Circulando MicroRNA Quantificação Usando DNA de ligação Dye Química e Gota Digital PCR

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Circulating (da isentos de células) microARNs (miARNs) são libertados a partir de células para a corrente sanguínea. A quantidade de microARNs específicos na circulação tem sido associada a um estado de doença e tem o potencial de ser utilizado como biomarcador da doença. Um método sensível e preciso para a circulação de microARN quantificação usando uma química à base de corantes e gota a tecnologia de PCR digital foi desenvolvido recentemente. Especificamente, utilizando Locked Nucleic Acid (LNA) à base de iniciadores específicos de miARN com um corante de ligação a ADN fluorescente verde num sistema de PCR compatível gota digital, é possível obter a quantificação absoluta de miARNs específicos. Aqui, nós descrevemos como realizar esta técnica para avaliar a quantidade de miARN em fluidos biológicos, tais como plasma e soro, é viável e eficaz.

Protocol

Isolamento MicroRNA a partir de plasma ou soro

Nota: Plasma e preparação do soro é um passo importante na circulação de miRNA quantificação. Não há nenhum procedimento preferido para o plasma e preparação do soro. A única coisa importante a considerar é que todas as amostras de um mesmo experimento deve ser processado usando exatamente o mesmo fluxo de trabalho. Iniciar a partir de soro ou de plasma de 200 ul. O ARN total pode ser isolado a partir de soro ou plasma, utilizando kits disponíveis comercialmente.

1. Protocolo para RNA total (incluindo miRNA) Isolamento

  1. As amostras de soro / plasma descongelamento em gelo.
  2. Adicionar 1 ml de Reagente de Lise (por ex., QIAzol) a 200 ul de soro / plasma.
  3. Misturar em vortex e colocar o tubo contendo o homogeneizado no banco à TA durante 5 min.
  4. Adicionar 3 ml de uma solução 4,16 nM de miARN CEL-miR-39-3p sintético de C. elegans.
  5. Adicionar 200 ul de clorofórmio. Agitar o tubo vigorosamente durante 15 sec. º lugare tubo no banco à TA, durante 2 min.
  6. Centrifugar durante 15 minutos a 12000 xg, a 4 ° C para se obter a separação fases: a fase aquosa superior contém ARN.
  7. Transferir a fase aquosa para um novo tubo, cerca de 700 ul, evitar a transferência de qualquer material interfase branca.
  8. Adicionar 1 ml de etanol a 100% e misturar por inversão.
  9. Pipeta-se 700 mL da amostra para uma coluna mini-rotação colocado em um tubo de recolha de 2 ml. Fechar a tampa e centrifugar a 12000 xg durante 15 seg. Descartar o fluxo de passagem.
  10. Repita este passo usando a amostra restante.
  11. Adicionar 700 mL de buffer ERP para o mini coluna de rotação, feche a tampa e centrifugar por 15 segundos a 12.000 xg para lavar a coluna. Descartar o fluxo de passagem.
  12. Pipetar 500 ul de tampão de RPE para o mini coluna de centrifugação. Feche a tampa e centrifugar por 15 segundos a 12.000 rpm. Descartar o fluxo de passagem. Repita este passo novamente.
  13. Centrifugar o mini coluna de centrifugação à velocidade máxima por 2 minutos para secar a coluna de spinmembrana a partir de etanol residual.
  14. Transferir o mini coluna de centrifugação para um novo tubo de recolha de 1,5 ml e pipeta 35 ul de água isenta de RNase na membrana da coluna.
  15. Centrifugar durante 1 minuto a 12000 xg para eluir o ARN.
  16. Armazenar o ARN a -80 ° C.
    Nota: Uma vez que a concentração de RNA não pode ser determinada com precisão, use volumes fixos como uma medida para a quantidade de entrada.

2. MicroRNA Transcrição Reversa

  1. Descongelar a transcrição reversa (RT) componentes de mistura de reagente de tampão de reacção: 5x, água isenta de nuclease. Misture suavemente, invertendo os tubos e colocar no gelo. Imediatamente antes da utilização, retire a mistura de enzimas do congelador e colocar no gelo. Spin down todos os reagentes.
  2. Preparar a mistura de reagente de RT em gelo tal como descrito na Tabela 1. Preparar pelo menos 10% de mistura superior.
  3. Misture a reacção por pipetagem, e, em seguida girar para baixo.
  4. Incubar durante 60 min a 42 ° C.
  5. Calor-inactivar a reverSE transcriptase durante 5 min a 95 ° C.
  6. Imediatamente fria a 4 ° C.
  7. Armazenar o cDNA a -20 ° C.

3. cDNA Diluição

  1. Diluir a quantidade de modelo de cDNA necessária para as reações ddPCR planejadas em água livre de nuclease. Dilui-se a reacção de ADNc entre 1:50 e 1: 500 em água, dependente da abundância alvo miARN. Armazenar o ADNc diluída a -20 ° C. O cDNA diluído provou ser estável durante pelo menos 3 meses a -20 ° C.

4. gota Geração e PCR

Nota: A geração da gota deve ser realizada em 8 amostras de cada vez. Repetições técnicas não são necessárias, devido à elevada reprodutibilidade desta tecnologia 12,15 .A Nenhum modelo de controlo (NTC) amostra deve ser executado em cada placa, e para cada condição ddPCR diferente.

  1. Descongelar e equilibrar a mistura principal (por exemplo., EvaGreen Mix Master), microRNA conjunto de primers e cDNA à temperatura ambiente.
  2. Misturar o th Mistura Principaloroughly invertendo o tubo várias vezes. Spin down todos os reagentes.
  3. Preparar a mistura de ddPCR como descrito na Tabela 2. Quando várias reacções são realizadas ddPCR, preparar um ddPCR misturar-solução de trabalho. Preparar pelo menos 10% de mistura superior.
  4. Uma vez montado, misturar cuidadosamente e girar a mistura ddPCR.
  5. Pipetar 12 ul de ddPCR misturar em uma placa com 96 poços de PCR ou tubos PCR.
  6. Adicionar 8 mL de modelo de cDNA diluído a cada tubo / poço.
  7. Insira o cartucho gerador de gotículas no suporte.
  8. Transferir 20 uL de cada amostra para os poços de amostra (linha do meio) do cartucho gerador de gota cuidadosamente, evitando bolhas de ar na parte inferior do poço.
  9. Encha cada poço de petróleo (linha de fundo) com 70 l de óleo gerador de gota.
  10. Gancho a junta sobre o suporte do cartucho e insira no gerador de gota.
  11. Feche a tampa para iniciar a geração de gotículas de acordo com a pr do fabricanteotocol. Quando a geração de gota tenha terminado, abra a tampa, retire a junta descartável. Os poços superior do cartucho conter as gotículas.
  12. Pipetar lenta e suavemente 40 ul do conteúdo dos oito poços de topo (as gotas) em uma única coluna de uma placa de 96 poços de PCR.
  13. Selar a placa PCR com a folha imediatamente após a transferência de gotas para evitar a evaporação. Use selos perfuráveis ​​placa de folha que são compatíveis com as agulhas no leitor de gotícula.
  14. Comece a ciclos térmicos (PCR) no prazo de 30 min de selagem da placa.
  15. Execute o protocolo de ciclismo de acordo com a Tabela 3.

5. Gota Reading

  1. Ligue o leitor de gota.
  2. Mover a placa do termociclador para o leitor gota.
  3. Colocar a placa de PCR de 96 poços contendo as gotículas de pós-PCR para a base de suporte da placa.
  4. Coloque a parte superior de suporte da placa sobre a placa de PCR. Pressione firmemente ambos os guias de liberaçãopara baixo para fixar a placa de PCR no suporte.
  5. Inicie o software do PC do sistema.
    1. Clique em Configurar para definir o experimento (quantificação absoluta), em seguida, clique em Executar para iniciar a leitura gota.
    2. Quando leitura gota está completa, clique em "Analisar" botão para abrir e analisar os dados.
    3. Use o enredo amplitude 2D no software de análise para selecionar as gotículas positivos (Lasso Tool) (Figura 1B).
    4. Use a guia Eventos para verificar o número de gotículas positivos e totais. Um número total de 18.000 - 21.000 gotículas é geralmente obtida com probeless ddPCR.
    5. Uma vez que as gotículas positivos são seleccionados, exportar os valores de concentração de miRNA usando a opção de exportação .csv a partir da guia Concentração.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

A quantidade absoluta de miARNs específicos por mililitro de plasma ou soro pode ser determinada utilizando um corante de ligação a ADN fluorescente verde e gota a tecnologia de PCR digital. A Figura 1 apresenta o processo de selecção do gotículas positivo, o qual determina a concentração final de miARN (cópias / ul ) na reacção de amplificação calculada pelo software de análise. A quantidade de cada um miARN no sangue é muito diferente, sendo algumas espécies de miARN mais abundantes do que os outros. Utilizando um ADNc diluída 1:50 em reacção ddPCR é possível obter um número adequado de gotas positivos e negativos. No caso de a saturação das gotículas positivos (por exemplo., Não há gotas restantes negativas), uma diluição adicional de amostras de cDNA pode ser necessário.

Cada conjunto de primers LNA deve ser otimizado para funcionar corretamente no sistema de PCR digital de gota. O processo de otimização para miR-181.º-5p érepresentado na Figura 2 Especificamente, alterando a quantidade de iniciador (normalmente na gama de 0,25-1 ul por reacção ddPCR). e a temperatura de recozimento (normalmente na gama de 56-60 ° C), é possível seleccionar a combinação que determina uma melhor separação entre as gotículas positivos e negativos. No caso de miR-181 ° -A-5p, 60 ° C Temperatura de recozimento e ambos os valores 0,5 e 1 ul de iniciador proporcionar o melhor resultado em termos de amplitude gota.

Pode acontecer que um conjunto de primers dá alguma amplificação não específica, provavelmente devido à Primer-dímeros de formação. Quando se trabalha com circulação miARNs, o sinal positivo a partir de amostras pode ser muito baixa e, por conseguinte, semelhante ao sinal não específico. Se o "nuvem" de amplificação alvo não específica não se sobrepõe com o verdadeiro sinal (Figura 1C), o miARN pode ainda ser quantificado seleccionar apenas a verdadeira gotículas positivos. Neste caso, a amostra NTC é essencial para a selecção das gotículas. Todas as amostras a serem incluídos na mesma análise precisa de ser processado usando a mesma metodologia e condição ddPCR idênticos.

figura 1
Figura 1. Gotas positivos Seleção. Gotículas positivos são seleccionados manualmente durante a análise utilizando um limiar acima das gotas negativos em 1D lote (A) ou a realização de um círculo em torno da nuvem de gotículas positiva no lote 2D (B). Se algum conjunto de primers dá uma amplificação não específica, isso é evidenciado por uma segunda nuvem de gotículas positivos que aparece no controle negativo (No Control Template, NTC) amostra (C). Os "verdadeiros" positivos ainda podem ser selecionados excluindo o sinal não específico no lote 2D.E.jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Optimization Primer para livre-Cell miRNA Quantificação com Probeless ddPCR Painel superior:. Quantificação de miR-181.º-5p em duas amostras de plasma (S1 e S2), utilizando 4 diferentes condições ddPCR. Mir-181.º-5p concentração LNA primário (0,5 e 1 ml) e a temperatura de recozimento (58 e 60 ° C) afetam a amplitude do positivo (azul) e gotículas negativo (preto) no corante intercalando DNA ddPCR. Uma melhor separação para este miARN pode ser obtido realizando a PCR a 60 ° C e utilizando 0,5 ou 1 ul de iniciador. A amostra de controlo (NTC, Nenhum modelo de controlo) não tem gotículas positivas, como se esperava. painel central: A concentração final de miR-181-5p nas condições acima mencionadas. Os resultados são apresentados como cópias por microlitro no amplireação ficação. As barras de erro representam os 95% de intervalo de confiança de Poisson. Painel inferior:. Número de gotículas positivos (azul) sobre o número total de gotas (verde) Por favor clique aqui para ver uma versão maior desta figura.

Reagente Volume (uL)
5x tampão de reacção 4
água livre de nuclease 11
mistura de enzima 2
ARN total Molde 3
Volume total 20

Tabela 1 - transcrição reversa de Reagentes Componentes Mix

Reagente Volume (uL)
2x DNA-ligação de corante Supermix 10
LNA conjunto de primers variável (0,5 - 1) *
água livre de nuclease variável
modelo de cDNA diluído 8
Volume total 20
* A primeira reação ddPCR deve ser apresentar com algumas amostras para determinar o montante mais trabalho de primer

Tabela 2 - Componentes ddPCR Reagente Mix

ciclismo Etapa Temperatura Tempo rampa Taxa Cycles
activação da enzima 95 ° C 5 min ~ 2 ° C / segundo 1
desnaturação 95 ° C 30 seg 40
Recozimento / extensão 60 ° C 1 minuto
estabilização do sinal 4 ° C 5 min 1
90 ° C 5 min 1
Espera (opcional) 4 ° C infinito 1
Utilize uma tampa aquecida definido para 105 ° C e definir o volume da amostra de 40 ul.

Tabela 3 - Condições de ciclos térmicos para Gota Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

miARNs circulantes estão presentes no sangue em concentrações extremamente baixas e a quantidade de ARN que pode ser extraída a partir de amostras de plasma e soro é baixa. Por esta razão, eles são difíceis de quantificar com outras técnicas tais como a sequenciação de ARN e micro-arranjo. Além disso, há uma falta generalizada de acordo com a normalização de dados e a presença de miARNs endógenos de "referência" no sangue. Neste contexto, uma tecnologia de PCR sensíveis, como digitais gota, capaz de contar o número de miARN cópias por ml de soro ou plasma, mesmo muito baixa, é muito atraente. Nós emparelhado com esta tecnologia com um sistema de cDNA universal que inverter-transcreve todos os miRNAs circulantes em uma reação, portanto, economizando tempo e, mais importante, materiais RNA. Na nossa abordagem, a especificidade é inerente ao uso de iniciadores de LNA, um desempenho muito bom em miARN quantificação quando em comparação com outras soluções de 16.

Gotadigital de PCR é um ensaio de ponto final que permite o cálculo da concentração absoluta genes alvo. Ao contrário de PCR quantitativa, eficiências de amplificação inadequados não afectam a quantificação final da ddPCR. Portanto, considerando a quantidade de inibidores da PCR presentes, por exemplo, em amostras de sangue, ddPCR fornece uma ferramenta robusta para a circulação de avaliação de ácidos nucleicos.

Devido à sua alta sensibilidade, a tecnologia proporciona uma quantificação adequada também dos miARNs menos abundantes, mesmo com uma quantidade limitada de material de partida. Além disso, assumindo que cada molécula de miARN é transcrito de forma inversa em uma molécula de cDNA, pode-se calcular as cópias absolutos em 1 ul de plasma / soro multiplicando a concentração obtida no valor reacção ddPCR por um factor de diluição (145.83).

O fluxo de trabalho apresentado pode ser facilmente realizado em 8-96 amostras de cada vez, proporcionando assim uma ferramenta eficaz e fiável para a quantificação tempo microARN em clinical amostras. Gota PCR digital tem potencial para se tornar uma ferramenta essencial para os ácidos nucleicos biomarcadores avaliação em um cenário de diagnóstico, trazendo assim biópsia líquido da bancada à cabeceira.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Apoiado pelo financiamento da Associação Italiana de Investigação do Cancro (AIRC) para MF (MFAG 11676) e MN (Oncologia Clínica Programa Especial Molecular -. 5 por mille n 9980, 2010/15) e do Ministério Italiano da Instrução, da Universidade e FIRB Research 2011 para MN (Project RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics