마이크로 RNA 정량는 DNA 결합 염료 화학, 물방울 디지털 PCR을 사용하여 순환

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

마이크로 RNA (miRNA가) (무 세포들)은 순환 혈류로 세포로부터 방출된다. 순환 특정 마이크로 RNA의 양은 질병 상태에 연결된 질병 표지자로서 사용될 수있는 잠재력을 가지고있다. 디지털 PCR 기술 염료 계 화학 제를 사용하여 액적 마이크로 RNA 정량화를 순환 민감하고 정확한 방법이 최근 개발되고있다. 구체적으로, 핵산 (LNA)을 그 고유의 miRNA의 절대 정량을 얻을 수있다 호환 액적 디지털 PCR 시스템에서 녹색 형광 DNA 결합 염료 miRNA에 특이 적 프라이머를 사용하여 잠김 기반. 여기, 우리는이 기술을 수행하는 플라즈마 및 혈청 등의 생물학적 유체에서 miRNA의 양을 평가하는 방법을 설명, 가능하고 효과적이다.

Protocol

혈장 또는 혈청에서 마이크로 RNA 분리

참고 : 플라즈마 및 혈청 준비의 miRNA 정량 순환에 중요한 단계이다. 플라즈마 및 혈청 준비를위한 기본 절차는 없습니다. 고려해야 만 중요한 것은 동일한 실험에서 모든 샘플은 동일 흐름을 사용하여 처리 할 수​​ 있어야한다는 것이다. 200 μL의 혈청 또는 혈장에서 시작합니다. 총 RNA를 상업적으로 이용 가능한 키트를 사용하여 혈청 또는 혈장으로부터 분리 될 수있다.

1. (miRNA를 포함) 총 RNA를위한 프로토콜 절연

  1. 얼음에 해동 혈청 / 혈장 샘플.
  2. 200 μL 혈청 / 플라즈마에 용해 시약 (예., QIAzol)의 1 ML을 추가합니다.
  3. 텍싱하여 혼합하고 5 분 동안 실온에서 벤치에 균질를 포함하는 튜브를 배치합니다.
  4. C.에서 합성의 miRNA CEL-은 miR-39-3p의 4.16 nM의 용액 3 μl를 추가 간스.
  5. 클로로포름 200 μl를 추가합니다. 15 초 동안 적극적으로 튜브를 흔들어. 장소 일2 분 동안 실온에서 벤치에 전자 튜브.
  6. 4 ° C에서 12,000 XG에 15 분 동안 원심 분리 단계 분리를 구하는 : 위 수성 단계는 RNA가 포함되어 있습니다.
  7. , 새로운 튜브에 700 μl를 수성 상을 이동하는 흰색 계면 물질의 이동을 피하십시오.
  8. 100 % 에탄올 1 ML을 추가하고 반전으로 섞는다.
  9. 피펫은 최대 미니 스핀 컬럼에 시료 700 μL은 2 ㎖의 포집 관에 배치합니다. 15 초 동안 12,000 XG에 뚜껑 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오.
  10. 나머지 샘플을 사용하여이 단계를 반복합니다.
  11. 미니 스핀 컬럼에 700 ㎕의 버퍼 RWT 추가 열을 씻어 12,000 XG에 15 초 동안 뚜껑과 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오.
  12. 미니 스핀 열에 피펫 500 μL 버퍼 RPE. 12,000 rpm에서 15 초 동안 뚜껑과 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. 다시이 단계를 반복합니다.
  13. 스핀 열을 건조 2 분 동안 전속력으로 미니 스핀 컬럼을 원심 분리기잔류 에탄올에서 막.
  14. 컬럼의 막에 새로운 1.5 ml의 수집 관 및 피펫 35 μL의 RNA 분해 효소가없는 물을에 미니​​ 스핀 컬럼을 전송합니다.
  15. RNA의를 용출 12,000 XG에서 1 분 동안 원심 분리기.
  16. -80 ° C에서 RNA를 저장합니다.
    주 : RNA의 농도를 정확하게 측정 할 수 없기 때문에, 입력 된 금액에 대한 척도로서 고정 볼륨을 사용한다.

2. 마이크로 RNA 역전사

  1. 배 반응 완충액 클레아없는 물 : 역전사 (RT) 시약을 혼합 성분을 해동. 믹스 부드럽게 얼음에 튜브와 장소를 반전. 즉시 사용하기 전에, 냉동고에서 효소 믹스를 제거하고 얼음에 배치합니다. 모든 시약을 스핀.
  2. 표 1에 설명 된 바와 같이 얼음의 RT 시약 혼합물을 준비한다. 적어도 10 %를 초과하는 조합을 준비한다.
  3. 피펫으로 반응을 혼합 한 다음 스핀 다운.
  4. 42 ℃에서 60 분 동안 품어.
  5. 되돌리기를 열 - 불 활성화95 ℃에서 5 분 자체의 효소.
  6. 즉시 4 ℃로 냉각.
  7. -20 ° C에서 cDNA를 저장합니다.

3. cDNA를 희석

  1. 클레아없는 물에서 계획된 ddPCR 반응에 필요한 서식하는 cDNA의 양을 희석. 1:50 1 사이의 cDNA의 반응을 희석 : (500)을 물에 대상 miRNA의 풍부에 따라 다릅니다. -20 ° C에서 희석 된 cDNA를 저장합니다. 희석 된 cDNA는 -20 ° C에서 3 개월 이상 안정한 것으로 판명되었다.

4. 물방울 생성 및 PCR

주 : 액적 생성 한 번에 8 개의 샘플들에 대해 수행되어야한다. 기술 복제로 인해 12,15 .A 아니 템플릿 컨트롤 (NTC) 샘플은 모든 판에서 실행되어야합니다이 기술의 높은 재현성에 각각 다른 ddPCR 조건에 대해, 필요하지 않습니다.

  1. 해동 마스터 믹스를 평형 (예., EvaGreen 마스터 믹스) 실온에서, 마이크로 RNA 프라이머 세트와 cDNA를.
  2. 마스터 믹스 번째 믹스oroughly 튜브를 수회 반전. 모든 시약을 스핀 다운.
  3. 표 2에 기재된 바와 같이 ddPCR 혼합물을 준비한다. 여러 ddPCR 반응이 수행되는 경우, 작동 ddPCR-용액을 섞어 제조. 10 % 이상 초과 믹스를 준비합니다.
  4. 조립 후 잘 혼합하고 ddPCR 믹스를 스핀 다운.
  5. ddPCR 12 μL를 96- 웰 PCR 플레이트 또는 PCR 튜브에 혼입 분배.
  6. 잘 / 각각의 튜브로 희석 cDNA를 템플릿의 8 μl를 추가합니다.
  7. 홀더에 방울 생성기 카트리지를 삽입합니다.
  8. 전송 공기를 피하는 웰의 바닥에 기포 조심하면서 방울 생성기 카트리지의 샘플 웰 (중간 행)에 각각 준비된 샘플 20 μL.
  9. 방울 생성기 오일의 70 μl를 각 유정 (아랫 줄)을 입력합니다.
  10. 카트리지 홀더 위에 개스킷 후크 및 방울 생성기 삽입.
  11. 제조 업체의 홍보에 따른 액적 생성을 시작하기 위해 덮개를 닫습니다otocol. 액적 생성이 완료되면, 뚜껑을 열고 일회용 가스켓을 제거합니다. 카트리지의 상단 우물은 물방울이 포함되어 있습니다.
  12. 96 웰 PCR 플레이트의 한 칼럼에 팔 상부 웰 (액적)의 내용 피펫 천천히 부드럽게 40 μL.
  13. 즉시 증발을 방지하기 위해 물방울 전사 후 호일 PCR 플레이트를 밀봉. 액적 리더의 바늘과 호환되는 천 공식 박 플레이트 씰을 사용합니다.
  14. 플레이트를 밀봉 30 분 이내에 열 사이클링 (PCR)를 시작합니다.
  15. 표 3에 따른 순환 프로토콜을 수행합니다.

5. 물방울 읽기

  1. 액적 리더의 전원을 켭니다.
  2. 액적 리더에 열 자전거 타는 사람에서 접시를 이동합니다.
  3. 판 홀더의베이스로 후 PCR 방울을 함유하는 96 웰 PCR 플레이트를 놓는다.
  4. PCR을 접시에 판 홀더의 상부를 놓습니다. 단단히 모두 분리 탭을 눌러아래 홀더에 PCR 플레이트를 고정합니다.
  5. 시스템 PC에서 소프트웨어를 시작합니다.
    1. 실험 (절대 정량)를 정의하는 설정을 클릭 한 다음 방울​​ 독서를 시작하려면 실행을 클릭합니다.
    2. 액적 판독이 완료되면, 열기를 클릭하여 데이터를 분석하는 버튼 "분석".
    3. 양의 물방울 (올가미 도구) (그림 1B)를 선택하는 분석 소프트웨어에서 2D 진폭 플롯을 사용합니다.
    4. 긍정적이고 총 방울의 수를 확인하기 위해 이벤트 탭을 사용합니다. 18,000의 총 - 21,000 방울은 일반적으로 probeless ddPCR 달성된다.
    5. 양의 물방울이 선택되면, 농도 탭에서 수출 .CSV 옵션을 사용하여 miRNA의 농도 값을 내보낼 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

혈장 또는 혈청 1 ㎖ 당 특정의 miRNAs의 절대량 디지털 PCR 기술을 녹색 형광 DNA 결합 염료를 사용하여 액적으로 결정될 수있다. (1)가 최종 miRNA의 농도를 결정하는 포지티브 방울 선택의 과정을 제시 도면 (그 사본 / μL ) 분석 소프트웨어에 의해 계산 된 증폭 반응이다. 혈액의 각 miRNA의 양은 다른 것들보다 일부의 miRNA 종 더 풍부되고, 매우 상이하다. ddPCR 반응의 1:50 희석 된 cDNA를 사용하여이 양 및 음 적의 적절한 수를 얻을 수있다. 양 액적 포화 (예., 남아있는 네거티브 방울)의 경우의 cDNA 샘플의 추가 희석이 필요할 수있다.

모든 LNA 프라이머 세트는 방울 디지털 PCR 시스템에서 제대로 작동하도록 최적화되어야한다. 은 miR-181a-5P의 최적화 과정이다도 2에 나타낸 즉, (일반적으로 0.25의 범위 - ddPCR 반응 당 1 μL) 프라이머의 변화량.와 (보통 56의 범위 - 60 ° C) 어닐링 온도, 상기 조합을 선택할 수있다 즉, 양극과 음극 방울 사이의 더 나은 분리를 결정합니다. 은 miR-181a-5P, 60 ℃ 어닐링 온도가 모두 0.5 내지 1 μL 프라이머 량의 경우에, 액적 크기의 측면에서 더 좋은 결과를 제공한다.

이 프라이머 세트가 형성-이량 체의 프라이머 아마도 몇 가지 비특이적 증폭을 준다 발생할 수 있습니다. 의 miRNAs 순환 작업 할 때, 샘플에서 긍정적 인 신호는 매우 낮은 비 특정 신호에 따라서 유사 할 수있다. 비특이적 표적 증폭의 "클라우드"참 신호 (도 1C)과 중첩되지 않는 경우,이 miRNA를 여전히 참 선택 정량화 할 수있다 긍정적 인 방울. 이 경우, NTC 샘플 액적 선택을 위해 필수적이다. 동일한 분석에 포함되는 모든 샘플은 동일한 방법론과 동일한 ddPCR 조건을 사용하여 처리 할 필요가있다.

그림 1
그림 1. 긍정적 인 물방울 선택. 포지티브 방울 수동 1D 플롯 (A) 또는 2D 플롯 (B)의 양의 클라우드 액적 주위에 원을 수행하는 음극 액 적을 상기 임계치를 이용한 분석에서 선택된다. 일부 프라이머 세트는 비특이적 증폭을 제공하는 경우, 이것은 음성 대조군 (없음 템플릿 관리, NTC) 샘플 (C)에 나타납니다 긍정적 인 방울의 두 번째 구름에 의해 입증된다. 은 "true"로 양성은 여전히​​ 2D 플롯의 비특이적 신호 제외 선택할 수 있습니다.e.jpg "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
Probeless ddPCR와 세포 무료 miRNA의 정량화 그림 2. 프라이머 최적화 상단 패널 :. 4 가지 ddPCR 조건을 사용하여 두 개의 혈장 샘플 (S1 및 S2)에서은 miR-181a-5P의 정량화. MIR-181a-5P LNA 프라이머 농도 (0.5 내지 1 μL) 및 소둔 온도 (58 ~ 60 ° C)의 DNA-인터 염료 ddPCR의 양 (청색)의 진폭 및 음 (블랙) 방울에 영향을 미친다. 이 miRNA를위한 더 나은 분리는 60 ° C에서 PCR을 수행하고, 0.5 μL 어느 한 프라이머를 사용하여 얻을 수있다. 예상대로 제​​어 샘플 (NTC, 아니 템플릿 컨트롤), 더 긍정적 인 물방울이 없습니다. 중앙 패널 : 상기 언급 된 조건은 miR-181-5p의 최종 농도. 결과는 전기 Ampli에서 마이크로 리터 당 사본으로 표시하고 있습니다문법을 없애는 반응. 오차 막대는 포아송 95 % 신뢰 구간을 나타낸다. 낮은 패널 :. 물방울 (녹색)의 총 수에 긍정적 인 물방울 (파란색)의 수 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

시약 볼륨 (μL)
5 배 반응 버퍼 4
클레아없는 물 (11)
효소 믹스
템플릿 총 RNA
총 볼륨 (20)

표 1 - 역전사 시약 믹스 구성 요소

시약 볼륨 (μL)
배 염료 수퍼 믹스를 DNA 결합 (10)
LNA의 프라이머 세트 변수 (0.5 - 1)의 *
클레아없는 물 변하기 쉬운
희석 cDNA를 템플릿 8
총 볼륨 (20)
* 제 ddPCR 반응은 프라이머의 최고의 작업 양을 설정하는 몇 가지 샘플을 수행해야한다

표 2 - ddPCR 시약 믹스 구성 요소

사이클링 단계 온도 시각 램핑 속도 사이클
효소 활성화 95 ° C 5 분 ~ 2 ° C / 초 1
변성 95 ° C 30 초 (40)
소둔 / 확장 60 ° C 1 분
신호 안정화 4 ° C 5 분 1
90 ° C 5 분 1
홀드 (선택 사항) 4 ° C 무한의 1
105 ° C로 설정 가열 뚜껑을 사용하여 40 μL로 샘플 볼륨을 설정합니다.

표 3 - 물방울 디지털 PCR을위한 열 사이클링 조건

Subscription Required. Please recommend JoVE to your librarian.

Discussion

순환의 miRNAs는 매우 낮은 농도에서 혈액 내 존재하는 혈장 및 혈청 샘플에서 추출 할 수있는 RNA의 양이 적다. 이 때문에, 그것들은 마이크로 어레이 및 RNA 서열 분석과 같은 다른 기술을 정량화하기 어렵다. 또한, 데이터의 정규화 계약 일반화 부족 혈중 내인성 "참조"의 miRNAs의 존재가있다. 이러한 맥락에서, 혈청 또는 혈장해도 매우 낮은 1 ㎖ 당 miRNA의 매수를 카운트 할 수있는 액적 디지털 PCR과 같은 중요한 기술은 매우 매력적이다. 우리는-역의 사본을 만듭니다 때문에 시간을 절약하고, 가장 중요한, RNA 소재 하나의 반응에있는 모든 순환의 miRNAs를 보편적 인 cDNA를 시스템에이 기술을 쌍. 우리의 접근에서, 특이도는 다른 솔루션에 비해 16 miRNA의 정량화 매우 잘 수행 LNA 프라이머의 사용에 고유하다.

작은 물방울디지털 PCR은 표적 유전자의 농도를 산출 절대 허용하는 종점 분석법이다. 정량 PCR과는 달리, 부적절한 증폭 효율이 최종 ddPCR 정량에 영향을주지 않습니다. 따라서, 혈액 샘플에서 예를 들어, 본 PCR 억제제의 양을 고려 ddPCR 핵산 평가를 순환시키기위한 강력한 도구를 제공한다.

그것의 높은 감도로,이 기술에도 출발 물질이 제한된 양으로도 풍부한 이하의 miRNAs 적절한 정량화를 제공한다. 또한, 각각의 miRNA 분자는 되감기의 cDNA 분자 전사된다고 가정하면, 우리는 희석 계수 (145.83)에 대해 ddPCR 반응 값의 획득 된 농도를 곱하여 1 ㎕의 혈장 / 혈청 절대 복사본을 계산할 수있다.

제시된 플로 쉽게 따라서 Clinica는 마이크로 RNA의 정량 신뢰성 및 시간 효율적인 툴을 제공하는 시점에서 8-96 샘플들에 수행 될 수있다리터 샘플. 디지털 PCR은 핵산을위한 필수적인 도구가되어 침대 옆에 벤치에서 액체 생검을 가져, 진단 설정에서 평가를 바이오 마커가 될 수있는 잠재력을 가지고 방울입니다.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

(-, 15분의 2,010 9,980 5 밀레 N 당. 특별 프로그램 분자 임상 종양)와, 대학 수업의 이탈리아 교육부에서 MF (MFAG 11676)에 암 연구를위한 이탈리아 협회 (AIRC)로부터 MN에 자금을 지원하는 MN에 대한 연구 FIRB 2011 (프로젝트 RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics