Protocol

Alle eksperimenter anvendes humane væv beskrevet heri blev godkendt af den lokale etiske komité (Rif. N. 141/12). Informeret samtykke til indsamling af vævsprøver og for anvendelse og opbevaring af prøverne blev opnået fra donorer på AOUC.

1. Forberedelse til Kultur

  1. Forbered vækst dyrkningsmedium (GM) ved tilsætning af 10% føtalt bovint serum (FBS), 100 IU / ml penicillin og 100 pg / ml streptomycin til Coon modificerede Hams F12-medium. Filter og sterilisere GM anvendelse af et 0,22 um filter. Store GM op til 1 måned ved 4 ° C.
  2. Forbered collagenase medium (CM) ved tilsætning af 20% FBS, 100 IU / ml penicillin, 100 ug / ml streptomycin og 3 mg / ml collagenase type II Coon modificerede Hams F12-medium. Filter og sterilisere CM anvendelse af et 0,22 um filter. Store CM op til 1 måned ved -20 ° C.
  3. Forbered medium for celle frysning (FM) ved at tilsætte 40% FBS, 100 IU / ml penicillin, 100 ug / ml streptomycin og 6.5% Dimethylsulfoxid (DMSO) til Coon modificerede Hams F12-medium. Filter og sterilisere FM anvendelse af et 0,22 um filter. Store FM op til 1 måned ved 4 ° C.
  4. Forbered medium til CFU-assay (CFUM) ved tilsætning af 20% FBS, 100 IU / ml penicillin og 100 pg / ml streptomycin til Coon modificerede Hams F12-medium. Filter og sterilisere CFUM hjælp af en 0,22 um filter. Store CFUM op til 1 måned ved 4 ° C.
  5. Forbered trypsin ved opløsning 400 mg trypsin, 200 mg EDTA og 1,000 mg D (+) - glucose vandfrit i 1.000 ml Dulbeccos phosphatbufret saltvand (DPBS) uden Ca2 + og Mg2 +.
    BEMÆRK: Divide frisk trypsin-EDTA i 50 ml prøver i 25 cm2 kolber ved anvendelse af et 0,22 um filter og fryses ved -20 ° C i op til 3 måneder. Store optøet filtersteriliserede portioner ved 4 ° C uden tab af aktivitet.
  6. Forbered stamceller cellevækst medium (SCGM) ved tilsætning af 10% FBS, 100 IU / ml penicillin, 100 ug / ml streptomycin, og 10 ng / ml bFGF (25 ug / ml stamopløsning) til Coon modificerede Hams F12-medium. Filter SCGM anvendelse af et 0,22 um filter og opbevar SCGM op til 2 uger ved 4 ° C.
  7. Forbered 2% methylcellulose (MC) ved opløsning MC i ultrarent H2O ved 4 ° C i 3 dage. Når MC er fuldstændig opløst, autoklave det og opbevares ved 4 ° C.
    BEMÆRK: Når MC er steriliseret, bliver det fast. At bringe MC til en flydende tilstand, opbevares ved 4 ° C.
  8. Forbered sarcosphere vækstmedium (SGM). Forberede dette medium friske (ikke mere end 2 uger før brug) ved tilsætning af 100 IE / ml penicillin, 100 ug / ml human bFGF (25 ug / ml stamopløsning), 20 nM progesteron (10 uM stock), 100 uM putrescin, 30 nM natriumselenit (30 uM stock), 25 ug / ml transferrin (25 mg / ml stamopløsning), 20 ug / ml insulin (20 mg / ml stamopløsning), og 10 ng / ml human EGF (10 ug / ml stamopløsning) til 2X Coon modificerede Hams F12 medium. Filter og sterilisere SDB anvendelse af et 0,22 um filter. Opbevar i op til 2 uger ved 4 ° C.
  9. Forbered osteogent medium (OM) ved tilsætning af 10% FBS (South amerikansk oprindelse), 100 IU / ml penicillin, 100 ug / ml streptomycin, 10 nM dexamethason (100 uM stock), 0,2 mM natrium-L-ascorbyl-2-phosphat (1 M stamopløsning), 10 mM β-glycerophosphat (5 mg / ml stamopløsning) og 1 ug / ml calcein (200 ug / ml stamopløsning) til Coon modificerede Hams F12-medium. Filter og sterilisere OM anvendelse af et 0,22 um filter. Opbevares ved 4 ° C.
    BEMÆRK: Opbevar dexamethason stamopløsninger under flydende nitrogen for at opretholde deres aktivitet. Forbered frisk OM hver 2. uge til at opretholde aktiviteten af ​​dexamethason for at opretholde differentiering potentiale af mediet.
  10. Forbered erythrocyt lysispuffer (ELB) ved opløsning 1,66 mg NH4Cl, 0,2 mg K 2 HPO 4 og 0,007 mg EDTA i 200 ml destilleret vand (dH 2 O). Filter og sterilisere ELB anvendelse af et 0,22 um filter. Opbevares ved 4 °C.
  11. Forbered adipogenisk medium (AM) ved tilsætning af 10% FBS (Sydamerika oprindelse), 100 IU / ml penicillin, 100 ug / ml streptomycin, 1 pM dexamethason (1 mM stamopløsning), 1 uM bovint insulin (10 mM stamopløsning), 0,5 mM isobutylmethylxanthin (IBMX) (500 mM stamopløsning), og 100 uM indomethacin (200 mM) til Coon modificerede Hams F12-medium. Filter og sterilisere AM ved hjælp af en 0,22 um filter. Opbevares ved 4 ° C.
    BEMÆRK: Opbevar dexamethason stamopløsninger under flydende nitrogen for at opretholde deres aktivitet. Forbered frisk AM hver 2. uge til at opretholde aktiviteten af ​​dexamethason for at opretholde differentiering potentiale af mediet.
  12. Forbered 2% bovint serumalbumin (BSA) i DPBS (BSA / DPBS). Opløs 10 g BSA i 500 ml DPBS og forberede stamopløsningen ved aliquotting 50 ml stamopløsning i 50 ml koniske rør. Opbevar ved -20 ° C.
  13. Forbered en opløsning af 4% paraformaldehyd (PFA) i DPBS (PFA / DPBS). I en lmemical hætte, fortyndes paraformaldehyd i DPBS og forberede stamopløsningen ved aliquotting 50 ml stamopløsning i 50 ml koniske rør. Opbevares ved 4 ° C.

2. Etablering Primær OS cellekulturer og OS Finite cellelinier (OSA)

BEMÆRK: Primær OS cellekulturer blev tilberedt af friske prøver af konventionelle OS biopsier indsamlet på "Unità Ortopedia Oncologica e ricostruttiva", AOUC Careggi, Firenze. Alle biopsier, som blev opnået ved nål aspiration eller kirurgisk resektion af en lille del af tumoren (figur 1A, B), blev øjeblikkeligt anbragt i dyrkningsmedium suppleret med 100 IU / ml penicillin og 100 ug / ml streptomycin (pH 7,4) og transporteres til laboratoriet, hvor de blev behandlet. Alle beskrevne manipulationer blev udført under aseptiske betingelser ved anvendelse af en laminar flow hætte.

  1. Isolering af OS celler
    1. Placer biopsi i en100 mm petriskål med et lille volumen GM. Med en steril lancet og Perry pincet, hakkekød prøver OS væv ved at skære dem i stykker så lille som muligt (0,5 mm - 1 mm) (figur 2A, B).
    2. Dæk vævsfragmenter med 10 ml CM for enzymatisk fordøjelse (figur 2B) og inkuberes i 3 timer i et 37 ° C, 5% CO2 inkubator. Fjern forsigtigt suspension af fragmenter ved hjælp af en pipette og overføre det til en 15 ml konisk rør til øjeblikkelig centrifugering (400 xg i 5 min) til pelletering af fragmenter.
      BEMÆRK: Efter centrifugering hvis biopsier er rige på erytrocytter, en rød deponering sammensat af erythrocytter kan ses i løbet af fragmenterne. Derfor, før man går videre til mekanisk spredning, behandle prøven med erythrocyt lysisbuffer. Supernatanten fjernes ved aspiration, og der tilsættes 5 ml ELB.
    3. Suspender pellet fragmenter i 1 min og centrifugeres suspensionen ved 400 xg i 2min. Fjern supernatanten ved aspiration. Tilsæt 5 ml GM og mekanisk sprede fragmenter ved hjælp af en 10 ml serologisk pipette (åbning størrelse, 1,5 mm indvendig Ø) 10 - 20 gange.
    4. Centrifugeres suspensionen ved 400 xg i 5 min. Fjern supernatanten ved aspiration, suspendere cellepelleten med 10 ml GM og derefter overføre den resulterende cellesuspension i en 100 mm petriskål. Inkubér petriskålen i et 37 ° C, 5% CO2 inkubator og erstatte GM med frisk komplet GM hver 3 d.
      BEMÆRK: Ganske ofte, OS vævsprøver opnået ved nål aspiration er meget små og indeholder knoglefragmenter, som ikke fordøjes ved enzymatisk fordøjelse med collagenase. Derfor, efter supernatanten er fjernet, forsøg på at adskille celler fra knoglevæv ved mæskning pellet fragmenter med en pipette.
  2. subkultur
    BEMÆRK:
    At etablere en OSA, når cellerne når omtrentlige sammenløb, fjerne dem fra their kultur fartøj, fortynde, og placere i en frisk plade for at muliggøre yderligere vækst. Denne subkultur procedure opnås med den enzymatiske fremgangsmåde betegnes trypsinisering.
    1. Fjern mediet ved aspiration. At dissociere cellemonolaget, tilsættes 2 - 3 i ml trypsin ved stuetemperatur (max 18 - 20 ° C), rystes forsigtigt én gang, og fjern trypsin straks ved aspiration. Gentag to gange. Inkuber cellerne ved 37 ° C i 3 - 4 minutter, indtil de begynder at løsne sig.
      BEMÆRK: God trypsinisering kan ses af den erfarne bruger som små huller, der danner i svagt uigennemsigtig monolag når fadet holdes mod lyset. Denne dissociation kan også overvåges ved anvendelse af et inverteret mikroskop; anbefales denne fremgangsmåde for begyndere.
    2. Standse trypsin reaktionen ved tilsætning af 10 ml GM og vaske skålen brønd med en pipette for at løsne alle cellerne. Overfør 1 ml af suspensionen til en ny 100 mm petriskål og tilsættes 9 ml GM (1/10 split af celler).
      NOTE:
  3. Kryopræservering af OS primære kulturer og OSA
    BEMÆRK: Frys en sammenflydende 100 mm petriskål i 4-5 kryohætteglas. skal udføres processen med kryopræservering hurtigt, fordi DMSO, som beskytter cellemembraner under frysning, er toksiske for celler på ikke-temperaturer under frysepunktet.
    1. Dissociér cellekulturer fra monolaget ved trypsinisering (se afsnit 2.2), pellet cellerne ved centrifugering ved 400 xg i 5 min, supernatanten fjernes ved aspiration, og derefter hurtigt suspendere cellepelleten i FM.
    2. Alikvot 1 ml af denne suspension pr kryogene hætteglas. Anbring straks de fyldte hætteglas i en fryser kasse med en kappe af 2-propanol og opbevare Immediately ved -80 ° CO / N. Transfer kryoglas til flydende nitrogen den følgende dag for langtidsopbevaring.
  4. Optøning OS cellelinjer og primære kulturer
    1. Optøning OS cellelinjer fra flydende nitrogen opbevaring, optøning kryoglas hurtigt ved at placere dem i et laboratorium vandbad ved 37 ° C. Overfør indholdet af kryoglas ind i en 15 ml konisk rør, og der tilsættes ca. 10 ml GM (Se ​​afsnit 2.3 for at fjerne DMSO). Fjern supernatanten ved aspiration og suspenderer cellepelleten i 10 ml GM. Plate cellesuspensionen i en 100 mm petriskål og inkuberes i et 37 ° C, 5% CO2 inkubator.

3. Sarcosphere Assay at isolere OS-CSCS

BEMÆRK: Dette eksperiment udføres på OSA. Varigheden af ​​dette eksperiment er relateret til kapaciteten af ​​cellerne til at danne disse kugle kolonier (sarcospheres), og rækken af ​​tiden er 7, 14, 21, og 28 d.

  1. Estabtelse af sarcosphere assay
    1. Forbered hæmocytometer kammer og alle reagenser i forvejen.
    2. Fjern mediet ved aspiration og dissociere cellerne fra monolaget ved trypsinisering (se afsnit 2.2). Bland cellesuspensionen grundigt, pipettering at dispergere eventuelle klumper, og indsamle 10 pi anvendelse af en 20 pi pipettespids.
    3. Overfør 10 uL cellesuspensionen straks til hæmocytometeret kammer kant, udvise suspensionen, og lad den blive trukket under dækglasset ved kapillarvirkning.
    4. Overhold hæmocytometeret kammer under fasekontrast. Vælg en 10X objektiv og fokusere på de gitterlinjer i kammeret. Tæl celler liggende i denne 1 mm 2-område ved hjælp af de underinddelinger (også bundet af tre parallelle linjer) og enlige gitterlinjer som en hjælp til tælling.
    5. Måle koncentrationen og anvende følgende ligning: 1 ml = n * 10 4 / z (n: hele antal celler i alle tællesfirkanter 1 mm2; z: antallet af optalte firkanter 1 mm2). Beregn rumfanget af cellesuspensionen nødvendig til pladen en total mængde på 240.000 celler opdelt i 40.000 celler for hver brønd i 6-brønds fastgørelsesplade ultralav.
      BEMÆRK: Sørg for at pladen det korrekte antal celler ved udpladning celler i én ekstra godt. Derfor er den totale mængde af celler, der skal udplades er 280.000 celler.
    6. Forbered 35 ml SGM ved tilsætning af 50% af 2% MC (SGM-MC) i en 25 cm2 kolbe. Forbered det samlede volumen af ​​SGM overvejer 5 ml ekstra for at pladen én ekstra godt.
    7. Tilsæt beregnede mængde af cellesuspensionen til SDB-MC fremstillet i kolben og blandes forsigtigt med en pipette til at sprede eventuelle klumper. Plate cellerne i en 6-brønds fastgørelsesplade ultralav og bruge et omvendt mikroskop at observere, hvordan cellerne ser ud efter at være blevet belagt.
    8. Inkubér cellerne i et 37 ° C, 5% CO2 inkubator. Hver 3 d, tilføje frESH alikvoter af bFGF og EGF til hver brønd for at opdatere koncentrationen af ​​vækstfaktorer. Tilsæt 2 pi bFGF og 5 pi EGF til at opretholde både den endelige koncentration på 10 ng / ml i hver brønd.
  2. Isolering af sarcospheres
    BEMÆRK: Overvåg gode fremadskriden sarcosphere assayet på 7, 14, 21, og 28 d at beslutte, hvornår det er nødvendigt at isolere de sarcospheres der dannes.
    1. Forbered alle reagenser og udstyr i laminar flow hætte (figur 3A, B). Saml filtreringsenheden ved at placere et netfilter af 25 mm diameter og en 40 um mesh i en membran filterholder; steriliseres ved autoklavering (Figur 4A-E).
    2. For hver brønd, overføre medium indeholdende sarcospheres til en sprøjte med en steril membran filterholder anvendelse af en steril pipette med en 1.000 pi spids. Efter helt at fjerne medium, der indeholder de sarcospheres, vaske godt med adding 5 ml GM at være sikker på at overføre alle i områder til en sprøjte. Brug mikroskop for at bekræfte, om alle de sarcospheres er blevet tilbagebetalt. Hvis ikke, skal du fortsætte ved at gentage dette trin.
    3. Filtrer suspensionen med en membran filterholder kun ved hjælp af tyngdekraften uden pres for at undgå at beskadige kugler og undgå har sarcospheres krydser gennem filteret og derved undgå tab af kugler. Fjern luftbobler ved forsigtigt under anvendelse af en steril glas Pasteur-pipette.
      BEMÆRK: Nogle gange filtreringen bliver blokeret af tilstedeværelsen af en luftboble i holderen membranfilter.
    4. filtreringsenheden vaskes ved tilsætning af 10 ml GM til sprøjten, og lade det filtrere uden pres for at være sikker på at eliminere de enkelte celler. Tag hinanden filterenheden fra sprøjten og sætte det ind i en petriskål.
    5. Fjern netfilter fra indehaveren af ​​Membranfilteret Perry pincet og vask det ved at ryste det forsigtigt med en pincet i en 60 mmPetriskål at frigive sarcospheres fra virvaret af membranen. Derefter placere membranen i et godt og bekræft ved mikroskopisk observation, at der ikke er flere kugler filtrede i membranen. Hvis kugler stadig viklet ind i membranen, fortsætte med en anden vask som beskrevet i trin 3.2.4.
    6. Overhold de frigivne sarcospheres bruger et mikroskop. Inkuber de frigjorte sarcospheres i et 37 ° C, 5% CO2 inkubator. Gentag alle trin for hver brønd i en 6-brønds fastgørelsesplade ultralav.

4. OS-CSC Lines

BEMÆRK: OS-CSCS opnås fra sarcospheres som udviser klæbende ekspansion ved at genindføre og reculturing disse celler i et monolag efter de er belagt i små 60 mm petriskåle ikke længere er under ultra-lave vedhæftede betingelser.

  1. OS-CSC kulturer
    1. For at aktivere yderligere vækst, subkultur celler, når de når ca. 90% sammenløb i en 60mm petriskål. Gentag trin 2.2.1 at etablere OS-CSC kulturer.
    2. Stop trypsinisering ved tilsætning af 4 ml SCGM og vaske skålen godt, med en pipette for at løsne alle cellerne. Overfør cellesuspensionen til en ny 100 mm petriskål, og der tilsættes 6 ml SCGM. Når OS-CSCS nå 90% sammenløb, subkultur ved at gentage punkt 2.2.
      BEMÆRK: Til in vitro analyse for at karakterisere stamcelle-lignende fænotype af isoleret OS-CSCS kan celler udpladet i forskellige typer af plader.
    3. Bevar de etablerede OS-CSC linjer ved kryopræservering (gentag alle trin i afsnit 2.3). Afrime kryopræserverede OS-CSCS ved at gentage alle trin i afsnit 2.4.

5. In vitro ANALYSE at Karakterisere OS-CSCS:

  1. Fremstilling af celler til immunofluorescens
    BEMÆRK: Celler fikseret i paraformaldehyd, når de når den rigtige kvalitet af konfluens i hver brønd i en 24-brønds plate. Karakteren af ​​konfluens er relateret til typen af ​​eksperimenter.
    1. Plade OS-CSCS i en plade med 24 brønde til at undersøge overfladen mesenchymale stamceller (MSC) -markører ved immunofluorescens. Fix cellerne i hver brønd, når de når op på 50 - 60% sammenløb. Fjern SCGM ved aspiration og vaskes to gange i en DPBS 24-brønds plade.
    2. Under en kemisk hætte, tilsættes 500 pi 4% PFA / DPBS til hver brønd. Inkuber ved stuetemperatur i 10 min. Fjern PFA / DPBS og vask 3x med ultra rent dH 2 O. Tillad 24-brønds plade til at tørre i stinkskab.
  2. Immunofluorescens for MSC markører
    BEMÆRK: Immunfluorescensfarvning af OS-CSCS fikseret i 4% PFA / DPBS kan anvendes til at undersøge MSC-lignende fænotype af OS-CSCS anvendelse af antistoffer rettet mod CD44, Stro-1 og CD105. Den følgende fremgangsmåde anvendes rutinemæssigt af forfatterne.
    1. I en kemisk hætte, permeabilisere celler, der er blevet fastsat i 4% PFA / DPBS ved at tilføje 500 uL 0.2% Triton X-100 / DPBS til hver brønd. Inkuber cellerne ved 37 ° C i 30 minutter. Vask forsigtigt cellerne 3 gange med DPBS. Tilsæt 300 pi RNase fortyndet 1 / 1.000 med 2% BSA / DPBS til cellerne og inkuberes ved 37 ° C i 30 minutter.
    2. Vask forsigtigt cellerne 3x med 2% BSA / DPBS. Farv cellerne for MSC markører. Tilsæt primære antistof alene til brøndene valgt som positive kontroller for hvert antistof.
      1. Der tilsættes 300 pi anti-CD105 fortyndet 1/10 med 2% BSA / DPBS, 300 pi anti-CD44 fortyndet 1/10 med 2% BSA / DPBS, 300 pi anti-Stro-1 fortyndet 1/10 med 2% BSA / DPBS og kun 200 pi 2% BSA / DPBS til brøndene valgt som negative kontroller for hvert antistof.
      2. Inkubér cellerne i et fugtigt miljø ved 4 ° CO / N. Vask brøndene 3x med DPBS og derefter to gange med 2% BSA / DPBS.
    3. Reveal primære antistoffer ved at tilføje specifikke sekundære antistoffer.
      1. Der tilsættes 300 pi anti-kanin IgG (æsel anti-kanin IgG [H + L]) fortyndet 1/100med 2% BSA / DPBS i hver brønd valgt som positiv og negativ kontrol for CD44 og CD105. Tilsæt 300 pi FITC-anti-muse-Ig (FITC-kanin anti-muse-IgG [H + L]) fortyndet 1/100 med 2% BSA / DPBS i hver brønd valgt som positiv og negativ kontrol for Stro-1. Cellerne inkuberes i mørke ved stuetemperatur i 60 min. Vask brøndene 6x med DPBS.
    4. Stain MSC markør-positive celler til cytoskeletal actin ved at tilføje 300 uL phalloidin fortyndet 1/100 med 2% BSA / DPBS i hver brønd farves for MSC markør immunofluorescens.
    5. Inkubér cellerne i 40 minutter ved stuetemperatur. Vask brøndene 3x med DPBS og derefter vaske dem to gange med ultrarent dH 2 O. Fortsætte til kontrastfarvning af kernerne efter immunfluorescensfarvning ovenfor beskrevet. Forbered propidiumiodid opløsning 10 -5 M i DPBS (lager 1,5 x 10 -3 M) i et stinkskab.
      1. Tilsæt 200 pi propidiumiodid opløsning til hver brønd farvet som beskrevet ovenfor. Inkubér cellens til 2 - 3 min ved stuetemperatur. Vask brøndene to gange med ultrarent dH 2 O.
        BEMÆRK: Gentag alle trin i §§ 5.1 - 5.2 på cellelinjen HCT8, en primær kontinuerlig differentieret coloncancercellelinie, der anvendes som en negativ kontrol.
  3. Osteogen differentiering assay
    BEMÆRK:
    Osteogen differentiering varer 20 d.
    1. Plade OS-CSCS i 24-brønds plader ved en celledensitet på 1 x 10 4 celler / cm2 i SCCGM. Lade cellerne vokse i SCGM indtil de op på 80 - 90% konfluens i hver brønd.
    2. Start osteogen differentiering ved at ændre SCGM til OM. Lad cellerne til at vokse i OM og opdatere medium hver 3. - 4 d. Stop osteogene differentiering assayet ved 10 d at evaluere forekomsten af ​​alkalisk phosphatase (ALP).
    3. Fix celler i 4% PFA / DPBS (se afsnit 5.1). Evaluere den osteoblastiske fænotype ved cytokemisk farvning for ALP og for HAhjælp alizarinrødt S-farvning.
    4. ALP cytokemisk farvning
      BEMÆRK: Forbered farvestoffet blandingen i en kemisk hætte umiddelbart før du starter farvning.
      1. Opløs 40 mg Fast Blue BB eller Fast Red Violet LB salt i 50 ml Tris-HCI, pH 9 (opløsning A). Opløs 5 mg naphthol-AS-MX phosphat-natriumsalt i 1 ml DMSO (Opløsning B). Tilføj Opløsning B udelukkende til opløsning A og bland godt, opnåelse Solution C. Vask cellerne to gange med DPBS.
      2. Der tilsættes 500 pi - 1 ml opløsning C til hver brønd og inkuberes ved 37 ° C og 5% CO2. Overvåg forløbet af farvning hver 10 min ved observation af cellerne under mikroskopet.
      3. Stop farvning når ALP-positive celler bliver intenst farvet (blå med Fast Blue BB salt eller rød med Fast Red Violet LB salt), hvilket normalt sker inden for 30 min. Vask cellerne 3x med ultra rent dH 2 O for at fjerne alle rester af Solution C. Hvis et bundfald af pletten is stede, vaske cellerne hurtigt en gang med absolut ethanol.
      4. Fortsætte til kontrastfarvning af kernerne efter ALP-farvning som beskrevet i trin 5.2.5 og 5.2.5.1.
    5. Alizarinrødt S cytokemisk farvning
      BEMÆRK: Forbered farvestoffet blandingen, før du starter eksperimentet.
      1. Forbered 2% alizarinrødt S (2 g alizarinrødt S i 100 ml ultrarent H2O). Tilføj 2,5% NH3 til 2% alizarinrødt S at nå pH 6,0. Store 2% alizarinrødt S-opløsning ved 4 ° C. Vask cellerne en gang med DPBS.
      2. Tilføj alizarinrødt S til cellerne for kun et par sekunder.
      3. Vask brøndene med ultrarent dH2O at styre graden af farvning; hvis HA indskud er ikke intenst farvet, gentag trin 5.3.5.2. Stop farvning, når HA indskud bliver intenst rød farvet, hvilket normalt sker inden for få minutter. Vask brøndene med ultra rent dH 2 O.
    6. adipogeniske differentiering
      BEMÆRK: Assay varighed afhænger af OS-CSC linjer. Assayet kan sidste 14 - 30 d.
      1. Plade OS-CSCS i 24-brønds plader ved en celledensitet på 1 x 10 4 celler / cm2 i SCGM. Lade cellerne vokse i SCGM indtil de op på 80 - 90% konfluens i hver brønd. Indled adipogenisk differentiering ved at ændre SCGM til AM. Lade cellerne vokse i AM og opfriske AM to gange om ugen.
      2. Stop adipogenisk differentiering testen, når lipidvesikler er synlige. Evaluere den adipogeniske fænotype ved Oil Red O-farvning og ved hæmatoxylin modfarvning for kerner.
      3. Hæmatoxylin kontrastfarvning for kerner
        BEMÆRK: Forbered farvestoffet blandingen, før du starter eksperimentet.
        1. Forbered 5% hæmatoxylin løsning, kaldet Emallume Carazzi 39. løsningen ved 4 ° C opbevares. Tilføj Emallume Carazzi for kun 2 min. Vask brønde med ULTrapure dH 2 O.
    7. CFU assay
      BEMÆRK: Dette eksperiment skal udføres i tre eksemplarer.
      1. Plate OS-CSCS i 100 mm petriskåle med en celledensitet på 450 celler / cm2 i CFUM. Inkubér cellerne i et 37 ° C, 5% CO2 inkubator i 4 uger. Opdater CFUM to gange om ugen.
      2. Plette CFU'er med toluidinblåt. Tæl farvede kolonier ved hjælp af et omvendt mikroskop. Beregn CFU effektivitet efter følgende formel: (antal dannede kolonier / antal celler podet) * 100.
    8. ALDH aktivitetsanalyse
      BEMÆRK: ALDH aktivitet er blevet vurderet ved anvendelse af en ALDH Activity Kolorimetrisk Assay Kit på de to OS-CSC linjer og på et endeligt fibroblast linie, som blev anvendt som en negativ kontrol. Dette sæt kvantificerer ALDH enzymatiske aktivitet ved absorbans læse ved 450 nm. Alle test udført i tre eksemplarer.
      1. Dissociér cellekulturer fra monolag ved trypsinisering (se afsnit 2.2). Pelleter cellerne ved centrifugering ved 400 xg i 5 min. Følg producentens protokol.
    9. Flowcytometrisk analyse:
      BEMÆRK: Single cellesuspensioner kræves for optimal farvning af prøver til flowcytometri. En enkelt celle suspension skal være forberedt på hvert antistof, der skal testes. Dissociér cellekulturer fra monolag ved trypsinisering (se afsnit 2.2).
      1. Placer cellesuspensionen i et konisk rør, udføre en celletælling under anvendelse af Burker-tællekammer, centrifugeres cellerne ved 400 xg og resuspender i et passende volumen adskillelse buffer til opnåelse af en cellesuspension ved en endelig cellekoncentration på 1 x 10 5 celler / ml.
      2. Centrifuger cellesuspensionen i 5 minutter ved 4 ° C. Supernatanten kasseres, og vask pellet med separation puffer. Gentag dette trin to gange.
      3. Farv celler til MSC markører (dvs. CD44, CD105 og Stro-1) 40.
      4. Analyser positivt farvede cellesuspensioner i et flowcytometer. Analyser de markerede prøver inden for 1 d. Inkuber disse prøver ved 4 ° C indtil analyse.
    10. RT-PCR
      1. Ekstraktion og isolation af RNA
        1. Tilsæt 1 ml lysis reagens til de cellulære frosne pakkede prøver af OS-CSCS og lysere cellerne direkte i røret ved pipettering pelleten op og ned flere gange.
        2. Centrifugeres prøverne ved 12.000 x g i 1 min ved 4 ° C. Fjern forsigtigt supernatanten. Supernatanten overføres til et nyt rør, der tilsættes 200 pi chloroform, og hætten røret fast. Ryst røret kraftigt i 15 sekunder og inkuberes prøven i 5 minutter ved stuetemperatur.
        3. Centrifugeres prøverne ved 12.000 xg i 15 minutter ved 4 ° C. Blandingen adskilles i tre forskellige faser. RNA er udelukkende i farveløs øvre vandige fase.
        4. At være particularly forsigtig, kun fjerne den vandige fase og overføre denne fase i et nyt rør til at gå videre med RNA isolation. Der tilsættes 500 pi isopropanol til røret indeholdende den vandige fase. Ryst røret forsigtigt med hånden. Prøven inkuberes ved stuetemperatur i 10 min. Centrifugeres prøven ved 12.000 xg i 10 min ved 4 ° C.
          BEMÆRK: Efter at prøven centrifugeres, er det muligt at se den RNA, som danner en gel-lignende pellet på siden og i bunden af røret.
        5. Fjern supernatanten fra røret, være omhyggelig med at forlade pelleten af ​​RNA på bunden. Tilsæt 1 ml 75% ethanol til røret. Vortex røret med hånden i et par sekunder og centrifugeres røret ved 7500 xg i 5 min ved 4 ° C.
        6. Kassér ethanol og lufttørre RNA pellet. Når pelleten er tør, resuspender RNA pellet i RNase-frit vand (på 10 - 50 uL) ved pipettering af opløsningen op og ned flere gange.
        7. Bestem udbyttet og renheden af ​​RNA ved measnder absorbansen ved 260 nm og 280 nm ved anvendelse af et spektrofotometer. Evaluere integriteten af ​​det totale RNA på standard 1% agarose gel. Opbevar RNA ved -80 ° C.
      2. Omvendt polymerasekædereaktion
        1. Syntetisere første streng cDNA'er fra 500 ng RNA-prøver under anvendelse af en revers transkription kit. Optø RNA-prøver på is og tø de nødvendige løsninger, der indgår i sættet ved ST. Fortsæt til syntetisere cDNA efter producentens protokol.
      3. Semikvantitativ revers transkriptase-polymerasekædereaktion (RT-PCR)
        1. Udføre alle PCR'er under anvendelse af 1 pi cDNA for hver prøve som en skabelon i et endeligt reaktionsvolumen på 24 pi. Brug primersekvenserne i tabel 1 anførte til amplifikation af Nanog, okt 3/4, Sox2 og CD133-gener.
        2. Adskil RT-PCR produkter af 1,8% agarosegelelektroforese og farvning med ethidiumbromid. Fotografi under UV Illumsøgelse.

Representative Results

OS prøver opnået via nål aspiration eller kirurgisk resektion af en lille del af tumoren (figur 1A, B) tillade isolering af kun én OSA hvis de behandles nøjagtigt som beskrevet i afsnittet protokollen (figur 2A, B). Desværre er antallet af celler isoleret fra biopsierne er lav, med et output fra 30 - 50%. Udgangen afhænger af typen og dimensionen af biopsier (figur 5A, B). Disse celler skal behandles præcist. Følgelig ca. en måned er nødvendig for de primære kulturer for at nå sammenflydning i en 100 mm petriskål. Efter dette tidsrum er OSA opnået fra to OS prøver mærket OSA5 og OSA6 (figur 6A, B). Derefter er det nødvendigt at videredyrke den primære cellelinie til opnåelse af et tilstrækkeligt antal celler til at udføre karakterisering analyse og at kryopræservere cellen lines. På den 3. passage af subkultur, når begge OSA primære cellelinier flyder sammen, er de udpladet i 6-brønds ultralav fastgørelsesplader for sarcosphere assay. Denne type plade anvendes, fordi det tillader os at opretholde cellerne i en suspenderet tilstand, at forhindre stamcellerne fra udlæg-medieret differentiering, for at forhindre forankringsafhængige celler fra dividere, og endelig at reducere vedhæftning til substratet. Derfor deres anvendelse tillader os at skabe en stressende betingelse for kræftcellerne, som er nødvendig for at udvælge CSCS. Ved 24 timer efter begyndelsen af assayet, synes celler isoleret fra hinanden (figur 7). Efter 7 dage for at overvåge progression af assayet, har små sfæriske kolonier begyndte at dannes og er synlige (figur 8). Ved 28 d, kan flere store sfæriske kolonier, der er opstået i hver brønd observeres (figur 9A, B). Efter sarcospheres have blevet dyrket i 28 d, kan disse store sfæriske kolonier isoleres. Figur 10 viser trinene til isolering sarcospheres fra 6-brønds ultralav fastgørelsesplader og reculturing dem under adhærente betingelser. Figur 11 viser de flydende sfæriske kolonier efter isolering. De store sfæriske kolonier udplades i normale fastgørelsesplader viser vedhæftende ekspansion efter isolering (figur 12A, B). Celler, der udvider fra de enkelte sarcospheres er sandsynligvis cancerceller med en stamcelle-lignende fænotype. Derfor efter isolering, OS-CSCS blev sandsynligvis opnået. Disse celler er navngivet OSA5-CSCS og OSA6-CSCS (figur 13A, B).

På dette tidspunkt, er det nødvendigt at gå videre med karakteriseringen af ​​stamcelle-lignende fænotype for de to OS-CSC linierne opnået som beskrevet ovenfor. Analyserne for karakteriseringen af ​​stamcelle-lignende fænotype were udføres på 4. passage af subkultur efter sarcospheres for hver OS-CSC blev isoleret. De to cellelinjer, OSA5-CSCS og OSA6-CSCS, udviste kraftig positivitet for overfladen MSC markører (CD105 og CD44) (figur 14A, B og 15A, B), mens de viste moderat positivitet for overfladen MSC markør Stro- 1 (figur 16A, B). Vores observationer er blevet bekræftet af negative resultater opnået med den kommercielle og differentieret coloncancercellelinie HCT8 (figur 14C, figur 15C, figur 16C). Der sås en total mangel på specifik og uspecifik farvning for disse overflade markører i HCT8 cellelinie.

For at evaluere MSC-fænotypen af ​​de to OS-CSCS, vi også udført flowcytometriske analyser. Både OS-CSC linier udtrykte høje niveauer af CD44 og CD105. Men af ​​cellerne i begge cellelinier, kun 1,14% udtrykt Stro-1. Derfor er denne reSult bekræftede moderat tilstedeværelse af Stro-1 som påvist ved immunfluorescensfarvning. I modsætning hertil 99,62% af OSA5-CSCS udtrykte CD44 og 87,38% af disse celler udtrykte CD105; 99,88% af OSA6-CSCS udtrykte CD44 i og 95,79% af disse celler udtrykte CD105. Derudover begge cellelinier er CD45-.

Vi vurderede udtryk for 3 ESC markører (NANOG, okt 3/4, Sox2) og af CD133-genet, en anden CSCS markør, ved RT-PCR. Vi har bemærket, at alle disse gener blev udtrykt i både OS-CSC linjer (figur 17). De adipogeniske og osteogene differentieringsfaktorer assays viste kapacitet både isolerede OSA-CSC linjer at differentiere til osteoblaster (Figur 18A - D og figur 19A - D) og til adipocyter (figur 20A - D).

Endvidere CFU en ssay (figur 21) viste en god sats på klonogene effektivitet, med 13% for OSA5-CSCS og 14% for OSA6-CSC. Adskillige nyere undersøgelser har vist, at høje niveauer af ALDH aktivitet er karakteristiske for forskellige former for kræft. Denne parameter kan anvendes som en kræft stamcellemarkør og er korreleret med en dårlig prognose. Den ALDH aktivitet assay viste, at både OS-CSC linjer har høje niveauer af ALDH aktivitet (figur 22), hvorimod ALDH aktivitet blev observeret ved den nedre kvantificerbar grænse i fibroblast linje, blev anvendt som en negativ kontrol i dette assay.

figur 1
Figur 1. Eksempler på OS biopsiprøver. (A). Biopsiprøve opnået ved nåleaspiration. (B). Biopsiprøve opnået ved kirurgisk resektion af en del af tumoren.884 / 53884fig1large.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Mekanisk Opdeling af en OS Prøve. (A) En opsplitning af en prøve ved hjælp Perry pincet og en lancet. (B) Fragmenter suspenderet i CM (angivet med pilen). Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Udstyr og forbrugsartikler Nødvendigt at isolere Sarcospheres. (A). Alt det nødvendige udstyr til celle isolation. 1. En steril sprøjte med en steril membran filterholder; 2. To forskellige medier: GM ennd SCGM; 3. En steril glas Pasteur-pipette. (B) Detalje af sprøjten monteret på en støtte, med indehaveren af membranfilter. Klik her for at se en større version af dette tal.

Figur 4
Figur 4. filtreringsenhed. Adskillige komponenter behøves til at samle filtreringsenheden (A) (netto filter er angivet med pilen). Fasekontrastmikroskopi af de 40 um masker (en mesh er angivet ved pilen) i nettet filter (B). Original forstørrelse: 10X. Filtreringsenheden samles (C - D). Filtrering enhed steriliseret (E). Klik her for at se et større version af dette tal.

Figur 5
Figur 5. primære cellekulturer af konventionelle OS. Fase kontrast observation af primære cellekulturer af høj kvalitet OS. I (A), flere lyse knoglefragmenter er synlige, mens i (B), flere små afrundede og flydende erythrocytter er til stede. Original forstørrelse: 10X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 6
Figur 6. Konventionel Osteosarkom Finite cellelinier (OSA). (A) OSA5 og (B) OSA6. Observation i fasekontrast.Original forstørrelse: 10X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 7
Figur 7. Sarcosphere Assay af OSA5 og OSA6. Efter 24 timer fra starten af assayet blev cellerne flydende og isoleret fra hinanden (celler er angivet med pile). Observation i fase kontrast. Original forstørrelse:. 20X Klik her for at se en større version af dette tal.

Figur 8
Figur 8. Sarcosphere Analyse af OSA5 og OSA6 på 7 D. 7 d ind i analysen, flere små spherical kolonier omgivet af enkelte celler kunne observeres. De sarcospheres (nogle af disse sarcospheres er angivet med pile) fremgår flydende i mediet eller lidt fast ned i bunden af ​​brønden. Observation i fase kontrast. Original forstørrelse: 20X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 9
Figur 9. Sarcosphere Assay af OSA5 og OSA6 ved 28 D. Efter 28 d, er flere store rav sarcospheres observeret i hver brønd af pladerne for hver OSA cellelinie, OSA5 (A) og OSA6 (B). Bar størrelse: 100 um. Klik her for at se en større version af dette tal. </ P>

Figur 10
Figur 10. Passager til isolering af Sarcospheres trinene til isolering sarcospheres fra 6-godt ultralave vedhæftede plader og deres reculturing under vedhængende betingelser er vist (A) Alt det nødvendige udstyr til isolering..: 1. Et 6-godt ultralav plade med dannede sarcospheres i hver brønd, 2. sprøjte med filterholderen netto, 3. pipette, 4. 1000 uL sterile tips, 5. 2 sterile Perry pincet, 6. 2 forskellige kulturmedier , 7. steril Pasteur-pipette 8. petriskåle. (B) Indsamling af sarcospheres. Mediet indeholdt i hver brønd opsamles under anvendelse af en pipette med en steril 1.000 pi spids. (C) Opsaml suspensionen i sprøjten. Den opsamlede suspension overføres til sprøjten for at starte den naturlige filtrering processen ved hjælp afmembranfilter holder. (D) Naturlig filtrering. (E) Demontering membranfilter holder fra sprøjten den. Efter alle suspensionen filtreres, er filterholderen netto taget fra hinanden og sat i en petriskål; (F) Demontering holderen membranfilter. Sarcospheres er indeholdt i porerne i nettet filter i filterholderen nettet, så de skal blive befriet ved hjælp af Perry pincet. (G, H) Fjernelse af sarcospheres fra membranfilter. Klik her for at se en større version af dette tal.

Figur 11
Figur 11. Sarcosphere Isolation. Isolerede sarcospheres flyde i mediet i 60 mm petriskål. Observation i fase-kontrast.Original forstørrelse: 40X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 12
Figur 12. Sarcosphere Efter Isolation. Sarcospheres fra OSA5 (A) og OSA6 (B) cellelinjer i starten af vedhængende ekspansion efter genindførelsen og reculturing i et monolag under vedhængende forhold på 48 timer efter isolering. Observation i fase-kontrast. Original forstørrelse: 20X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 13 Figur 13. Sarcospheres på 7 D efter isolering. Sarcospheres fra OSA5 (A) og OSA6 (B) cellelinjer viste klæbende ekspansion efter genindførelsen og reculturing i et monolag under adhærente betingelser ved 7 d efter isolering. Observation i fase-kontrast. Original forstørrelse: 20X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 14
Figur 14. Immunofluorescens farvning for CD105. Immunfluorescensfarvning for CD105 i OSA-CSC linjer OSA5-CSCS (A) og OSA6-CSCS (B) og i den kontinuerlige cellelinie HCT8 (C), der blev anvendt som en negativ kontrol. LSCM i konventionel farve: Grøn for CD105 og rød for cytoskelet. Original forstørrelse: 10X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 15
Figur 15. Immunofluorescens farvning for CD44. Immunofluorescens farvning for CD44 i OSA-CSC linjer OSA5-CSCS (A) og OSA6-CSCS (B) og i den kontinuerlige cellelinie HCT8 (C), der blev anvendt som en negativ kontrol. LSCM i konventionelle farver: grøn for CD44 og rød for cytoskelet. Original forstørrelse: 10X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.


Figur 16. Immunofluorescens-farvning af Stro1. Immunfluorescensfarvning for Stro-1 i OSA-CSC linjer OSA5-CSCS (A) og OSA6-CSCS (B) og i den kontinuerlige cellelinie HCT8 (C), som blev anvendt som en negativ kontrol. LSCM i konventionelle farver: grøn for Stro-1 og rød for cytoskelet. Original forstørrelse: 10X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 17
Figur 17. Ekspression af Nuclear ESC markører og af CD133-genet. RT-PCR, som viser ekspressionen af Nanog, okt 3/4, Sox2 og CD133 i OSA5-CSCS (A) og i OSA6-CSCS ( Klik her for at se en større version af dette tal.

Figur 18
Figur 18. Osteogen Differentiation Assay -. ALP Osteogen differentiering ved 0 d (A, B) og efter 10 d (C, D) på induktion som bestemt ved cytokemisk farvning for ALP hjælp Fast Blue BB. I blå, ALP + celler; i rødt, kernen modfarvet med propidiumiodid. Composite observation i lysfelt og i fluorescens. Original forstørrelse: 20X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 19 Figur 19. Osteogen Differentiation Assay -. HA Osteogen differentiering ved 0 d (A, B) og efter 20 d (C, D) på induktion som bestemt ved cytokemisk farvning for hydroxyapatit (HA) med alizarinrødt S. Cellerne kontrasteres i blå / grå, og den grynede aflejringer af HA farves rødt. Observation i fase kontrast. Original forstørrelse: 40X. Bar størrelse:. 100 um Klik her for at se en større version af dette tal.

Figur 20
Figur 20. adipogenisk differentiering Assay. Adipogenisk differentiering ved 0 d (A, B) og efter 14 d (C, D) på induktion som bestemt ved cytochemical farvning med Oil Red O. I rød, lipid-vesikler (de større vesikler er angivet med de sorte / røde pile, de mindre vesikler er angivet med de hvide / sorte pile); i blå / violet, kernerne modfarvet med hæmatoxylin. Observation i lysfelt. Original forstørrelse: 40X. Bar størrelse:. 100 pM Klik her for at se en større version af dette tal.

Figur 21
Figur 21. CFU-analysen. CFU assay af OSA-CSC linjer farvet med toluidinblåt. Klik her for at se en større version af dette tal.

Figur 22 /> Figur 22. ALDH Activity analysen. Det ALDH kolorimetrisk analyse opdaget høje niveauer af ALDH aktivitet i de to OS-CSC linjer, OSA5-CSCS og OSA6-CSCS, mens analysen påviste fraværet af denne aktivitet i det endelige differentierede cellelinie af fibroblaster, FIB. Fejllinjer: SD. **: P <0,001 vs. FIB; *:. P <0,01 vs FIB Klik her for at se en større version af dette tal.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
Gene Oligonukleotider Sekvens (5¹-3¹) Amplikonstørrelse (bp) Tₐ (° C)
Nanog Fremadrettet primer Reverse primer 87 60
oktober 3/2 Fremadrettet primer Reverse primer GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 Fremadrettet primer Reverse primer TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 Fremadrettet primer Reverse primer CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp, basepar af amplikonstørrelse; Tₐ, annealingtemperatur

Tabel 1. Detaljeret Liste over primersekvenser for Nanog, okt 3/4, Sox2 og CD133 med amplikonstørrelse og Annealing Temperatur

Discussion

CSCS har flere egenskaber, der gør det muligt at identificere denne særlige cellulære delmængde i tumoren bulk. På grundlag af disse karakteristika, såsom erhvervet resistens over for cytotoksisk kemoterapi midler til overekspression af ATP-bindende kassette multidrug effluxtransportører 28, 32, 33, eller for opregulering af ekspressionen af afgiftning enzymer, såsom ALDH 32, til ekspression af en bestemt overflademarkør, såsom CD133, CD44, CD34, CD90, og andre 30, 34, 35, 41, flere forskellige metoder til isolering CSCS er blevet udviklet 42-44. En af disse teknikker er sfæren formation assay som er baseret på evne CSCS til at vokse under ikke-adhærente betingelser.

Evnen af væv stamceller og CSCS at danne sfærer blev først beskrevet i undersøgelser til kortlægning af neurale stamceller ved Reynolds et al. 37. Efterfølgende Gibbs et al. 38 osed disse undersøgelser for at begynde at isolere CSCS fra solide tumorer, især fra knogle sarkomer. Vi har besluttet at bruge kuglen dannelse assay metode illustreret af Gibbs et al. At isolere CSCS fra OSA cellelinjer skabt på grundlag konventionelle OS biopsier. Vi tilpasset den oprindelige metode til at forbedre resultaterne af dette assay og for at lette dens reproducerbarhed for andre cancercellelinjer. Med henvisning til oprettelsen af ​​kuglen dannelse assay, vi kontrolleret, at plating 40.000 celler / brønd er en god praksis for at opretholde celler i isolation i begyndelsen af ​​analysen. Dette trick er meget vigtigt at undgå muligheden for, at de sfæriske kolonier stammer fra cellulær aggregering og ikke fra den særlige og eksklusive kapacitet af en enkelt CSC til at vokse under ikke-adhærente betingelser og danne en sfærisk koloni. Denne evne er en særlig kritisk punkt i dette assay.

Vi certificeret også, at for at opnå en god sats af kugle-dannelseEr det tilstrækkeligt at opdatere portioner af vækstfaktorer hver 3 d og ikke hver dag som beskrevet i den oprindelige fremgangsmåde. I denne undersøgelse har vi også etableret og beskrevet udførligt en god metode til isolering af de sfæriske kolonier, der dannede ved dyrkning under ikke-adhærente betingelser. Dette trin er kritisk i dette assay, fordi det er meget vigtigt at forsøge at isolere så mange af kuglerne som muligt, der er dannet i hver brønd uden at beskadige dem. Det er også vigtigt at isolere kun kugler og ikke de enkelte celler, som kunne forblive i suspension for varigheden af ​​assayet. For at overvinde disse kritiske punkter, har vi udviklet et særligt isolation metode, der, som vist ovenfor, gav gode resultater for CSC isolation. Der er naturligvis mulighed for, at ikke alle de kugler, der dannede kan udvindes, men tabet i procent er meget lav. Faktisk har vi også mulighed for at bruge et filter med 40 um porer at isolere kugler efter de bliver store (formulared ca. 100 - 200 blodlegemer).

Denne isolation stopper sfære formation men tillader de enkelte celler, en del af methylcellulose resten, og de mindste kugler, der skal filtreres. Denne eliminering er udført af grundig filtrering som beskrevet i protokollen.

Endvidere udvælgelsen af ​​de største sfæriske kolonier gennem de 40 um mesh med deraf følgende tab af de mindste sfæriske kolonier gør det muligt at vælge de CSCS med den højeste kapacitet til at danne sfæriske kolonier og med større stemness. Alle disse ændringer blev udført for at forbedre analysen og at hjælpe forskere studerer CSCS at forstå og gengive det mest kritiske trin i den oprindelige metode af kuglen dannelse analysen.

Blandt de undersøgelser vedrørende in vitro-metoder til isolering CSCS, denne undersøgelse havde til formål at vise, hvordan denne tilpasset sfære dannelse assay kunne være en god fremgangsmåde til isolering CSCS fraOSA cellelinier. Tilpasningerne til den oprindelige metode og den detaljerede isolation teknikken beskrevet forbedre dens effektivitet. I en kort tid, kan der opnås og anvendes til flere eksperimenter god antallet af CSCS. Derfor er det muligt hurtigt bekræfte stamceller-lignende fænotyper og navnlig, at studere den dobbelte stilk-lignende fænotype der kendetegner OS-CSCS. Således kunne denne modificerede assay være en god teknik til isolering af CSCS og studere deres biologi. I fremtiden, denne metode, med yderligere tilpasninger, kan også anvendes til at isolere CSCS fra andre finite cancercellelinier opnået ved biopsier af sjældne faste tumorer.

Muligheden for at isolere CSCS fra sjældne solide tumorer, såsom OS, ikke kun tillader en forbedring af undersøgelser om denne særlige kræft, men også omfatter undersøgelser af forskellige former for kræft at udvikle bedre metoder til deres isolation og til fremtidige undersøgelser af biologi denne vigtige cellulære delmængde. Derfor, som vihar gjort i denne undersøgelse, er det vigtigt at forbedre metoderne til CSC isolation gennem studiet af CSC biologi, med det endelige mål at finde molekylære mål og udvikle en meget specifik anticancer terapi rettet mod netop denne cellulære delmængde, der er sandsynligvis ansvarlig for opretholdelse af den primære tumor, udvikling af gentagelse, og oprindelsen af ​​metastaser i flere organer. Studiet af CSC biologi er også vigtigt for at finde behandlinger, som kunne være skarp i helbredelse af kræftformer, såsom OS, for hvilke overlevelsesraten efter neoadjuverende behandling forbliver meget dårlig.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics