MicroRNA Niceleme DNA bağlayıcı Boya Kimya ve Damlacık Dijital PCR kullanarak Sirkülasyon

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

mikroRNA (miRNA'ların) (hücre içermeyen) dolaşımdaki kan akışı içine hücrelerden salınırlar. dolaşımdaki Belirli mikroRNA miktarı bir hastalık durumu ile bağlantılı hastalık belirteç olarak kullanılmak üzere bir potansiyele sahip olmuştur. Dijital PCR teknolojisi bir boya temelli kimya kullanılarak ve damlacık microRNA ölçümü dolaşan için hassas ve doğru bir yöntem son zamanlarda geliştirilmiştir. Spesifik olarak, nükleik asit (LNA) belirli miRNA'ların mutlak miktarının elde edilmesi mümkün olmaktadır, uyumlu bir damlacık dijital PCR sisteminin yeşil floresan DNA bağlayıcı boya ile miRNA spesifik primerler tabanlı Kilitli kullanılarak. Burada, bu tekniği gerçekleştirmek gibi plazma ve serum gibi biyolojik sıvılarda, içinde miRNA miktarını değerlendirmek için nasıl tarif uygulanabilir ve etkili hem de.

Protocol

Plazma ya da serum gelen mikroRNA İzolasyon

Not: Plazma ve serum hazırlama miRNA miktarının dolaşımdaki ilgili bir adımdır. plazma ve serum hazırlanması için herhangi bir tercih işlemi yoktur. dikkate Önemli olan tek şey aynı deneyden tüm örnekler aynı iş akışı kullanarak işlenmelidir olmasıdır. 200 ul serum veya plazmadan başlayın. Toplam RNA ticari olarak temin edilebilir kitler kullanılarak serum veya plazma izole edilebilir.

1. (miRNA dahil) Toplam RNA Protokolü İzolasyon

  1. Buz üzerinde Çözülme serum / plazma örnekleri.
  2. 200 ul serum / plazma liziz reaktifi (örn., QIAzol) 1 ml ilave edilir.
  3. vorteks karışım, 5 dakika boyunca oda sıcaklığında tezgah üzerinde Homojenat içeren tüp yerleştirin.
  4. C. sentetik miRNA cel-miR-39-3p bir 4.16 nM çözeltisi 3 ul ekleyin elegans.
  5. kloroform 200 ul ekle. 15 saniye boyunca kuvvetlice tüpü çalkalayın. Yeri inci2 dakika boyunca oda sıcaklığında tezgah e tüpü.
  6. 4 ° C'de 12,000 x g'de 15 dakika boyunca santrifüj aşamaları ayırma elde etmek üzere, üst sulu faz RNA içerir.
  7. , Yeni bir tüpe 700 ul sulu faz transfer herhangi bir beyaz interfaz malzeme transferini engellemek.
  8. % 100 etanol 1 ml ilave edilir ve çevirerek karıştırın.
  9. Pipet yukarı mini spin kolon içine numune 700 ul 2 ml toplama tüpü yerleştirilir. 15 saniye boyunca 12.000 xg'de kapağı ve santrifüj kapatın. flow-through atın.
  10. Kalan örnek kullanarak bu adımı yineleyin.
  11. Mini döndürme kolonuna 700 ul Tampon RWT ekle sütunu yıkamak için 12,000 xg'de 15 sn için kapağı ve santrifüj kapatın. flow-through atın.
  12. Mini spin kolon içine Pipetleyin 500 ul Tampon RPE. 12.000 rpm'de 15 saniye boyunca kapağı ve santrifüj kapatın. flow-through atın. Yine bu adımı yineleyin.
  13. spin kolon kurumasını 2 dakika süreyle tam hızda mini spin kolon santrifüjKalıntı etanolden membran.
  14. Sütunun membran üzerinde yeni bir 1.5 ml'lik bir toplama tüpü ve damlalıklı 35 mL RNaz içermeyen su mini spin kolon aktarın.
  15. RNA elüte etmek için 12,000 x g'de 1 dakika boyunca santrifüj.
  16. -80 ° C'de RNA saklayın.
    Not: RNA konsantrasyonu, doğru olarak belirlenebilir edemediğinden, giriş miktarı için bir ölçü olarak, sabit hacimli kullanımı.

2. mikroRNA Ters Transkripsiyon

  1. 5x reaksiyon tamponu, nükleaz içermeyen su: ters transkripsiyon (RT) reaktif karışımı bileşenleri çözülme. Yavaşça karıştırın buz üzerinde tüpler ve yeri tersini. Kullanımdan hemen önce, dondurucudan enzim karışımı çıkarın ve buz üzerine yerleştirin. tüm reaktifler aşağı doğru döndürün.
  2. Tablo 1 'de tarif edildiği gibi buz üzerinde RT reaktif karışımı hazırlayın. En az% 10 aşan karışımı hazırlayın.
  3. Pipetleme tarafından reaksiyonu karıştırın ve daha sonra aşağı doğru döndürün.
  4. 42 ° C'de 60 dakika boyunca inkübe edin.
  5. Rever Isı inaktive95 ° C'de 5 dakika boyunca SE transkriptaz.
  6. Hemen ardından 4 ° C'ye soğutun.
  7. -20 ° C'de cDNA saklayın.

3. cDNA Sulandırma

  1. nükleaz içermeyen su içinde planlanan ddPCR reaksiyonları için gerekli olan cDNA şablon miktarının seyreltilir. 1:50 ve 1 arasında cDNA reaksiyonu sulandırmak: 500 suda, hedef miRNA bereket bağlıdır. -20 ° C'de seyreltilmiş cDNA saklayın. seyreltilmiş cDNA -20 ° C'de en az 3 ay boyunca stabil olduğu kanıtlanmıştır.

4. damlacık oluşturma ve PCR

Not: damlacık oluşturma her seferinde 8 numuneler üzerinde yapılmalıdır. Teknik çoğaltır nedeniyle 12,15 .A Şablonsuz kontrol (NTC) bir numunesi, her plaka çalıştırılmalıdır bu teknolojinin yüksek ölçüde tekrarlanabilirliği ve her biri farklı ddPCR durum için gerekli değildir.

  1. Çözülme ve ana karışımı dengeye (örn., EvaGreen Master Mix) oda sıcaklığında, mikroRNA primer seti ve cDNA.
  2. Master Mix th Mixoroughly Tüpü birkaç kez baş aşağı çevirerek. tüm reaktifleri aşağı doğru döndürün.
  3. Tablo 2'de tarif edildiği gibi ddPCR karışımı hazırlayın. Birden ddPCR reaksiyonlar gerçekleşirken zaman, ddPCR çalışma-çözeltisi karışımı hazırlayın. en az% 10 aşan karışımı hazırlayın.
  4. monte kez iyice karıştırın ve ddPCR karışımı aşağı doğru döndürün.
  5. ddPCR 12 ul, 96 oyuklu bir plaka, PCR ya da PCR tüpleri içine karıştırmak dağıtın.
  6. de / her bir tüpe seyreltildi cDNA şablonunun 8 ul ekle.
  7. tutucu içine damlacık jeneratör kartuşu takın.
  8. Aktarım hava kaçınarak kuyunun dibinde kabarcıkları dikkatle ise damlacık jeneratör kartuşunun örnek kuyu (orta sıra) her Hazırlanan numune 20 ul.
  9. damlacık jeneratör yağı 70 ul her petrol kuyusu (alt sıra) doldurun.
  10. kartuş yuvasına üzerinde conta kanca ve damlacık jeneratör yerleştirin.
  11. Üreticinin pr göre damlacık nesil başlatmak için kapağını kapatınotocol. damlacık oluşturma bittiğinde, kapağı açın atılabilir conta çıkarın. kartuşun üst kuyular damlacıkları içerir.
  12. 96 oyuklu bir PCR plaka tek bir sütuna sekiz en oyuklara (damlacıklar) içeriğinin pipetleyin yavaş ve düzgün 40 ul.
  13. hemen buharlaşmasını önlemek için damlacıkların aktardıktan sonra folyo ile PCR plaka mühür. Damlacık okuyucu iğne ile uyumlu delinebilir folyo plaka contaları kullanın.
  14. bir plak kapatıldı, 30 dk içinde termal çevrimi (PCR) başlayın.
  15. Tablo 3'e göre bisiklet protokolü gerçekleştirin.

5. Damlacık Okuma

  1. damlacık okuyucu açın.
  2. damlacık okuyucuya termal döngü plaka taşıyın.
  3. plaka sahibinin tabanına PCR sonrası damlacıkları içeren 96-PCR plaka koyun.
  4. PCR plaka üzerinde plaka sahibinin üst yerleştirin. Sıkıca hem serbest bırakma tırnaklarını basınaşağı tutucuya PCR plakasını sabitlemek için.
  5. Sistem PC'den yazılımını başlatın.
    1. deneyi (Mutlak miktar) tanımlamak için Kur'u tıklatın ve sonra damlacık okumaya başlamak için Çalıştır 'ı tıklatın.
    2. damlacık okuma tamamlandığında, tıklayın açın ve verileri analiz etmek için, lütfen "Analiz".
    3. Pozitif damlacıkları (kement aracı) (Şekil 1B) seçmek için analiz yazılımı 2D genlik arsa kullanın.
    4. Pozitif ve toplam damlaların sayısını kontrol etmek Olaylar sekmesini kullanın. 18.000 toplam sayısı - 21.000 damlacıkları genellikle probeless ddPCR ile elde edilir.
    5. Pozitif damlacıklar seçildikten sonra, Konsantrasyon sekmesinden ihracat .csv seçeneğini kullanarak miRNA konsantrasyon değerleri ihracat.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Plazma ya da serum ml başına özgül miRNA'ların mutlak miktarı, dijital PCR teknolojisi yeşil fluoresan DNA bağlayıcı boya kullanılarak ve damlacık belirlenebilir. 1 son MiRNA konsantrasyonunu belirler pozitif damlacıkları seçim sürecini sunulur şekil (kopya / ml ) analiz yazılımı ile hesaplanmıştır amplifikasyon reaksiyonunda. Kandaki her miRNA miktarı diğerlerine göre biraz miRNA türü daha bol olması, çok farklıdır. ddPCR reaksiyonunda 1:50 seyreltilmiş cDNA kullanılarak pozitif ve negatif damlacıkların yeterli sayıda elde etmek mümkündür. Pozitif damlacık doygunluğu (örn., Herhangi bir geri kalan negatif damlacıklar) halinde cDNA numune daha fazla seyreltme gerekli olabilir.

Her LNA primer kümesi damlacık dijital PCR sisteminin düzgün çalışması için optimize edilmelidir. miR-181a-5p için optimizasyon süreciŞekil 2'de temsil edilen Spesifik olarak, (genellikle 0.25 ila - ddPCR reaksiyon başına 1 ul) astar miktarının değiştirilmesi. (genellikle 56 ila - 60 ° C) Tavlama sıcaklığı, kombinasyon seçmek mümkündür bu pozitif ve negatif damlacıklar arasında daha iyi bir ayırma belirler. miR-181a-5p, 60 ° C tavlama sıcaklığı ve her ikisi de 0.5 ila 1 ul primer miktarlarda durumunda damlacık amplitüd açısından daha iyi bir sonuç sağlar.

Bir primer seti oluşumunu-dimerleri primer için muhtemelen bazı non-spesifik amplifikasyon, verdiğini olabilirdi. miRNA'lar sirkülasyon ile çalışırken, örnekler olumlu sinyali çok düşük ve spesifik olmayan sinyal, bu nedenle benzer olabilir. Spesifik olmayan bir hedef amplifikasyon "bulut" gerçek sinyal (Şekil 1C) ile üst üste değilse, MiRNA hala sadece doğru seçilerek belirlenebilir Pozitif damlacıkları. Bu durumda, NTC örnek damlacık seçimi için önemlidir. Aynı analize dahil edilecek tüm örnekler, aynı yöntem ve aynı ddPCR durum ile işlenmesi gerekir.

Şekil 1
Şekil 1. Pozitif damlacıklar seçimi. Pozitif damlacıklar elle 1D arsa (A) veya 2D arsa (B) pozitif damlacık bulutu etrafında bir daire yerine getirirken olumsuz damlacıklar üzerinde bir eşik kullanarak analizi sırasında seçilir. Bazı primer seti nonspesifik amplifikasyon verirse, bu negatif kontrol (Yok Şablon Kontrolü, NTC) numune (C) görünür pozitif damlacıkların ikinci bulutu ile kanıtlanır. "Gerçek" pozitif 2B arsa nonspesifik sinyal hariç seçilebilir.e.jpg "target =" _ blank "> bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

şekil 2
Probeless ddPCR ile hücre içermeyen MiRNA ölçümü için Şekil 2. Primer Optimizasyonu Üst panel:. 4 farklı ddPCR koşulları kullanılarak iki plazma örnekleri (S1 ve S2) 'de miR-181a-5p miktarının belirlenmesi. MiR-181a-5P LNA primer konsantrasyonu (0.5, 1 | il) ve tavlama sıcaklığı (58 ile 60 ° C), DNA-ara boya ddPCR pozitif (mavi) genliği ve negatif (siyah) damlalar etkiler. Bu miRNA için daha iyi bir ayrım, 60 ° C 'de PCR yapılması ve 0.5 ya da 1 ya da ul primer kullanılarak elde edilebilir. beklendiği gibi kontrol numunesi (NTC, No Şablon Kontrolü), hiçbir olumlu damlacıkları vardır. Orta panel: yukarıda belirtilen şartlarda miR-181-5p nihai konsantrasyonu. Sonuçlar ampli içinde mikrolitre başına kopya olarak sunulmuşturnağı reaksiyonu. Hata çubukları Poisson% 95 güven aralığı temsil etmektedir. Alt panel:. Damlacıkları (yeşil) toplam sayısına olumlu damlacıklar (mavi) sayısı bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

reaktif Hacim (ul)
5x reaksiyon tamponu 4
Nükleaz içermeyen su 11
Enzim karışımı 2
Şablon toplam RNA 3
Toplam ses 20

Tablo 1 - Ters Transkripsiyon Reaktif Karışımı Bileşenleri

reaktif Hacim (ul)
2x boya Supermix DNA-bağlama 10
LNA primer seti Değişken (0,5-1) *
Nükleaz içermeyen su değişken
Seyreltilmiş cDNA şablonu 8
Toplam ses 20
* İlk ddPCR reaksiyon astar en çok çalışma miktarı kurmak birkaç örnekleri ile gerçekleştirmek olmalıdır

Tablo 2 - ddPCR Reaktif Karışımı Bileşenleri

Bisiklet Adım Sıcaklık Zaman rampa Oranı Bisikletler
enzim aktivasyonu 95 ° C 5 dakika Yaklaşık 2 ° C / sn 1
denatürasyonu 95 ° C 30 sn 40
Tavlama / uzantısı 60 ° C 1 dakika
Sinyal sabitleme 4 ° C 5 dakika 1
90 ° C 5 dakika 1
Tut (isteğe bağlı) 4 ° C sonsuz 1
105 ° C'ye kadar ayarlanmış ısıtılmış kapak kullanın ve 40 ul örnek seviyesini ayarlamak.

Tablo 3 - Damlacık Dijital PCR için termal Bisiklet Koşullar

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sirkülasyon miRNA'lar son derece düşük konsantrasyonlarda, kanda bulunan plazma ve serum örneklerinden elde edilebilir RNA miktarı düşüktür. Bu nedenle, bu tür mikrodizi ve RNA dizi analizi gibi diğer tekniklerle ölçmek zordur. Ayrıca, veriler normalleştirme üzerinde anlaşma genel bir eksikliği ve kan endojen "referans" miRNA'ların varlığı yoktur. Bu bağlamda, serum veya plazma çok düşük dahi olsa ml başına miRNA kopya sayısını sayma yeteneğine sahip damlacık dijital PCR gibi hassas bir teknoloji, çok cazip. Biz-ters transkripsiyonun nedenle zaman tasarrufu ve en önemlisi, RNA malzemesi tek reaksiyonda tüm dolaşan miRNA'lar evrensel cDNA sistemi ile bu teknolojiyi eşleştirilmiş. Bizim yaklaşımda, özgüllük diğer çözümlerle 16 ile karşılaştırıldığında miRNA nicellendirmesinde çok iyi performans LNA astar, kullanımına doğasında vardır.

DamlacıkDijital PCR, hedef genlerin hesaplama saf derişimi, sağlayan bir uç-nokta deneyidir. kantitatif PCR aksine, yetersiz amplifikasyon verimleri son ddPCR kantifikasyonunu etkilemez. Bu nedenle, kan örneklerindeki örneğin mevcut PCR inhibitörleri miktarı dikkate alınarak, ddPCR nükleik asitler değerlendirmesini dolaşan için sağlam bir araç sağlar.

Nedeniyle yüksek hassasiyet için, teknoloji bile başlangıç ​​malzemesinin sınırlı miktarda, aynı zamanda daha az bol miRNA'lar yeterli ölçümü sağlar. Buna ek olarak, her bir MiRNA molekülü ters bir cDNA molekülünün transkripsiyonu olduğunu varsayarak, bir seyreltme faktörü (145,83) için ddPCR tepki değeri elde konsantrasyonu çarparak 1 ul plazma / serum mutlak kopya hesaplayabilir.

sunulmuştur akışı böylece kolayca clinica olarak mikroRNA ölçülmesi için güvenilir ve zaman etkili bir araç temin seferinde 8-96 numuneler üzerinde gerçekleştirilebilirl örnekleri. Dijital PCR nükleik asitler için vazgeçilmez bir araç, böylece yatağın tezgah sıvı biyopsi getiren bir tanı ortamda değerlendirmeyi biyomarkerların olma potansiyeline sahiptir Damlacık.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

(-, 2010/15 9980 5 mille n başına. Özel Program Moleküler Klinik Onkoloji) ve Üniversite ve Öğretim İtalyan Bakanlığı MF (MFAG 11676) Kanser Araştırma İtalyan Derneği (AIRC) den ve MN için fon tarafından desteklenen MN Araştırma FIRB 2011 (Proje RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics