Circulant microARN Quantification Utilisation DNA-binding Dye Chemistry and Droplet PCR numérique

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Circulant (des sans cellules) microARN (miARN) sont libérés à partir de cellules dans le flux sanguin. La quantité de micro-ARN spécifique dans la circulation a été liée à un état pathologique et a le potentiel pour être utilisé en tant que marqueur biologique de la maladie. Une méthode sensible et précis pour la circulation microRNA quantification en utilisant une chimie à base de colorants et des gouttelettes de la technologie PCR numérique a été récemment mis au point. Plus précisément, à l'aide Locked Nucleic Acid (LNA) à base d'amorces spécifiques de miARN avec un colorant fluorescent de liaison à l'ADN vert dans un système de PCR compatible avec des gouttelettes numérique, il est possible d'obtenir la quantification absolue des miARN spécifiques. Ici, nous décrivons comment effectuer cette technique pour évaluer le montant de miARN dans les liquides biologiques, tels que le plasma et le sérum, est à la fois faisable et efficace.

Protocol

MicroARN Isolation du plasma ou du sérum

Remarque: Le plasma et la préparation de sérum est une étape pertinente dans la circulation miRNA quantification. Il n'y a pas de procédure préférée pour le plasma et la préparation du sérum. La seule chose importante à considérer est que tous les échantillons de la même expérience doivent être traitées en utilisant exactement le même workflow. À partir de sérum de 200 pi ou de plasma. L'ARN total peut être isolé à partir de sérum ou de plasma en utilisant des kits disponibles dans le commerce.

1. Protocole pour l'ARN total (y compris miRNA) Isolation

  1. des échantillons de sérum / plasma Décongeler sur la glace.
  2. Ajouter 1 ml de réactif de lyse (par ex., QIAzol) à 200 ul de sérum / plasma.
  3. Mélanger par tourbillonnement et placer le tube contenant le broyat sur le banc à température ambiante pendant 5 min.
  4. Ajouter 3 ul d'une solution nM 4.16 du miRNA cel-miR-39-3p synthétique de C. elegans.
  5. Ajouter 200 ul de chloroforme. Agiter vigoureusement le tube pendant 15 sec. La place etube e sur le banc à température ambiante pendant 2 min.
  6. Centrifuger pendant 15 min à 12 000 xg à 4 ° C pour obtenir la séparation des phases: la phase aqueuse supérieure contenant l'ARN.
  7. Transférer la phase aqueuse dans un nouveau tube, environ 700 ul, éviter tout transfert de matériel d'interphase blanche.
  8. Ajouter 1 ml d'éthanol à 100% et mélanger par retournement.
  9. Pipeter jusqu'à 700 ul de l'échantillon dans une colonne de centrifugation de mini placée sur un tube collecteur de 2 ml. Fermer le couvercle et centrifuge à 12.000 xg pendant 15 sec. Jeter l'écoulement.
  10. Répétez cette étape en utilisant l'échantillon restant.
  11. Ajouter 700 ul de tampon RWT à la colonne de spin mini fermer le couvercle et centrifuger pendant 15 secondes à 12.000 xg pour laver la colonne. Jeter l'écoulement.
  12. Pipet 500 ul de tampon RPE dans la colonne de spin Mini. Fermer le couvercle et centrifuger pendant 15 secondes à 12000 rpm. Jeter l'écoulement. Répétez cette étape.
  13. Centrifuger la colonne de spin mini-à pleine vitesse pendant 2 minutes pour sécher la colonne de spinune membrane à partir d'éthanol résiduel.
  14. Transférer la colonne spin mini-à un nouveau tube de 1,5 ml de collecte et de l'eau libre de RNase-pipette 35 ul sur la membrane de la colonne.
  15. Centrifuger pendant 1 min à 12 000 xg pour éluer l'ARN.
  16. Stocker l'ARN à -80 ° C.
    Remarque: Comme la concentration d'ARN ne peut pas être déterminée avec précision, utiliser des volumes fixes comme une mesure de quantité d'entrée.

2. microARN Reverse Transcription

  1. Décongeler la transcription inverse (RT) des composants réactifs de mélange: 5x tampon de réaction, de l'eau sans nucléase. Mix retournant doucement les tubes et les placer sur la glace. Immédiatement avant utilisation, retirer le mélange d'enzymes du congélateur et placer sur de la glace. Isoler tous les réactifs.
  2. Préparer le mélange de réactifs RT sur la glace comme décrit dans le tableau 1. Préparer au moins 10% supérieure à mélange.
  3. Mélanger la réaction par pipetage, puis tourner vers le bas.
  4. Incuber pendant 60 min à 42 ° C.
  5. Heat-inactiver le reverse transcriptase pendant 5 min à 95 ° C.
  6. Immédiatement refroidir à 4 ° C.
  7. Stocker l'ADNc à -20 ° C.

3. ADNc Dilution

  1. Diluer la quantité d'ADNc modèle nécessaire pour les réactions ddPCR prévues dans l'eau sans nucléase. Diluer la réaction d'ADNc entre 1:50 et 1: 500 dans l'eau, en fonction de la cible miARN abondance. Stocker l'ADNc dilué à -20 ° C. L'ADNc dilué avéré être stable pendant au moins 3 mois à -20 ° C.

4. Génération et Gouttelette PCR

Remarque: la génération de gouttelettes doit être effectuée sur 8 échantillons à la fois. Réplicats techniques ne sont pas nécessaires, en raison de la grande reproductibilité de cette technologie 12,15 .Un contrôle sans matrice (NTC) échantillon doit être exécuté dans chaque plaque et pour chaque condition de ddPCR différente.

  1. Décongeler et équilibrer le mélange maître (par ex., EvaGreen Master Mix), microRNA ensemble d' amorces et d' ADNc à la température ambiante.
  2. Mélanger le th Master Mixoroughly en renversant le tube plusieurs fois. Isoler tous les réactifs.
  3. Préparer le mélange ddPCR comme décrit dans le tableau 2. Lorsque plusieurs réactions ddPCR sont effectuées, préparer un ddPCR mélanger travail-solution. Préparer au moins 10% supérieure à mélange.
  4. Une fois assemblé, bien mélanger et centrifuger le mélange ddPCR.
  5. Distribuer 12 pi de ddPCR mélanger dans un 96 puits plaque PCR ou tubes PCR.
  6. Ajouter 8 pi de matrice d'ADNc dilué dans chaque tube / puits.
  7. Insérer la cartouche de générateur de gouttelettes dans le support.
  8. Transférer 20 pl de chaque échantillon préparé dans les puits d'échantillon (ligne médiane) de la cartouche du générateur de gouttelettes avec précaution, tout en évitant les bulles d'air au fond du puits.
  9. Remplir chaque puits de pétrole (rangée du bas) avec 70 pi d'huile générateur de gouttelettes.
  10. Accrocher le joint sur le support de cartouche et l'insérer dans le générateur de gouttelettes.
  11. Fermez le couvercle pour lancer la génération de gouttelettes selon la pr fabricantotocole. Lorsque la génération des gouttelettes est terminée, ouvrir le couvercle, retirer le joint jetable. Les premiers puits de la cartouche contiennent des gouttelettes.
  12. Pipet lentement et en douceur 40 pl du contenu des puits supérieurs huit (les gouttelettes) dans une seule colonne d'une plaque à 96 puits PCR.
  13. Sceller la plaque PCR avec une feuille immédiatement après le transfert de gouttelettes pour éviter l'évaporation. Utiliser les joints d'étanchéité perforable plaque d'aluminium qui sont compatibles avec les aiguilles dans le lecteur de gouttelettes.
  14. Commencez le cycle thermique (PCR) dans les 30 min de la plaque d'étanchéité.
  15. Effectuer le protocole de cyclisme selon le tableau 3.

5. Droplet Reading

  1. Allumez le lecteur de gouttelettes.
  2. Déplacer la plaque par rapport au cycleur thermique pour le lecteur de gouttelettes.
  3. Placer la plaque PCR 96 puits contenant les gouttelettes post-PCR dans la base du support de plaque.
  4. Placer la partie supérieure du support de plaque sur la plaque de PCR. Appuyez fermement sur les deux pattes de dégagementvers le bas pour fixer la plaque de PCR dans le support.
  5. Démarrez le logiciel du système PC.
    1. Cliquez sur Configuration pour définir l'expérience (quantification absolue) puis cliquez sur Exécuter pour démarrer la lecture des gouttelettes.
    2. Lorsque gouttelette lecture est terminée, cliquez sur "Analyser" bouton pour ouvrir et analyser les données.
    3. Utilisez le tracé d'amplitude 2D dans le logiciel d'analyse pour sélectionner les gouttelettes positives (outil Lasso) (Figure 1B).
    4. Utilisez l'onglet Événements pour vérifier le nombre de gouttelettes positifs et totaux. Un nombre total de 18.000 - 21.000 gouttelettes est habituellement réalisé avec ddPCR sans sonde.
    5. Une fois que les gouttelettes positives sont sélectionnées, exporter les valeurs de concentration miRNA en utilisant l'option de l'exportation à partir de l'onglet Concentration.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La quantité absolue de miARN spécifiques par ml de plasma ou le sérum peut être déterminée en utilisant un colorant fluorescent de liaison à l' ADN vert et des gouttelettes de la technologie de PCR numérique. La figure 1 présente le processus de sélection-gouttelettes positif, ce qui détermine la concentration finale miRNA (copies / ul ) dans la réaction d'amplification calculée par le logiciel d'analyse. Le montant de chaque miARN dans le sang est très différent, étant certaines espèces miRNA plus abondantes que d'autres. En utilisant un ADNc dilué à 1:50 dans la réaction ddPCR il est possible d'obtenir un nombre suffisant de gouttelettes positives et négatives. En cas de saturation positif de gouttelettes (par exemple., Pas de gouttelettes négatives restantes), une nouvelle dilution des échantillons d' ADNc pourrait être nécessaire.

Chaque ensemble d'amorces de LNA doit être optimisé pour fonctionner correctement sur le système PCR numérique gouttelette. Le processus d'optimisation pour miR-181a-5p estreprésentée sur la figure 2 Plus précisément, en changeant la quantité d'amorce (habituellement dans la gamme de 0,25 à 1 ul par réaction ddPCR). et la température de recuit (habituellement dans la gamme de 56 - 60 ° C), il est possible de sélectionner la combinaison qui détermine une meilleure séparation entre les gouttelettes positives et négatives. Dans le cas de miR-181a-5p, 60 ° C la température de recuit et les deux montants de 0,5 et 1 pl d'amorce fournir le meilleur résultat en termes de gouttelettes d'amplitude.

Il peut arriver qu'un ensemble d'amorces donne une amplification non spécifique, probablement due à l'amorce-dimères formation. Lorsque vous travaillez avec circulation miARN, le signal positif à partir d'échantillons pourrait être très faible et donc similaire au signal non spécifique. Si le «nuage» d'amplification cible non spécifique ne chevauche pas avec le signal vrai (figure 1C), le miARN peut encore être quantifiée en sélectionnant uniquement la vraie gouttelettes positives. Dans ce cas, l'échantillon de NTC est essentielle pour la sélection des gouttelettes. Tous les échantillons à inclure dans la même analyse doivent être traitées en utilisant la même méthodologie et identique état ddPCR.

Figure 1
Figure 1. Gouttelettes positifs de sélection. Gouttelettes positives sont sélectionnées manuellement lors de l'analyse à l' aide d' un seuil au- dessus des gouttelettes négatives en 1D parcelle (A) ou d' effectuer un cercle autour du nuage de gouttelettes positif dans la parcelle 2D (B). Si certains jeu d'amorces donne une amplification non spécifique, cela se traduit par un deuxième nuage de gouttelettes positives qui apparaît dans le contrôle négatif (No Control Template, NTC) échantillon (C). Les "vrais" positifs peuvent encore être sélectionnés à l'exclusion du signal non spécifique dans la parcelle 2D.f.jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Optimisation de Primer gratuitement Cell-miARN Quantification avec ddPCR Panneau supérieur Sans sonde. Quantification de miR-181a-5p dans deux échantillons de plasma (S1 et S2) à l' aide de 4 conditions ddPCR différentes. MiR-181a-5p concentration LNA primaire (0,5 et 1 pi) et la température de recuit (58 et 60 ° C) affectent l'amplitude positive (bleu) et (noir) gouttelettes négatives dans la teinture d'ADN-intercalant ddPCR. Une meilleure séparation de ce miRNA peut être obtenue effectuer la PCR à 60 ° C et en utilisant 0,5 ou 1 pi de l'amorce. L'échantillon témoin (NTC, No Control Template) n'a pas de gouttelettes positives, comme prévu. Panneau central: La concentration finale de miR-181-5p dans les conditions mentionnées ci-dessus. Les résultats sont présentés sous forme de copies par microlitre dans l'ampliréaction de cation. Les barres d'erreur représentent Poisson 95% intervalle de confiance. Panneau inférieur:. Nombre de gouttelettes positives (bleu) sur le nombre total de gouttelettes (vert) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Réactif Volume (ul)
5x tampon de réaction 4
l'eau exempte de nucléase 11
mélange d'enzymes 2
ARN total Template 3
Volume total 20

Tableau 1 - transcription inverse Réactif Composants Mix

Réactif Volume (ul)
2x liaison à l'ADN de colorant Supermix dix
LNA amorce ensemble variables (0,5 - 1) *
l'eau exempte de nucléase variable
Dilué matrice d'ADNc 8
Volume total 20
* Une première réaction ddPCR doit être effectuer avec quelques échantillons pour établir le montant le plus de travail d'apprêt

Tableau 2 - ddPCR Réactif Composants Mix

cyclisme Etape Température Temps Ramping Taux Cycles
activation enzymatique 95 ° C, 5 min ~ 2 ° C / s 1
Dénaturation 95 ° C, 30 sec 40
Recuit / poste 60 ° C, 1 minute
la stabilisation du signal 4 ° C 5 min 1
90 ° C, 5 min 1
Maintien (en option) 4 ° C infini 1
Utilisez un couvercle chauffant réglé à 105 ° C et régler le volume de l'échantillon à 40 pi.

Tableau 3 - Thermal vélo Conditions pour Droplet PCR numérique

Subscription Required. Please recommend JoVE to your librarian.

Discussion

miARN circulantes sont présents dans le sang à des concentrations extrêmement faibles et la quantité d'ARN qui peut être extrait à partir d'échantillons de plasma et de sérum est faible. Pour cette raison, il est difficile de quantifier avec d'autres techniques telles que la puce à ADN et le séquençage de l'ARN. De plus, il y a un manque généralisé d'accord sur la normalisation des données et la présence de miARN "de référence" endogènes dans le sang. Dans ce contexte, une technologie sensible comme gouttelette PCR numérique, capable de compter le nombre de copies miRNA par ml de sérum ou de plasma, même si elle est très faible, est très attrayant. Nous avons associé cette technologie avec un système d'ADNc universel qui reverse-transcrit tous les miARN circulant dans une seule réaction donc gain de temps et, le plus important, le matériel de l'ARN. Dans notre approche, la spécificité est inhérente à l'utilisation d'amorces de LNA, qui ont effectué très bien en miRNA quantification par rapport à d' autres solutions 16.

Gouttelettenumérique PCR est un essai point final qui permet le calcul des gènes cibles de concentration absolue. Contrairement à la PCR quantitative, l'efficacité d'amplification inadéquates ne touchent pas la quantification finale ddPCR. Par conséquent, compte tenu de la quantité d'inhibiteurs de PCR présents par exemple dans des échantillons de sang, ddPCR fournit un outil robuste pour la circulation nucléique évaluation des acides.

En raison de sa haute sensibilité, la technologie fournit une quantification adéquate aussi des miARN moins abondantes, même avec une quantité limitée de matériau de départ. En outre, en supposant que chaque molécule miARN est transcrit de manière inverse dans une molécule d'ADNc, on peut calculer les copies absolues dans 1 pi de plasma / sérum en multipliant la concentration obtenue dans ddPCR valeur de réaction d'un facteur de dilution (145,83).

Le flux de travail présenté peut être facilement effectuée sur 8-96 échantillons à la fois, offrant ainsi un outil fiable et efficace du temps pour microRNA quantification dans clinical échantillons. Droplet PCR numérique a le potentiel de devenir un outil essentiel pour les acides nucléiques évaluation biomarqueurs dans un cadre de diagnostic, apportant ainsi une biopsie liquide du banc au chevet.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Soutenu par un financement de l'Association italienne pour la recherche sur le cancer (AIRC) MF (MFAG 11676) et MN (Molecular Programme spécial Clinical Oncology -. 5 pour mille n 9980, 2010/15) et du ministère italien de l'Instruction, de l'Université et Research FIRB 2011 MN (projet RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics