Oprichting van Cancer Stem Cell Cultures van Human Conventionele Osteosarcoom

Cancer Research
 

Summary

De aanwezigheid van kanker stamcellen (CSC) in bot sarcomen Onlangs is gekoppeld aan de pathogenese. In dit artikel presenteren we de isolatie van CSCs van primaire celculturen verkregen uit humane biopten van conventionele osteosarcoom (OS) met de mogelijkheid van CSCs groeien onder hechtende omstandigheden.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De huidige verbeteringen in de therapie tegen osteosarcoom (OS) hebben het leven van kankerpatiënten verlengd, maar de overlevingskans van vijf jaar nog steeds slecht toen metastase heeft plaatsgevonden. De Stem Cancer Cell (CSC) theorie stelt dat er een subset van tumorcellen binnen de tumor die stam-achtige eigenschappen, waaronder het vermogen om de tumor te handhaven en multidrug chemotherapie weerstaan. Daarom is een beter begrip van OS biologie en pathogenese nodig om vooraf de ontwikkeling van therapieën gericht deze bepaalde subset roeien en morbiditeit en mortaliteit bij patiënten. Isoleren CSCs, tot oprichting van celculturen van CSCs, en de studie van de biologie zijn belangrijke stappen gezet om het verbeteren van onze kennis van OS biologie en pathogenese. De oprichting van mensen afgeleide OS-CSCs van biopten van OS wordt mogelijk gemaakt met behulp van verschillende methoden, waaronder het vermogen om 3-dimensionale stamcelkweken onder nonadhere creërennt omstandigheden. Onder deze omstandigheden, CSC kunnen sferische drijvende kolonies gevormd door de dochter stamcellen; deze kolonies worden "cellulaire sferen '. We beschrijven een werkwijze om CSC culturen van primaire celculturen conventionele OS OS verkregen uit biopsieën stellen. We hebben duidelijk een beschrijving van de verschillende passages die nodig is om te isoleren en te karakteriseren CSCs.

Introduction

Sarcomen zijn een heterogene groep van zeldzame kwaadaardige bindweefsel tumoren afkomstig voornamelijk uit de embryonale mesoderm 1. De verschillende typen zijn bot sarcomen en weke delen sarcomen. Bot sarcomen, een groep relatief weinig primaire tumoren, uit meerdere subtypen, waaronder osteosarcoom (OS). OS, een van de meest voorkomende primaire tumoren van het bot, is een mesenchymale maligniteit die uitgebreide klinische, histologische en moleculaire heterogeniteit 2, 3 vertoont. Helaas OS voornamelijk voorkomt bij kinderen en jongvolwassenen 4, 5 en vertegenwoordigt 60% van de de gemeenschappelijke histologische subtypes been sarcoom bij kinderen 6, 7. OS tast gewoonlijk de skelet gebieden, die worden gekenmerkt door snelle botgroei (bijvoorbeeld de metafyse van lange botten). Onder de histologisch verschillende subtypes van OS, conventionele OS, ook wel medullaire of centrale OS, heeft een hoge graad van maligniteit en een quotum share van 80% 8. Deze 80% is samengesteld uit 60% conventionele osteoblastische OS, 10% chondroblastair OS en 10% fibroblastische OS 6, 8-10. Andere OS subtypen behoren anaplastisch, telangiectatic, giant cell-rijk en kleincellige OS. Ondanks de vooruitgang in de gecombineerde operatie en chemotherapie in OS beheer, de uitkomst blijft slecht, met een lange-termijn overleving van 65-70% bij patiënten zonder metastase 11, 12. Distant recidieven vaak voorkomen als longmetastasen of, minder vaak, zoals metastasen naar verre botten en lokaal recidief 13. Metastasen vaak resistent tegen conventionele behandelingen. Deze weerstand is de reden waarom de 10-jaar ziektevrije overleving is ongeveer 30% bij patiënten met metastasen bij diagnose 14, 15.

Zoals bij normale weefsel wordt kankerweefsel uit een heterogene verzameling van celsoorten. Cellen in de tumor lijkt overeen te komen met de verschillende stadia van ontwikkeling. Binnen elke normale weefsel bevindt een subpopulatie van cellen met het vermogen om selfrenew, waardoor voorlopercellen en rijpe cellen voor weefsel homeostase. Evenzo wordt kanker uit een soortgelijke heterogene populatie van cellen in verschillende stadia van ontwikkeling, met een verschillende mate van proliferatie en tumorigene potentieel. Een subset van deze kankercellen, genoemd Kanker stamcellen (CSC), vormt een reservoir van selfsustaining cellen met de exclusieve mogelijkheid selfrenew en onderhouden van de maligne potentie van tumoren, waardoor het genereren van de verschillende cellijnen die de tumorbulk 16 vormen. In de jaren 1990, studies over acute myeloïde leukemie op voorwaarde dat de eerste overtuigend bewijs voor het bestaan van CSC subpopulaties 17, 18. CSCs zijn inmiddels geïsoleerd uit een groot aantal vaste tumoren 19, waardoor steeds een van de meest onderzochte onderwerpen in het kankeronderzoek. CSCs inderdaad het gevolg zijn van normale stamcellen door mutaties in genen die normaal makenstamcellen kankerachtige 20-23. Meerdere transformeren mutaties en interacties met de micro-omgeving kan ook bijdragen tot een gezonde voorlopers en volgroeide cellen verwerven van de selfrenewal capaciteit en onsterfelijkheid die CSCs typeren. Er zijn verschillende hypothesen over deze transformatie. Gezond voorlopers, gezonde volwassen cellen en kankercellen, kan dedifferentiate naar stamcellen, het verkrijgen van een stam-achtige fenotype door het activeren-selfrenewal geassocieerde genen 24-28. Ondanks verscheidene recente studies, de oorsprong van CSCs nog om ontdekt te worden.

Een bijzonder kenmerk van CSC is dat hun vermogen om de multi-therapie benadering waarbij Gecombineerd chirurgie en chemotherapie met verschillende drugs weerstaan. Recente studies hebben aangetoond dat CSCs ook resistentie kan verwerven om chemotherapie cytotoxische. Mogelijke verklaringen voor deze weerstand onder de overexpressie van ATP-bindende cassette (ABC) multidrug transporter (dat wil zeggen,MDR1 en BCRP1), overexpressie van chemotherapie metaboliserende enzymen zoals aldehyde dehydrogenase 1 (ALDH1) en / of veranderingen in celcycluskinetiek 30-33. Het directe gevolg van al deze concepten die tot nu toe zijn beschreven, is dat een kankertherapie efficiënt zou zijn alleen als de CSC subpopulatie volledig werden uitgeschakeld, terwijl de lokale recidief of metastasen op afstand kunnen optreden als zelfs een enkel CSC overleefd.

De ontdekking van CSCs in menselijke sarcomen 34, met name besturingssysteem 35, of anderszins bot en zacht weefsel kanker, heeft groot klinisch belang omdat het een mogelijke verklaring waarom veel behandelingen lijken aanvankelijk effectief, maar de patiënten later terugval. Daarom is de hoop voor de toekomst bestrijding conventionele OS is nieuwe en specifieke gerichte therapieën te vinden gebaseerd op de ontwikkeling van innovatieve geneesmiddelen gericht op OS-CSCs dankzij de moleculaire karakterisering van deze subbevolking en de studie van CSC biologie.

In 1992, Reynolds en collega's, die zijn onderzocht of een subset van stamcellen in de hersenen aanwezig volwassen zoogdieren was, ontwikkelde een methode om cellen vermoedelijk stamcellen-achtige cellen 36, 37 te isoleren. Deze methode is gebaseerd op het specifieke vermogen van deze cellen bolvormige kolonies vormen wanneer gekweekt onder omstandigheden hechtende. Soortgelijke technieken in dienst waren van Gibbs en zijn collega's in 2005 tot een subpopulatie van stamcellen-achtige cellen in het bot sarcomen 38 bestuderen. Isoleren en karakteriseren OS-CSCs uit primaire celkweken van verschillende soorten conventionele OS, besloten we om deze techniek OS cellijnen passen.

We beschrijven hier de aangepaste methode van de bol vorming assay, aangeduid als "sarcosphere assay", die kan worden gebruikt voor het isoleren OS-CSCs van eindige primaire cellijnen afgeleid uit humane biopten van conventionele OS. We beschrijven ook alle technieken die used de steel-achtige CSC fenotype van cellijnen geïsoleerd door deze te valideren: 1) evaluatie van de expressie van genen die pluripotente embryonale stamcellen (SER detecteren) en de CD133-gen, dat een merker van CSCs; 2) kolonievormende eenheid (CFU) test; 3) evaluatie van het vermogen van deze cellen om te differentiëren tot osteoblasten en differentiatie adipocyten onder geschikte omstandigheden; 4) studie van het oppervlak markers van mesenchymale stamcellen (MSC) (dat wil zeggen, CD44, CD105 en Stro-1) door immunofluorescentie kleuring en door flowcytometrische analyse; 5) evaluatie van de ALDH activiteit van deze cellen.

Protocol

Alle experimenten waarbij menselijke weefsels hierin beschreven werd goedgekeurd door de lokale ethische commissie (Rif. N. 141/12). Informed consent voor het verzamelen van weefselmonsters en voor het gebruik en de opslag van de monsters werd verkregen van de donors op AOUC.

1. Voorbereiding van Cultuur

  1. Bereid groei kweekmedium (GM) door toevoeging van 10% foetaal runderserum (FBS), 100 IE / ml penicilline en 100 ug / ml streptomycine Coon's gemodificeerd Ham's F12 medium. Filter en steriliseer GM met behulp van een 0,22 pm filter. Store GM tot 1 maand bij 4 ° C.
  2. Bereid collagenase medium (CM) door toevoeging van 20% FBS, 100 IU / ml penicilline, 100 ug / ml streptomycine en 3 mg / ml collagenase type II Coon's gemodificeerd Ham's F12 medium. Filter steriliseren CM behulp van een 0,22 pm filter. WINKEL CM tot 1 maand bij -20 ° C.
  3. Bereid medium voor cellulaire invriezen (FM) door toevoeging van 40% FBS, 100 IU / ml penicilline, 100 ug / ml streptomycine en 60,5% dimethylsulfoxide (DMSO) naar Coon's gemodificeerd Ham's F12 medium. Filter en steriliseren FM gebruik van een 0,22 urn filter. WINKEL FM tot 1 maand bij 4 ° C.
  4. Bereid medium voor CFU assay (CFUM) door toevoeging van 20% FBS, 100 IU / ml penicilline en 100 ug / ml streptomycine Coon's gemodificeerd Ham's F12 medium. Filter en steriliseren CFUM gebruik van een 0,22 urn filter. Store CFUM tot 1 maand bij 4 ° C.
  5. Bereid door oplossen trypsine 400 mg trypsine, 200 mg EDTA en 1000 mg D (+) - glucose watervrije in 1000 ml Dulbecco's fosfaat-gebufferde zoutoplossing (DPBS) zonder Ca2 + en Mg2 +.
    OPMERKING: Verdeel verse trypsine-EDTA in 50 ml porties in 25 cm2 flessen met behulp van een 0,22 um filter en bevriezen bij -20 ° C maximaal 3 maanden. WINKEL ontdooid filter gesteriliseerde monsters bij 4 ° C zonder verlies van activiteit.
  6. Bereid stamcellen kweekmedium (SCGM) door toevoeging van 10% FBS, 100 IU / ml penicilline, 100 ug / ml streptomycin, en 10 ng / ml bFGF (25 ug / ml voorraad) te Coon's gemodificeerd Ham's F12 medium. Filtreer SCGM met een 0,22 urn filter en opslag SCGM maximaal 2 weken bij 4 ° C.
  7. Bereid 2% methylcellulose (MC) door oplossen MC in ultrapuur H 2 O bij 4 ° C gedurende 3 dagen. Wanneer MC volledig is opgelost, autoclaveren en te bewaren bij 4 ° C.
    NB: Na MC wordt gesteriliseerd, het stevig wordt. MC naar een vloeibare toestand, opslag brengen bij 4 ° C.
  8. Bereid sarcosphere groeimedium (SGM). Bereid dit middellange vers (niet langer dan 2 weken voor gebruik) door toevoeging van 100 IU / ml penicilline, 100 ug / ml menselijk bFGF (25 ug / ml stock), 20 nM progesteron (10 pM voorraad), 100 uM putrescine, 30 nM natriumseleniet (30 uM voorraad), 25 ug / ml transferrine (25 mg / ml voorraad), 20 ug / ml insuline (20 mg / ml voorraad) en 10 ng / mL humaan EGF (10 ug / ml voorraad) te 2X Coon's gemodificeerd Ham's F12 medium. Filter en steriliseer SGM met behulp van een 0,22 pm filter. Op te slaan voor maximaal 2 weken bij 4 ° C.
  9. Bereid osteogene medium (OM) door toevoeging van 10% FBS (Zuid-Amerikaanse oorsprong), 100 IU / ml penicilline, 100 ug / ml streptomycine, 10 nM dexamethason (100 pM voorraad), 0,2 mM natrium-L-ascorbinezuur-2-fosfaat (1 M voorraad), 10 mM β-glycerofosfaat (5 mg / ml voorraad) en 1 ug / ml calceïne (200 ug / ml voorraad) te Coon's gemodificeerd Ham's F12 medium. Filter en steriliseren OM met een 0,22 urn filter. Bewaren bij 4 ° C.
    LET OP: Bewaren dexamethason voorraad oplossingen onder vloeibare stikstof om hun activiteit. Vers bereid OM elke 2 weken de activiteit van dexamethason om de differentiatie potentieel van het medium te handhaven handhaven.
  10. Bereid erytrocyten lysisbuffer (ELB) door het oplossen van 1,66 mg NH 4 Cl, 0,2 mg K 2 HPO 4 en 0,007 mg EDTA in 200 ml gedestilleerd water (dH 2 O). Filter en steriliseer ELB met behulp van een 0,22 pm filter. Bewaren bij 4 °C.
  11. Bereid adipogenic medium (AM) door toevoeging van 10% FBS (Zuid Amerika oorsprong), 100 IU / ml penicilline, 100 ug / ml streptomycine, 1 uM dexamethason (1 mM voorraadoplossing), 1 uM runder insuline (10 mM voorraadoplossing), 0,5 mM isobutylmethylxanthine (IBMX) (500 mM voorraad), en 100 uM indomethacine (200 mm) tot Coon's gemodificeerd Ham's F12 medium. Filter en steriliseer AM gebruik van een 0,22 pm filter. Bewaren bij 4 ° C.
    LET OP: Bewaren dexamethason voorraad oplossingen onder vloeibare stikstof om hun activiteit. Vers bereid AM elke 2 weken de activiteit van dexamethason om de differentiatie potentieel van het medium te handhaven handhaven.
  12. Bereid 2% runderserumalbumine (BSA) in DPBS (BSA / DPBS). Los 10 g BSA in 500 ml DPBS en de voorbereiding van de voorraad oplossing aliquotting 50 ml stock-oplossing in 50 ml conische buizen. Bewaar bij -20 ° C.
  13. Bereid een oplossing van 4% paraformaldehyde (PFA) in DPBS (PFA / DPBS). In eeemical kap, verdunnen paraformaldehyde in DPBS en de voorbereiding van de voorraad oplossing aliquotting 50 ml stock-oplossing in 50 ml conische buizen. Bewaren bij 4 ° C.

2. Vaststelling van primaire OS celculturen en OS eindige cellijnen (OSA)

LET OP: Primaire OS celkweken werden bereid uit verse monsters van conventionele OS biopten verzameld op de "Unità Ortopedia Oncologica e Ricostruttiva", AOUC Careggi, Florence. Alle biopsieën die werden verkregen door punctie of chirurgische resectie van een klein deel van de tumor (Figuur 1A, B), werden onmiddellijk geplaatst in kweekmedium aangevuld met 100 IU / ml penicilline en 100 ug / ml streptomycine (pH 7,4) en vervoerd naar het laboratorium ze werden verwerkt. Alle beschreven bewerkingen werden uitgevoerd onder aseptische condities met een laminaire stroming kap.

  1. Isolatie van OS cellen
    1. Plaats de biopsie in een100 mm petrischaal met een klein volume GM. Met een steriel lancet en Perry pincet, gehakt OS weefselmonsters door te snijden in stukjes zo klein mogelijk (0,5-1 mm) (Figuur 2A, B).
    2. Bedek de weefselfragmenten met 10 ml CM voor de enzymatische digestie (Figuur 2B) en incubeer gedurende 3 uur in een 37 ° C, 5% CO2 incubator. Verwijder de suspensie van fragmenten met een pipet overgebracht naar een 15 ml conische buis voor onmiddellijke centrifugatie (400 xg gedurende 5 minuten) om de fragmenten te pelleteren.
      OPMERKING: Na centrifugeren indien de biopten zijn rijk aan erytrocyten, een rode aanslag uit erytrocyten te zien via fragmenten. Daarom wordt, alvorens over te gaan tot de mechanische dispersie, behandelen van het monster met erytrocyten lysisbuffer. Verwijder de bovenstaande vloeistof door aspiratie en voeg 5 ml ELB.
    3. Schorsen pellet fragmenten gedurende 1 minuut en centrifuge de suspensie bij 400 g gedurende 2min. Verwijder het supernatant door afzuigen. Voeg 5 ml GM en mechanisch verspreiden de fragmenten met behulp van een 10 ml serologische pipet (opening grootte, 1,5 mm interne Ø) 10 - 20 keer.
    4. Centrifugeer de suspensie bij 400 xg gedurende 5 minuten. Verwijder de bovenstaande vloeistof door aspiratie, schorten de cel pellet met 10 ml GM, en vervolgens over de resulterende celsuspensie in een 100 mm petrischaal. Incubeer de petrischaal in een 37 ° C, 5% CO2 incubator en vervang de GM verse volledige GM elke 3 d.
      OPMERKING: Vaak OS weefselmonsters verkregen punctie zijn zeer klein en botfragmenten bevatten, die niet worden verteerd door enzymatische digestie met collagenase. Dus na het supernatant is verwijderd, trachten cellen van botweefsel scheiden door stampen pellet fragmenten met een pipet.
  2. Subcultuur
    OPMERKING:
    Om een OSA vast te stellen, wanneer de cellen bij benadering samenvloeiing bereiken, verwijder ze uit their kweekvat, te verdunnen, en plaats in een frisse plaat om verdere groei mogelijk te maken. Deze subcultuur procedure wordt bereikt door enzymatische procedure genoemd trypsine.
    1. Verwijder het medium door afzuigen. Om de cel monolaag distantiëren, voeg 2-3 ml trypsine bij kamertemperatuur (max 18-20 ° C), schud voorzichtig een keer, en verwijder de trypsine onmiddellijk gevolgd door aspiratie. Herhaal dit twee keer. Incubeer de cellen bij 37 ° C gedurende 3-4 min tot ze beginnen te los.
      LET OP: Goed trypsine kan worden gezien door de ervaren gebruiker als kleine gaatjes vormen in het licht ondoorzichtige monolaag wanneer de schotel wordt tegen het licht gehouden. Deze dissociatie kan ook worden gecontroleerd met behulp van een omgekeerde microscoop; Deze aanpak wordt aanbevolen voor beginners.
    2. Stop de reactie door toevoeging van trypsine 10 ml GM en was de schaal en met een pipet om de cellen los. Breng 1 ml van de suspensie tot een nieuwe 100 mm petrischaal en voeg 9 ml GM (1/10 splitsing van cellen).
      NOTITIE:
  3. Cryopreservatie van OS primaire kweken en OSA
    LET OP: Freeze een samenvloeiing 100 mm petrischaal in 4-5 cryovials. Het proces van cryopreservatie dient snel uitgevoerd aangezien DMSO, die celmembranen beschermt tijdens het vriezen, is giftig voor cellen bij niet- vriestemperaturen.
    1. Distantiëren celkweken van de monolaag door behandeling met trypsine (zie paragraaf 2.2), pellet cellen door centrifugatie bij 400 xg gedurende 5 minuten, verwijder het supernatant door afzuigen en vervolgens snel schorten de celpellet in FM.
    2. Aliquot 1 ml van deze opschorting per cryogene flacon. Onmiddellijk in zijn gevulde flesjes in een vrieskist van een mantel van 2-propanol en store immediadellijk bij -80 ° CO / N. Overdracht cryovials vloeibare stikstof de volgende dag voor langdurige opslag.
  4. Ontdooi OS cellijnen en primaire culturen
    1. Ontdooiing OS cellijnen uit vloeibare stikstof opslag, snel ontdooien cryovials door ze in een laboratorium waterbad bij 37 ° C. Breng de inhoud van de cryovials in een 15 ml conische buis en voeg ongeveer 10 ml van GM (zie hoofdstuk 2,3 tot DMSO te verwijderen). Verwijder de bovenstaande vloeistof door aspiratie en schorten de cel pellet in 10 ml GM. Plaat de celsuspensie in een 100 mm petrischaal en incubeer op 37 ° C, 5% CO2 incubator.

3. Sarcosphere Assay te isoleren OS-CSCs

LET OP: Dit experiment wordt uitgevoerd op OSA. De duur van dit experiment heeft betrekking op het vermogen van de cellen om deze bol kolonies (sarcospheres) te vormen, en het tijdsbereik is 7, 14, 21, en 28 d.

  1. Estabstelling van sarcosphere assay
    1. Bereid de hemocytometer kamer en alle reagentia op voorhand.
    2. Verwijder het medium door aspiratie en distantiëren van de cellen van de monolaag door behandeling met trypsine (zie paragraaf 2.2). Meng de celsuspensie grondig, pipetteren om eventuele klonten verspreiden, en het verzamelen van 10 pi met behulp van een 20 pi pipet tip.
    3. Breng de 10 pi celsuspensie onmiddellijk naar de hemocytometer kamer rand, verdrijven de schorsing, en laat het onder de dekglaasje door capillaire werking worden getrokken.
    4. Let op de hemocytometer kamer onder fase contrast. Selecteer een 10X objectief en focus op de rasterlijnen in de kamer. Tel de cellen liggen in deze 1 mm 2-gebied met behulp van de deelsectoren (ook gebonden aan drie parallelle lijnen) en single rasterlijnen als hulpmiddel voor het tellen.
    5. Meet de concentratie en breng de volgende vergelijking: 1 ml = n * 10 4 / z (n: geheel aantal cellen in alle geteldevierkanten 1 mm 2; z: het aantal getelde vierkantjes 1 mm 2). Bereken het volume van de celsuspensie moet in totaal 240.000 cellen verdeeld in 40.000 cellen per putje in 6-well ultralage bevestigingsplaat plaat.
      LET OP: Zorg ervoor dat u het juiste aantal cellen plaat door uitplating cellen in een extra goed. Daarom is de totale hoeveelheid cellen worden uitgeplaat is 280.000 cellen.
    6. Bereid 35 ml BSS door toevoeging van 50% van 2% MC (SGM-MC) in een 25 cm2 kolf. Bereid de totale omvang van de SGM overweegt 5 ml extra om een ​​extra goed plaat.
    7. Voeg het berekende volume van de celsuspensie aan de SGM-MC bereid in de kolf en meng voorzichtig met een pipet om eventuele klonten te dispergeren. Plate de cellen in een 6-well ultra-lage bevestigingsplaat en het gebruik van een omgekeerde microscoop om te zien hoe de cellen verschijnen nadat een vergulde.
    8. Incubeer de cellen in een 37 ° C, 5% CO2 incubator. Elke 3 d, toevoegen frvruchtvlees aliquots van bFGF en EGF aan elk putje om de concentratie van groeifactoren vernieuwen. Voeg 2 ul bFGF en EGF 5 ul zowel handhaven op de uiteindelijke concentratie van 10 ng / ml in elk putje.
  2. Isolatie van sarcospheres
    OPMERKING: Controleer het goede verloop van de sarcosphere assay op 7, 14, 21 en 28 d te bepalen wanneer het nodig is om de sarcospheres die gevormd isoleren.
    1. Bereid alle reagentia en apparatuur in de laminaire stroming kap (figuur 3A, B). Monteer de filtratie-eenheid door het plaatsen van een netto-filter met een diameter van 25 mm en een 40 um maas in een membraan filterhouder; steriliseren in de autoclaaf (Figuur 4A-E).
    2. Voor elk putje, dragen de informatiedrager de sarcospheres een spuit met een steriel membraanfilter houder met een steriele pipet met 1000 pi tip. Na het volledig verwijderen van het medium dat het sarcospheres, was de put naar adding 5 ml GM om zeker te zijn alle sferen te dragen aan een spuit. Gebruik de microscoop om te bevestigen of alle sarcospheres zijn teruggevonden. Indien niet, gaat door deze stap te herhalen.
    3. Filtreer de suspensie met een membraanfilter houder alleen door de zwaartekracht zonder druk om beschadiging van de bolletjes en met sarcospheres dwars door het filter, waardoor het verlies van bolletjes vermijden vermijden. Verwijder luchtbellen door voorzichtig met een steriele glazen Pasteur pipet.
      Opmerking: soms de filtratie wordt geblokkeerd door de aanwezigheid van een luchtbel in het membraan filterhouder.
    4. Was de filtratie-eenheid door het toevoegen van 10 ml GM om de spuit en ze te laten filteren zonder druk om zeker te zijn van de afzonderlijke cellen te elimineren. Uit elkaar halen van de filter unit uit de spuit en zet het in een petrischaal.
    5. Verwijder de netto-filter uit het membraan filterhouder met behulp van Perry pincet en wassen met het zachtjes schudden met de pincet in een 60 mmPetrischaaltje de sarcospheres bevrijden van de wirwar van het membraan. Dan, plaats het membraan in een goed en bevestig door microscopische waarneming dat er geen gebieden meer verstrikt in het membraan. Als bollen nog in het membraan worden verward, verder met nog een was zoals beschreven in stap 3.2.4.
    6. Let op de vrijgegeven sarcospheres behulp van een microscoop. Incubeer de vrijgegeven sarcospheres in een 37 ° C, 5% CO2 incubator. Herhaal alle stappen voor elk putje van een 6-well ultra-lage bevestigingsplaat.

4. OS-CSC Lines

LET OP: OS-CSCs worden verkregen uit de sarcospheres dat aanhangend expansie door de herinvoering en reculturing deze cellen in een monolaag nadat ze zijn uitgezet in kleine 60 mm petrischaaltjes niet meer onder ultra-lage attachment vertonen.

  1. OS-CSC culturen
    1. Om verdere groei, subcultuur de cellen in te schakelen wanneer ze ongeveer 90% samenvloeiing bereiken in een 60mm petrischaal. Herhaal stap 2.2.1 om OS-CSC culturen vast te stellen.
    2. Stop trypsine door toevoeging van 4 ml SCGM en was de schaal goed, met een pipet om de cellen los. Breng de celsuspensie om een ​​nieuwe 100 mm petrischaal en voeg 6 ml SCGM. Bij OS-CSCs bereiken 90% samenvloeiing, subcultuur door het herhalen van paragraaf 2.2.
      Opmerking: Voor in vitro analyse om de stamcel fenotype van geïsoleerde OS-CSCs karakteriseren, kunnen cellen worden uitgeplaat in verschillende platen.
    3. Behoud van de gevestigde OS-CSC lijnen door cryopreservatie (herhaal alle stappen van paragraaf 2.3). Ontdooi de gecryopreserveerde OS-CSCs door het herhalen van alle stappen van paragraaf 2.4.

5. In vitro bestudeert de analyse te karakteriseren OS-CSC:

  1. Bereiding van cellen voor immunofluorescentie
    OPMERKING: Cellen worden gefixeerd in paraformaldehyde wanneer ze de juiste graad van confluentie bereiken in elk putje van een 24 putjes plate. De graad van samenvloeiing houdt verband met het type experimenten.
    1. Plaat OS-CSC in een 24-wells plaat aan het oppervlak Mesenchymale stamcellen (MSC) markers bestuderen door immunofluorescentie. Fix cellen in elk putje toen ze 50 te bereiken - 60% samenvloeiing. Verwijder de SCGM door afzuiging en tweemaal wassen in DPBS een 24-wells plaat.
    2. Onder een chemische motorkap, voeg 500 ul 4% PFA / DPBS aan elk putje. Incubeer bij kamertemperatuur gedurende 10 min. Verwijder de PFA / DPBS en was 3x met ultrapuur dH 2 O. Laat de 24-putjes plaat te drogen in de zuurkast.
  2. Immunofluorescentie MSC merkers
    OPMERKING: Immunofluorescentiekleuring van de OS-CSC gefixeerd in 4% PFA / DPBS kan worden gebruikt om de MSC-achtige fenotype van OS-CSCs behulp van antilichamen gericht tegen CD44, Stro-1 en CD105 onderzoeken. De volgende methode wordt routinematig gebruikt door de auteurs.
    1. In een chemische kap, permeabilize cellen die in 4% PFA / DPBS zijn vastgesteld door het toevoegen van 500 pi 0,2% Triton X-100 / DPBS aan elk putje. Incubeer de cellen bij 37 ° C gedurende 30 minuten. Voorzichtig wassen van de cellen 3x met DPBS. Voeg 300 ul RNase verdund 1/1000 met 2% BSA / DPBS om de cellen en incubeer bij 37 ° C gedurende 30 minuten.
    2. Voorzichtig wassen van de cellen 3x met 2% BSA / DPBS. Vlekken op de cellen gedurende MSC markers. Voeg het primaire antilichaam alleen gekozen als positieve controle voor elk antilichaam putjes.
      1. 300 add ul anti-CD105 1/10 verdund met 2% BSA / DPBS, 300 pl anti-CD44 1/10 verdund met 2% BSA / DPBS, 300 gl anti-Stro-1 1/10 verdund met 2% BSA / DPBS slechts 200 pl 2% BSA / DPBS het gekozen als negatieve controles voor elk antilichaam putjes.
      2. Incubeer de cellen in een vochtige omgeving bij 4 ° CO / N. Was de putjes 3x met DPBS en vervolgens tweemaal met 2% BSA / DPBS.
    3. Reveal primaire antilichamen door het toevoegen van specifieke secundaire antilichamen.
      1. Voeg 300 ul anti-konijnen IgG (ezel anti-konijnen IgG [H + L]) verdund 1/100met 2% BSA / DPBS in elk putje gekozen als positieve en negatieve controle voor CD44 en CD105. Voeg 300 ul FITC anti-muis IG (FITC-konijn-anti-muis IgG [H + L]) 1/100 verdund met 2% BSA / DPBS in elk putje gekozen als positieve en negatieve controle voor Stro-1. Incubeer cellen in het donker bij kamertemperatuur gedurende 60 min. Was de putjes 6x met DPBS.
    4. Stain MSC marker-positieve cellen voor het cytoskelet actine door het toevoegen van 300 pi phalloidin 1/100 verdund met 2% BSA / dpbs in elk putje gekleurd voor MSC marker immunofluorescentie.
    5. Incubeer de cellen gedurende 40 minuten bij kamertemperatuur. Was de putjes 3x met DPBS en dan was ze tweemaal met ultrapuur dH 2 O. Overgaan tot de tegenkleuring van de kernen na immunofluorescentie kleuring hierboven beschreven. Bereid propidiumjodide oplossing 10 -5 M in DPBS (voorraad 1,5 x 10 -3 M) in een zuurkast.
      1. Voeg 200 ul propidiumjodide oplossing in elk putje gekleurd zoals hierboven beschreven. Incubeer de cels 2 - 3 minuten bij kamertemperatuur. Was de putjes tweemaal met ultrapuur dH 2 O.
        OPMERKING: Herhaal de stappen secties 5,1-5,2 op de cellijn HCT8, een primaire continue gedifferentieerde colonkanker cellijn die wordt gebruikt als een negatieve controle.
  3. Osteogene differentiatie assay
    OPMERKING:
    osteogene differentiatie duurt 20 d.
    1. Plaat OS-CSCs in 24-putjes platen bij een celdichtheid van 1 x 10 4 cellen / cm2 in SCCGM. Laat de cellen groeien in SCGM totdat ze 80 bereiken - 90% confluentie in elk putje.
    2. Begin osteogene differentiatie door het veranderen van de SCGM naar OM. Laat de cellen groeien in OM en verfrissen medium om de 3 - 4 d. Stop de osteogene differentiatie test bij 10 d om de aanwezigheid van alkalische fosfatase (ALP) evalueren.
    3. Fix cellen in 4% PFA / DPBS (zie paragraaf 5.1). Evalueer de osteoblastische fenotype door cytochemische kleuring voor ALP en voor HAmet behulp van alizarinerood S kleuring.
    4. ALP cytochemische kleuring
      NB: Bereid de kleurstof mengsel in een chemische kap onmiddellijk voor aanvang van de kleuring.
      1. Los op 40 mg Fast Blauw BB of Fast Red Violet LB zout in 50 ml Tris-HCl, pH 9 (oplossing A). Los 5 mg naftol-AS-MX fosfaat-natriumzout in 1 ml DMSO (oplossing B). Voeg Oplossing B volledig aan Oplossing A en meng goed, het verkrijgen van Solution C. Twee keer wassen cellen met DPBS.
      2. Voeg 500 ul - 1 ml oplossing C aan elk putje en incubeer bij 37 ° C en 5% CO2. Toezicht tijdens kleuring elke 10 minuten door het observeren van de cellen onder de microscoop.
      3. Stop de kleuring bij ALP-positieve cellen intens geworden gekleurd (blauw met de Fast Blue BB zout of rood met Fast Red violet LB zout), die meestal optreedt binnen 30 min. Was de cellen 3x met ultrapuur dH 2 O om alle residuen van Solution C. verwijderen Als er een neerslag van de vlek iaanwezig is, was de cellen snel een keer met absolute ethanol.
      4. Overgaan tot de tegenkleuring van de kernen na ALP kleuring zoals beschreven in de stappen 5.2.5 en 5.2.5.1.
    5. Alizarinerood S cytochemische kleuring
      NB: Bereid de kleurstof mengsel vóór het begin van het experiment.
      1. Bereid de 2% Alizarine rood (2 g alizarine rood in 100 ml ultrapuur H 2 O). Voeg 2,5% NH 3-2% alizarinerood S te bereiken pH 6,0. Store 2% alizarinerood S-oplossing bij 4 ° C. Was de cellen eenmaal met DPBS.
      2. Voeg Alizarin Red S aan de cellen gedurende enkele seconden.
      3. Was de putjes met ultrazuiver dH 2 O tot de mate van kleuring controleren; als de HA deposito's zijn niet intens gekleurde, herhaalt u stap 5.3.5.2. Stop de kleuring wanneer HA deposito intens rood gekleurd, die meestal optreedt binnen enkele minuten te worden. Was de putjes met ultrapuur dH 2 O.
    6. adipogenic differentiatie
      LET OP: Assay duur is afhankelijk van de OS-CSC lijnen. De test kan duren 14-30 d.
      1. Plaat OS-CSCs in 24-putjes platen bij een celdichtheid van 1 x 10 4 cellen / cm2 in SCGM. Laat de cellen groeien in SCGM totdat ze 80 bereiken - 90% confluentie in elk putje. Initiëren adipogenic differentiatie door het veranderen van de SCGM naar AM. Laat de cellen groeien in AM en vernieuwt de AM tweemaal per week.
      2. Stop de adipogene differentiatie assay wanneer lipide blaasjes zichtbaar zijn. Evalueer de adipogenic fenotype door Oil Red O kleuring en door hematoxyline tegenkleuring voor kernen.
      3. Haematoxyline tegenkleuring voor kernen
        NB: Bereid de kleurstof mengsel vóór het begin van het experiment.
        1. Bereid de 5% hematoxyline-oplossing, genaamd Emallume Carazzi 39. Bewaar de oplossing bij 4 ° C. Voeg Emallume Carazzi voor slechts 2 min. Was de putjes met ultrapure dH 2 O.
    7. CFU assay
      NB: Dit experiment moet worden uitgevoerd in drievoud.
      1. Plaat OS-CSCs in 100 mm Petrischalen bij een celdichtheid van 450 cellen / cm2 in CFUM. Incubeer de cellen in een 37 ° C, 5% CO2 incubator gedurende 4 weken. Vernieuwen CFUM twee keer per week.
      2. Vlekken op de CFU's met toluidine blauw. Tel de kolonies gekleurd met behulp van een omgekeerde microscoop. Bereken CFU efficiency volgens de volgende formule: (aantal gevormde kolonies / aantal cellen gezaaid) * 100.
    8. ALDH activiteit analyse
      OPMERKING: ALDH activiteit is beoordeeld volgens een ALDH activiteit Colorimetrische Assay Kit op beide OS-CSC lijnen en een eindige fibroblast lijn, die werd gebruikt als een negatieve controle. Deze kit kwantificeert de ALDH enzymatische activiteit door absorptiewaarde bij 450 nm. Alle tests zijn uitgevoerd in drievoud.
      1. Distantiëren celculturen uit de monolaag door behandeling met trypsine (zie paragraaf 2.2). Pellet cellen door centrifugatie bij 400 xg gedurende 5 minuten. Volg protocol van de fabrikant.
    9. Flow cytometrische analyse:
      OPMERKING: Enige cel suspensies zijn vereist voor optimale kleuring van monsters voor flowcytometrie. Een enkele celsuspensie moet voorbereid voor elk antilichaam te testen. Distantiëren celculturen uit de monolaag door behandeling met trypsine (zie paragraaf 2.2).
      1. Plaats de celsuspensie in een conische buis, het uitvoeren van een aantal cellen met de Bürker telkamer Centrifugeer cellen bij 400 xg en resuspendeer in een geschikt volume scheidingsbuffer een celsuspensie te verkrijgen bij een uiteindelijke celconcentratie van 1 x 10 5 cellen / ml.
      2. Centrifugeer de celsuspensie gedurende 5 minuten bij 4 ° C. Verwijder het supernatant en was het pellet met scheidingsbuffer. Herhaal deze stap twee keer.
      3. Stain cellen voor MSC markers (dat wil zeggen, CD44, CD105 en Stro-1) 40.
      4. Analyseer positief gekleurd celsuspensies in een flowcytometer. Analyseer de gemarkeerde monsters binnen 1 d. Incubeer deze monsters bij 4 ° C tot analyse.
    10. RT-PCR
      1. Extractie en isolatie van RNA
        1. Voeg 1 ml lysis reagens om de cellulaire verpakt bevroren monsters van OS-CSCs en is rechtstreeks lyseren van de cellen in de buis pipetteren de pellet en neer meerdere malen.
        2. Centrifugeer de monsters bij 12.000 xg gedurende 1 min bij 4 ° C. Verwijder voorzichtig de bovenstaande vloeistof. Breng de bovenstaande vloeistof over in een nieuwe buis, voeg 200 pl chloroform en dop op de tube stevig. Schud de buis krachtig gedurende 15 seconden en incubeer het monster gedurende 5 minuten bij kamertemperatuur.
        3. Centrifugeer de monsters bij 12.000 xg gedurende 15 min bij 4 ° C. Het mengsel scheidt in drie verschillende fasen. Het RNA uitsluitend in de kleurloze bovenste waterige fase.
        4. Als particularly voorzichtig verwijdert alleen de waterige fase en breng deze fase naar een nieuwe buis door te gaan met RNA-isolatie. Voeg 500 ul isopropanol aan de buis met de waterfase. Schud de buis voorzichtig met de hand. Incubeer het monster bij kamertemperatuur gedurende 10 min. Centrifugeer het monster bij 12.000 xg gedurende 10 min bij 4 ° C.
          OPMERKING: Nadat het monster gecentrifugeerd, kan het RNA zien, die een gelachtige pellet gevormd op de wand en de bodem van de buis.
        5. Verwijder de bovenstaande vloeistof uit de buis voorzichtig om de pellet van het RNA op de bodem verlaat. Voeg 1 ml 75% ethanol aan de buis. Vortex de buis met de hand gedurende een paar seconden en centrifugeer de buis bij 7500 xg gedurende 5 minuten bij 4 ° C.
        6. Gooi de ethanol en lucht droog de RNA pellet. Wanneer de pellet droog, resuspendeer de RNA pellet in RNase-vrij water (10-50 ui) pipetteren de oplossing en neer meerdere malen.
        7. Bepaal de opbrengst en zuiverheid van het RNA door MMOijdens de absorptie bij 260 nm en 280 nm met een spectrofotometer. Evalueer de integriteit van de totale RNA op standaard 1% agarose gel. Bewaar het RNA bij -80 ° C.
      2. Omgekeerde polymerasekettingreactie
        1. Synthetiseren eerste streng cDNA uit 500 ng RNA monsters met behulp van een reverse transcriptie kit. Dooi RNA-monsters op ijs ontdooien en de nodige oplossingen in de kit bij kamertemperatuur. Verder met cDNA volgende protocol van de fabrikant synthetiseren.
      3. Semi-kwantitatieve reverse transcriptase-polymerasekettingreactie (RT-PCR)
        1. Voer alle PCRs gebruik 1 pi cDNA voor elk monster als een matrijs in een uiteindelijk reactievolume van 24 pi. Gebruik de primersequenties in Tabel 1 die voor de amplificatie van Nanog, Oct 3/4, SOX2 en CD133 genen.
        2. Scheid de RT-PCR producten door 1,8% agarose gelelektroforese en kleuring met ethidiumbromide. Foto onder UV Illumnatie.

Representative Results

OS monsters verkregen door punctie of chirurgische resectie van een klein deel van de tumor (Figuur 1A, B) dat het isoleren van enige OSA indien juist behandeld, zoals beschreven in het hoofdstuk protocol (Figuur 2A, B). Helaas is het aantal cellen geïsoleerd uit biopten laag, met een vermogensbereik 30-50%. De uitgang is afhankelijk van het type en de afmeting van biopsies (Figuur 5A, B). Deze cellen moeten nauwkeurig worden behandeld. Bijgevolg ongeveer een maand nodig om de primaire culturen confluentie bereiken in een 100 mm petrischaal. Hierna worden OSA verkregen uit twee OS monsters gemarkeerd OSA5 en OSA6 (Figuur 6A, B). Vervolgens is het noodzakelijk om de primaire cellijn subcultuur om een ​​voldoende aantal cellen op de karakterisering en analyse uit te voeren aan de cel cryopreserve lines. Bij het 3e passage van de subcultuur, wanneer beide OSA primaire cellijnen te bereiken confluentie, worden ze uitgezet in 6-well ultra-low platen bevestiging voor de sarcosphere test. Dit type plaat wordt gebruikt omdat het ons in staat om cellen in een gesuspendeerde toestand te houden, om de stamcellen uit-gemedieerde hechting differentiatie te voorkomen, om te voorkomen dat de verankering-afhankelijke cellen uit te delen, en tenslotte, om hechting aan het substraat verminderen. Vandaar het gebruik laat ons een stressvolle voorwaarde voor de kankercellen, die nodig is voor het samenstellen van CSCs creëren. Op 24 uur na de start van de analyse, lijken cellen van elkaar geïsoleerd (Figuur 7). Na 7 dagen van waarnemen van het verloop van de assay werden kleine ronde kolonies begonnen te vormen en zichtbaar (Figuur 8). Op 28 d, kan een aantal grote bolvormige kolonies die zijn gevormd in elk putje worden waargenomen (Figuur 9A, B). Na de sarcospheres have gekweekt voor 28 d kunnen deze grote bolvormige kolonies worden geïsoleerd. Figuur 10 toont de stappen voor het isoleren van sarcospheres 6-well platen ultralage hechting en ze reculturing onder hechtende omstandigheden. Figuur 11 toont de drijvende bolvormige kolonies na isolatie. De grote bolvormige kolonies uitgeplaat in normaal bevestigingsplaten tonen hechtende groei na isolatie (Figuur 12A, B). Cellen die uitzetten van Single sarcospheres waarschijnlijk kankercellen met een stamcel fenotype. Dus na isolatie, OS-CSCs waren waarschijnlijk verkregen. Deze cellen zijn genoemd OSA5-CSCs en OSA6-CSCs (Figuur 13A, B).

Op dit punt dient te gaan met de karakterisatie van de stamcel fenotype voor de twee OS-CSC lijnen verkregen, zoals hierboven beschreven. De analyses voor het karakteriseren van de stamcel fenotype were uitgevoerd op de 4 de passage van subcultuur na de sarcospheres voor elk OS-CSC lijn werden geïsoleerd. De twee cellijnen, OSA5-CSCs en OSA6-CSCs, liet een sterke positiviteit voor de oppervlaktebehandeling MSC markers (CD105 en CD44) (Figuur 14A, B en figuur 15A, B), terwijl ze gematigd positiviteit voor de oppervlaktebehandeling MSC marker toonde Stro- 1 (Figuur 16A, B). Onze opmerkingen zijn bevestigd door de negatieve resultaten verkregen met de commerciële en gedifferentieerde darmkanker cellijn HCT8 (figuur 14C, Figuur 15C, Figuur 16C). Een totaal gebrek aan specifieke en niet-specifieke kleuring van deze oppervlaktemerkers in de HCT8 cellijn werd waargenomen.

Om het fenotype van de MSC twee OS-CSCs evalueren we ook uitgevoerd flowcytometrische analyses. Zowel de OS-CSC lijnen brachten hoge niveaus van CD44 en CD105. Echter, van de cellen in beide cellijnen, slechts 1,14% uitgedrukt Stro-1. Daarom is deze result bevestigde de aanwezigheid van matige Stro-1 zoals aangetoond met immunofluorescentie kleuring. Daarentegen 99,62% van de OSA5-CSCs CD44 expressie en 87,38% van deze cellen tot expressie CD105; 99,88% van de OSA6 CSC-expressie in CD44 en 95,79% van deze cellen tot expressie CD105. Bovendien, beide cellijnen CD45-.

Onderzochten we de expressie van markers 3 ESC (Nanog, Oct 3/4, Sox2) en de CD133 gen, andere CSCs marker, door RT-PCR. We hebben gemerkt dat al deze genen werden uitgedrukt in zowel OS-CSC-lijnen (Figuur 17). De adipogene en osteogene differentiatie assays toonden het vermogen van zowel geïsoleerd OSA-CSC lijnen te differentiëren tot osteoblasten (Figuur 18A - D en Figuur 19A - D) en tot adipocyten (Figuur 20A - D).

Bovendien is de CFU een ssay (Figuur 21) toonde een goede snelheid van klonogene efficiency, met 13% voor OSA5-CSCs en 14% voor OSA6-CSC. Recent onderzoek heeft aangetoond dat hoge niveaus van ALDH activiteit kenmerkend voor verschillende soorten kanker. Deze parameter kan worden gebruikt als een kanker stamcel marker en is gecorreleerd met een slechte prognose. De ALDH activiteit assay toonde dat zowel OS-CSC lijnen hebben hoge niveaus van ALDH activiteit (figuur 22), terwijl ALDH activiteit op de onderste detectielimiet in de fibroblast lijn die werd gebruikt als een negatieve controle in deze test werd waargenomen.

Figuur 1
Figuur 1. Voorbeelden van OS Biopsie monsters. (A). Biopsie monster verkregen door de naald aspiratie. (B). Biopsiemonster verkregen door chirurgische resectie van een deel van de tumor.884 / 53884fig1large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. Mechanische onderverdeling van een OS Monster. (A) Fragmentatie van een monster met behulp van Perry pincet en een lancet. (B) Fragmenten gesuspendeerd in CM (aangegeven door de pijl). Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3. Apparatuur en verbruiksgoederen die nodig zijn om Isoleer Sarcospheres. (A). Alle apparatuur die nodig is voor mobiele isolement. 1. Een steriele spuit met een steriel membraanfilter gedaan; 2. Twee verschillende media: GM eennd SCGM; 3. Een steriele glazen Pasteur pipet. (B) Detail van de spuit gemonteerd op een drager, met het membraan filterhouder. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4. filtereenheid. Verschillende componenten nodig filtratie-eenheid (A) monteren (netto filter wordt aangegeven door de pijl). Fasecontrast observatie van de 40 urn mazen (een maas wordt aangegeven door de pijl) van het netfilter (B). Original vergroting: 10X. De filtratie-eenheid gemonteerd (C - D). Filtratie-eenheid gesteriliseerd (E). Klik hier om te zien een grotere version van dit cijfer.

figuur 5
Figuur 5. primaire celculturen van conventionele OS. Fase contrast observatie van primaire celculturen van hoogwaardig OS. In (A), verschillende lichte botfragmenten zichtbaar, terwijl in (B), diverse kleine ronde en drijvende erytrocyten aanwezig zijn. Original vergroting: 10X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 6
Figuur 6. Conventionele osteosarcoom eindige cellijnen (OSA). (A) OSA5 en (B) OSA6. Observatie in fasecontrast.Original vergroting: 10X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 7
Figuur 7. Assay van Sarcosphere OSA5 en OSA6. Na 24 uur vanaf het begin van de test cellen dreven en geïsoleerd van elkaar (cellen worden aangegeven met pijlen). Observatie in fase contrast. Oorspronkelijke vergroting. 20X Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 8
Figuur 8. Sarcosphere Assay van OSA5 en OSA6 7 D. 7 dagen in de test, een aantal kleine Spherical kolonies omringd door enkele cellen konden worden waargenomen. De sarcospheres (sommige sarcospheres zijn aangegeven met pijlen) lijken drijvend in het medium of iets lager geïnstalleerd in de bodem van de put. Observatie in fase contrast. Original vergroting: 20X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 9
Figuur 9. Analyse van Sarcosphere OSA5 en OSA6 bij 28 D. Na 28 d, enkele grote amber sarcospheres waargenomen in elk putje van de platen voor elke OSA cellijn, OSA5 (A) en OSA6 (B). Bar grootte: 100 micrometer. Klik hier om een grotere versie van deze figuur te zien. </ P>

figuur 10
Figuur 10. Passages voor de isolatie van Sarcospheres De stappen voor het isoleren van sarcospheres 6-well platen ultralage hechting en hun reculturing onder omstandigheden hechtende getoond (A) alle benodigde apparatuur voor de isolatie..: 1. Een 6-well ultra-low plaat met gevormd sarcospheres in elk putje, 2. spuit met de netto-filterhouder, 3. pipet, 4. 1000 pl steriele tips, 5. 2 steriele Perry pincet, 6. 2 andere cultuur media 7. steriele Pasteur pipet 8. petrischaaltjes. (B) Collectie van sarcospheres. Het medium in elk putje verzameld met een pipet met steriele 1000 pi tip. (C) het verzamelen van de suspensie in de spuit. De verzamelde suspensie wordt overgebracht naar de spuit om de natuurlijke filtratieproces gaan gebruikenmembraan filterhouder. (D) Natuurlijke filtratie. (E) demonteren membraanfilter houder van de spuit. Nadat alle suspensie wordt gefiltreerd, wordt het net filterhouder uit elkaar gehaald en in een petrischaal; (F) Demontage van het membraan filterhouder. Sarcospheres zijn opgenomen in de poriën van het netfilter in de netto filterhouder, zodat zij moeten worden vrijgemaakt met de Perry pincet. (G, H) Verwijdering van sarcospheres uit het membraan filter. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 11
Figuur 11. Isolatie Sarcosphere. Geïsoleerd sarcospheres drijven in het medium in de 60 mm petrischaal. Observatie in fase-contrast.Original vergroting: 40X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 12
Figuur 12. Sarcosphere na isolatie. Sarcospheres van OSA5 (A) en OSA6 (B) cellijnen begin hechtende expansie na herintroductie en reculturing in een monolaag onder hechtende omstandigheden bij 48 uur na isolatie. Observatie in fase-contrast. Original vergroting: 20X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 13 Figuur 13. Sarcospheres 7 D na isolatie. Sarcospheres van OSA5 (A) en OSA6 (B) cellijnen vertoonden adherente expansie na herintroductie en reculturing in een monolaag onder hechtende omstandigheden op 7 d na isolatie. Observatie in fase-contrast. Original vergroting: 20X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 14
Figuur 14. Immunofluorescentie kleuring voor CD105. Immunofluorescentiekleuring van CD105 in het OSA-CSC CSC-lijnen OSA5 (A) en OSA6-CSC (B) en in de continue cellijn HCT8 (C), die werd gebruikt als een negatieve controle. LSCM in conventionele kleur: Groen voor CD105 en rood voor cytoskelet. Original vergroting: 10X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 15
Figuur 15. Immunofluorescentie kleuring voor CD44. Immunofluorescentie kleuring voor CD44 in de OSA-CSC CSC-lijnen OSA5 (A) en OSA6-CSC (B) en in de continue cellijn HCT8 (C), die werd gebruikt als een negatieve controle. LSCM in conventionele kleuren: groen voor CD44 en rood voor cytoskelet. Original vergroting: 10X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.


Figuur 16. Immunofluorescentie kleuring van Stro1. Immunofluorescentie kleuring voor Stro-1 in het OSA-CSC CSC-lijnen OSA5 (A) en OSA6-CSC (B) en in de continue cellijn HCT8 (C), die werd gebruikt als een negatieve controle. LSCM in conventionele kleuren: groen voor Stro-1 en rood voor cytoskelet. Original vergroting: 10X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 17
Figuur 17. Expressie van nucleaire ESC Markers en de CD133 gen. RT-PCR waarin de expressie van Nanog, Oct 3/4, Sox2 en CD133 in OSA5-CSC (A) en OSA6-CSC ( Klik hier om een grotere versie van deze figuur te bekijken.

figuur 18
Figuur 18. osteogene differentiatie Assay -. ALP osteogene differentiatie bij 0 d (A, B) en na 10 d (C, D) inductie zoals bepaald door cytochemische kleuring voor ALP middels Fast Blue BB. In blauw, ALP + cellen; rood, de kern tegengekleurd met propidiumjodide. Composite observatie in helderveld en fluorescentie. Original vergroting: 20X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 19 Figuur 19. osteogene differentiatie Assay -. HA osteogene differentiatie bij 0 d (A, B) en na 20 d (C, D) inductie zoals bepaald door cytochemische kleuring van hydroxyapatiet (HA) met alizarinerood S. De cellen worden gecontrasteerd in blauw / grijs, en de korrelige deposito's van HA zijn gekleurd in het rood. Observatie in fase contrast. Original vergroting: 40X. Bar size:. 100 um Klik hier om een grotere versie van deze figuur te bekijken.

figuur 20
Figuur 20. Assay adipogene differentiatie. Adipogene differentiatie bij 0 d (A, B) en na 14 d (C, D) inductie zoals bepaald door cytochemical kleuring met Oil Red O. In het rood, de lipide blaasjes (de grotere blaasjes worden aangegeven door de zwart / rode pijlen, de kleinere blaasjes worden aangegeven door de wit / zwarte pijlen); in blauw / violet, de kernen tegengekleurd met hematoxyline. Observatie in helderveld. Original vergroting: 40X. Bar size:. 100 uM Klik hier om een grotere versie van deze figuur te bekijken.

figuur 21
Afbeelding 21. CFU Assay. CFU assay van OSA-CSC lijnen gekleurd met toluidine blauw. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 22 /> Figuur 22. ALDH activiteit Assay. De ALDH colorimetrische test gedetecteerd hoge niveaus van ALDH activiteit in de twee OS-CSC lijnen, OSA5-CSCs en OSA6-CSCs, terwijl de test het ontbreken van deze activiteit in de eindige gedifferentieerde cellijn gedetecteerd fibroblasten, FIB. Error bars: SD. **: P <0,001 versus FIB; *. P <0,01 vs FIB Klik hier om een grotere versie van deze figuur te bekijken.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
Gen oligonucleotiden Sequence (5¹-3¹) Amplicongrootte (bp) Tₐ (° C)
nanog Voorwaartse primer Reverse primer 87 60
02/03 oktober Voorwaartse primer Reverse primer GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 Voorwaartse primer Reverse primer TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 Voorwaartse primer Reverse primer CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp basenparen van amplicongrootte, Tₐ, gloeientemperatuur-

Tabel 1. gedetailleerde lijst van Primer sequenties voor Nanog, Oct 3/4, Sox2 en CD133 met de Amplicon Grootte en de hybridisatietemperatuur

Discussion

CSCs hebben verschillende eigenschappen die de identificatie van deze specifieke cellulaire set in de tumorbulk mogelijk. Op basis van deze kenmerken, zoals verworven resistentie tegen chemotherapeutische middelen cytotoxische de overexpressie van ATP-bindende cassette multidrug transporters 28, 32, 33, of de opwaartse regulatie van de expressie van detoxificatie enzymen zoals ALDH 32, voor de expressie van een bepaald oppervlak merker, zoals CD133, CD44, CD34, CD90, en andere 30, 34, 35, 41, verschillende methoden om CSCs isoleren ontwikkeld 42-44. Een van deze technieken is de bol vorming assay die is gebaseerd op het vermogen van CSCs groeien onder niet-klevende omstandigheden.

Het vermogen van weefsels stamcellen en CSC tot bolletjes gevormd werd eerst beschreven in studies naar de identificatie van neurale stamcellen door Reynolds et al. 37. Vervolgens, Gibbs et al. 38 onsed deze studies beginnen isoleren CSCs van vaste tumoren, met name uit bot sarcomen. We hebben besloten om de sfeer formatie assay methode toegelicht door Gibbs et al gebruiken. CSCs om te isoleren van OSA verkregen cellijnen conventionele OS biopsies. We pasten de oorspronkelijke methode om de resultaten van deze test verhogen en de reproduceerbaarheid van andere kankercellijnen vergemakkelijken. Met oog op de uitwerking van de bol vorming assay, we vastgesteld dat uitplaten 40.000 cellen / putje is een goede praktijk handhaven cellen afzonderlijk aan het begin van de test. Deze truc is zeer belangrijk om de mogelijkheid dat de bolvormige kolonies afkomstig van cellulaire aggregatie en niet van de bijzondere en exclusieve capaciteit van een enkele CSC groeien onder niet-klevende omstandigheden en vormen een bolvormige kolonie voorkomen. Dit vermogen is bijzonder kritisch punt van deze assay.

We hebben ook verklaard dat om een ​​goede prijs van de bol formatie te verkrijgenVolstaat om aliquots van groeifactoren verversen elke 3 d en niet dagelijks zoals aangegeven in de oorspronkelijke methode. In deze studie hebben we ook vast en uitgebreid beschreven een goede methode voor het isoleren van de bolvormige kolonies die gevormd wordt wanneer gekweekt onder niet-klevende omstandigheden. Deze stap is essentieel in deze test omdat het zeer belangrijk om te proberen zoveel mogelijk van de bollen mogelijk die worden gevormd in elk isolaat vormt zonder ze te beschadigen. Het is ook belangrijk om alleen de bollen, en niet de cellen, die in suspensie voor de duur van de test zouden kunnen blijven isoleren. Om deze kritische punten te overwinnen, hebben wij een bijzondere isolatiewerkwijze, die, zoals hierboven getoond, gaf goede resultaten voor CSC isolatie ontwikkeld. Uiteraard bestaat de mogelijkheid dat niet alle gebieden die gevormd kunnen worden teruggewonnen, maar het verlies percentage is zeer laag. Sterker nog, we hebben ook de mogelijkheid om een ​​filter te gebruiken met 40 urn poriën om bollen te isoleren nadat ze groot worden (vormed ongeveer 100-200 cellen).

Deze isolatie stopt bol vorming maar laat de afzonderlijke cellen, deel van het residu methylcellulose, en de kleinste gebieden te filteren. Deze verwijdering wordt uitgevoerd door een grondige filtratie zoals beschreven in het protocol.

Bovendien is de keuze van het grootste bolvormige kolonies door 40 urn mesh met als gevolg dat de kleinste bolvormige kolonies kan men de CSCs met de hoogste capaciteit bolvormig kolonies vormen en met meer stemness selecteren. Al deze aanpassingen werden uitgevoerd om de assay verbeteren en onderzoekers bestuderen CSCs te begrijpen en te reproduceren de meest kritische fase van de oorspronkelijke methode van de bol vorming assay helpen.

Onder de studies met betrekking tot in vitro werkwijzen voor het isoleren CSCs, deze studie gericht om te laten zien hoe dit aangepast bol formatie assay een goede methode zou kunnen zijn voor het isoleren van CSCsOSA cellijnen. De aanpassingen van de oorspronkelijke methode en de gedetailleerde isolatie techniek beschreven verbetering van de doeltreffendheid ervan. In een korte tijd, kan goed aantal CSCs worden verkregen en gebruikt voor verschillende experimenten. Daarom is het mogelijk om snel bevestigen de steel-achtige fenotypen en met name de dubbele steel fenotype dat OS-CSCs kenmerkt bestuderen. Aldus zou deze gewijzigde assay een goede techniek voor het isoleren CSCs en de studie biologie. In de toekomst, deze methode extra aanpassingen kunnen ook worden gebruikt om de andere CSCs eindige kankercellijnen verkregen biopten van zeldzame solide tumoren te isoleren.

De mogelijkheid van het isoleren CSCs zeldzame vaste tumoren, zoals OS, niet alleen maakt de verbetering van studies over deze specifieke kanker maar ook voor studies van verschillende soorten kanker betere werkwijzen voor de isolatie ontwikkelen en toekomstige studies van de biologie van deze belangrijke cellulaire subgroep. Daarom, zoals wegedaan in deze studie, is het belangrijk om de werkwijzen van CSC isolatie te verbeteren door de studie van CSC biologie, met het uiteindelijke doel van het vinden van moleculaire doelen en de ontwikkeling van een specifieke anti-kanker therapie tegen deze specifieke cellulaire deelverzameling, die waarschijnlijk verantwoordelijk voor het handhaven van de primaire tumor, de ontwikkeling van de herhaling, en het ontstaan ​​van uitzaaiingen in verschillende organen. De studie van de biologie CSC is ook belangrijk voor het vinden van therapieën die scherpe in de behandeling van kankers, zoals OS, waarvan de overleving na neoadjuvante behandeling nog zeer gering zijn.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics