Que circula MicroARN Cuantificación Usando ADN vinculante tinte Química y gotita de PCR digital

Bioengineering

GE Global Research must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Circulación (de libres de células) microRNAs (miRNAs) son liberados de las células en el torrente sanguíneo. La cantidad de microRNAs específicos en la circulación se ha relacionado con un estado de enfermedad y tiene el potencial para ser utilizado como biomarcador de la enfermedad. Un método sensible y exacto para la circulación de la cuantificación de microARN usando una química a base de colorante y tecnología de gotas de PCR digital ha sido desarrollado recientemente. Específicamente, utilizando ácido nucleico cerrado (LNA) a base de cebadores-miARN específico con un colorante de unión a ADN fluorescente verde en un sistema digital de PCR gotita compatible es posible obtener la cuantificación absoluta de miRNAs específicos. A continuación, se describe la forma de realizar esta técnica para evaluar la cantidad de miRNA en fluidos biológicos, tales como plasma y suero, es factible y eficaz.

Protocol

Aislamiento MicroARN del plasma o suero

Nota: El plasma y suero de preparación es un paso relevante en la circulación de miARN cuantificación. No existe un procedimiento preferido para la preparación de plasma y suero. La única cosa importante a tener en cuenta es que todas las muestras del mismo experimento deben ser elaborados utilizando exactamente el mismo flujo de trabajo. Comenzar a partir de suero o plasma de 200 l. El ARN total se puede aislar a partir de suero o plasma usando kits disponibles en el mercado.

1. Protocolo para el ARN total (incluyendo miRNA) Aislamiento

  1. Las muestras de suero / plasma descongelación en hielo.
  2. Añadir 1 ml de reactivo de lisis (por ejemplo., QIAzol) a 200 l de suero / plasma.
  3. Mezclar con el vórtex y colocar el tubo que contiene el homogeneizado en el banquillo a temperatura ambiente durante 5 min.
  4. Añadir 3 l de una solución de 4,16 nM del miARN miR-cel-39-3p sintético a partir de C. elegans.
  5. Añadir 200 l de cloroformo. Agitar vigorosamente durante 15 segundos. º lugartubo de correo en el banquillo a temperatura ambiente durante 2 min.
  6. Centrifugar durante 15 min a 12.000 xg a 4 ° C para obtener la separación fases: la fase acuosa superior contiene ARN.
  7. Transferir la fase acuosa a un tubo nuevo, a unos 700 l, evitar la transferencia de cualquier material interfase blanca.
  8. Añadir 1 ml de etanol al 100% y se mezcla por inversión.
  9. Pipet hasta 700 l de la muestra en una columna de mini giro colocado en un tubo de recogida de 2 ml. Cierre la tapa y centrifugar a 12.000 xg durante 15 seg. Desechar el flujo continuo.
  10. Repita este paso con el resto de la muestra.
  11. Añadir 700 l de tampón de TAR a la columna de centrifugación mini, cierre la tapa y centrifugar durante 15 segundos a 12.000 xg para lavar la columna. Desechar el flujo continuo.
  12. Pipetear 500 l de tampón RPE en la columna de centrifugación mini. Cierre la tapa y centrifugar durante 15 segundos a 12.000 rpm. Desechar el flujo continuo. Repita este paso de nuevo.
  13. Se centrifuga la columna de centrifugación de mini a toda velocidad durante 2 minutos para secar la columna de centrifugaciónmembrana a partir de etanol residual.
  14. Transferir la columna de la mini giro a un nuevo tubo de 1,5 ml de recogida y pipeta de 35 l de agua libre de RNasa en la membrana de la columna.
  15. Centrifugar durante 1 min a 12.000 xg para eluir el RNA.
  16. Almacenar el ARN a -80 ° C.
    Nota: Puesto que la concentración de ARN no puede determinarse con precisión, utilizar volúmenes fijos como una medida para la cantidad de entrada.

2. El microARN transcripción inversa

  1. Descongelar los transcripción inversa (RT) componentes de la mezcla de reactivos: Tampón de reacción 5x, agua libre de nucleasa. Mezclar invirtiendo suavemente los tubos y el lugar en el hielo. Inmediatamente antes de su uso, retire la mezcla de enzimas del congelador y colocar en hielo. Centrifugar todos los reactivos.
  2. Preparar la mezcla de reactivo de RT en hielo como se describe en la Tabla 1. Preparar al menos 10% superior a la mezcla.
  3. Mezclar la reacción con la pipeta, y luego girar hacia abajo.
  4. Incubar durante 60 minutos a 42 ° C.
  5. Heat-inactivar la revertranscriptasa SE durante 5 min a 95 ° C.
  6. Inmediatamente enfriar a 4 ° C.
  7. Almacenar el ADNc a -20 ° C.

3. La dilución de cDNA

  1. Diluir la cantidad de cDNA plantilla necesaria para las reacciones ddPCR previstas en agua libre de nucleasa. Se diluye la reacción de ADNc de entre 1:50 y 1: 500 en agua, en función de los genes miARN objetivo abundancia. Almacenar el ADNc diluida a -20 ° C. El cDNA diluido resultó ser estable durante al menos 3 meses a -20 ° C.

4. Generación de la gotita y PCR

Nota: la generación de la gotita se debe realizar en 8 muestras a la vez. Técnico repeticiones no son necesarios, debido a la alta reproducibilidad de esta tecnología 12,15 .A No Control plantilla (NTC) de la muestra debe ser ejecutado en cada placa y para cada condición ddPCR diferente.

  1. Descongelar y equilibrar la mezcla maestra (por ejemplo., EvaGreen Master Mix), el juego de primers Micro RNA y cDNA a temperatura ambiente.
  2. Mezclar la TH Master Mixoroughly invirtiendo el tubo varias veces. Centrifugar todos los reactivos.
  3. Prepare la mezcla ddPCR como se describe en la Tabla 2. Cuando se realizan múltiples reacciones ddPCR, preparar una mezcla ddPCR-solución de trabajo. Preparar al menos 10% superior a la mezcla.
  4. Una vez montada, mezclar bien y centrifugar la mezcla ddPCR.
  5. Dispensan 12 l de ddPCR mezclan en una placa de 96 pocillos PCR o los tubos de PCR.
  6. Añadir 8 l de molde de ADNc diluida a cada tubo / pocillo.
  7. Insertar el cartucho generador de gotas en el soporte.
  8. Transferencia de 20 l de cada muestra preparada a los pocillos de muestra (fila central) del cartucho generador de gotas con cuidado, evitando las burbujas de aire en la parte inferior del pozo.
  9. Llenar cada pocillo de aceite (fila inferior) con 70 l de aceite de generador de gotas.
  10. Enganche la junta sobre el soporte del cartucho y se insertan en el generador de gotas.
  11. Cierre la tapa para que comience la generación de gotas según la pr del fabricanteotocol. Cuando la generación de gotas ha terminado, abra la tapa, retire la junta desechable. Los pocillos superior del cartucho contienen las gotitas.
  12. Pipet lenta y suavemente 40 l de los contenidos de los ocho pozos superiores (las gotas) en una sola columna de una placa de 96 pocillos de PCR.
  13. Sellar la placa con papel de PCR inmediatamente después de la transferencia de gotas para evitar la evaporación. Usar juntas de la placa de lámina perforables que son compatibles con las agujas en el lector de gotas.
  14. Comenzará el ciclo térmico (PCR) dentro de los 30 minutos después del cierre del plato.
  15. Realizar el protocolo de ciclado de acuerdo a la Tabla 3.

5. Lectura de la gotita

  1. Encender el lector de gotas.
  2. Mover la placa del termociclador para el lector de gotas.
  3. Coloque la placa de PCR de 96 pocillos que contiene las gotas de post-PCR en la base del soporte de la placa.
  4. Coloque la parte superior del soporte de la placa en la placa de PCR. Presione firmemente las dos lengüetas de liberaciónhacia abajo para asegurar la placa de PCR en el soporte.
  5. Iniciar el software desde el PC del sistema.
    1. Haga clic en Configuración para definir el experimento (Cuantificación absoluta) a continuación, haga clic en Ejecutar para iniciar la lectura de las gotas.
    2. Cuando la lectura de la gotita se haya completado, haga clic en el botón para abrir y analizar los datos "Analizar".
    3. Usar el diagrama de amplitud 2D en el software de análisis para seleccionar las gotitas positivos (herramienta de lazo) (Figura 1B).
    4. Utilice la ficha Eventos para comprobar el número de gotitas positivas y totales. Un total de 18.000 - 21.000 gotitas se logra por lo general con ddPCR sin sonda.
    5. Una vez que se seleccionan las gotitas positivos, exportar los valores de concentración miARN utilizando la opción de la exportación .csv desde la pestaña de concentración.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La cantidad absoluta de miRNAs específicos por ml de plasma o suero se puede determinar usando un colorante de unión a ADN fluorescente verde y tecnología de gotas de PCR digital. La Figura 1 presenta el proceso de selección-gotitas positivo, que determina la concentración final miRNA (copias / l ) en la reacción de amplificación calculado por el software de análisis. La cantidad de cada uno de los genes miARN en la sangre es muy diferente, siendo algunas especies miARN más abundantes que otros. El uso de un ADNc diluido 1:50 en reacción ddPCR es posible obtener un número suficiente de gotitas de positivos y negativos. En caso de saturación de gotas positivo (por ejemplo., No hay gotas restantes negativos), una dilución adicional de muestras de cDNA podría ser necesario.

Cada conjunto de cebadores LNA debe ser optimizado para que funcione correctamente en el sistema de PCR digital de las gotas. El proceso de optimización de miR-181-5p esrepresentado en la figura 2 Específicamente, el cambio de la cantidad de cebador (por lo general en el intervalo de 0,25 a 1 l por reacción ddPCR). y la temperatura de recocido (por lo general en el rango de 56-60 ° C), es posible seleccionar la combinación que determina una mejor separación entre gotas positivos y negativos. En el caso de miR-181-5p, 60 ° C de temperatura de recocido y ambos 0,5 y 1 l de cebador cantidades proporcionar el mejor resultado en términos de amplitud de las gotas.

Podría suceder que un conjunto de cebadores da una amplificación no específica, probablemente debido a la formación de dímeros de cebadores. Cuando se trabaja con la circulación miRNAs, la señal positiva a partir de muestras podría ser muy baja y por lo tanto similar a la señal no específica. Si la "nube" de amplificación de la diana no específica no se solapa con la verdadera señal (Figura 1C), el miARN todavía puede ser cuantificado seleccionando sólo el verdadero gotitas positivos. En este caso, la muestra de NTC es esencial para la selección de las gotas. Todas las muestras que deben incluirse en el mismo análisis necesitan ser procesados ​​utilizando la misma metodología e idénticas condiciones ddPCR.

Figura 1
Figura 1. Las gotitas positivos de selección. Gotitas positivos se seleccionan manualmente durante el análisis utilizando un umbral por encima de las gotitas negativos en parcela 1D (A) o la realización de un círculo alrededor de la nube de gotitas positivo en la parcela 2D (B). Si algún grupo de cebadores da una amplificación no específica, esto se evidencia por una segunda nube de gotitas positivos que aparece en el control negativo (Control Sin Templado, NTC) de la muestra (C). Los aspectos positivos "verdaderos" todavía se pueden seleccionar con exclusión de la señal no específica en la parcela 2D.e.jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Optimización Primer para libre de células miARN Cuantificación con ddPCR sin sondas Panel superior:. La cuantificación de miR-181-5p en dos muestras de plasma (S1 y S2) utilizando 4 ddPCR condiciones diferentes. MiR-181a-5p primer concentración LNA (0,5 y 1 l) y la temperatura de recocido (58 y 60 ° C) afectan a la amplitud de positivo (azul) y gotitas negativos (negros) en el ADN tinte intercalante ddPCR. Una mejor separación para este miARN puede obtenerse la realización de la PCR a 60 ° C y usando ya sea 0,5 o 1 l de cebador. La muestra de control (NTC, Control Sin Templado) no tiene gotitas positivos, como se esperaba. Panel central: La concentración final de miR-181-5p en las condiciones antes mencionadas. Los resultados se presentan como copias por microlitro en la amplificación de reacción. Las barras de error representan el intervalo de confianza Poisson 95%. Panel inferior:. Número de gotitas positivos (azul) sobre el número total de gotitas (verde) Haga clic aquí para ver una versión más grande de esta figura.

Reactivo Volumen (l)
tampón de reacción 5x 4
agua libre de nucleasa 11
mezcla de enzimas 2
ARN total plantilla 3
Volumen total 20

Tabla 1 - transcripción reversa Reactivos Componentes Mix

Reactivo Volumen (l)
tinte Supermix 2x ADN vinculante 10
conjunto de cebadores LNA variable (0,5-1) *
agua libre de nucleasa variable
molde de cDNA diluido 8
Volumen total 20
* Una primera reacción debe ser ddPCR realizar con pocas muestras para establecer la cantidad de mejor trabajo de imprimación

Tabla 2 - ddPCR componentes de la mezcla de reactivos

Paso ciclismo Temperatura Hora Tasa de rampa ciclos
activación de enzimas 95 ° C 5 minutos ~ 2 ° C / seg 1
La desnaturalización 95 ° C 30 segundos 40
El recocido / extensión 60 ° C 1 minuto
estabilización de la señal 4 ° C 5 minutos 1
90 ° C 5 minutos 1
Hold (opcional) 4 ° C infinito 1
Use una tapa de calefacción ajustada a 105 ° C y ajustar el volumen de la muestra de 40 microlitros.

Tabla 3 - condiciones de ciclos térmicos para la gotita Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

miRNAs circulantes están presentes en la sangre en concentraciones extremadamente bajas y la cantidad de ARN que se puede extraer a partir de muestras de plasma y suero es baja. Por esta razón, son difíciles de cuantificar con otras técnicas tales como microarrays y secuenciación de ARN. Por otra parte, hay una falta generalizada de acuerdo sobre la normalización de datos y la presencia de miRNAs endógenos "de referencia" en la sangre. En este contexto, una tecnología sensible como gotita PCR digital, capaz de contar el número de copias de genes miARN por ml de suero o plasma, incluso si es muy baja, es muy atractivo. Nos emparejado esta tecnología con un sistema universal que ADNc inversa transcribe todos los miRNAs circulantes en una reacción por lo tanto, ahorrando tiempo y, lo más importante, materiales ARN. En nuestro enfoque, la especificidad es inherente a la utilización de cebadores de LNA, que funcionó muy bien en la cuantificación de los genes miARN en comparación con otras soluciones 16.

Gotitadigital de PCR es un ensayo de punto final que permite el cálculo de los genes diana concentración absoluta. A diferencia de la PCR cuantitativa, la insuficiencia de las eficiencias de amplificación no afectan a la cuantificación final ddPCR. Por lo tanto, teniendo en cuenta la cantidad de inhibidores de la PCR presentes por ejemplo en muestras de sangre, ddPCR proporciona una herramienta robusta para la circulación de evaluación de los ácidos nucleicos.

Debido a su alta sensibilidad, la tecnología proporciona una cuantificación adecuada también de los miRNAs menos abundantes, incluso con cantidad limitada de material de partida. Además, suponiendo que cada molécula de miARN se transcribe de forma inversa en una molécula de ADNc, se puede calcular las copias absolutas en 1 l de plasma / suero multiplicando la concentración obtenida en el valor reacción ddPCR para un factor de dilución (145,83).

El flujo de trabajo presentado se puede realizar fácilmente en 8-96 muestras a la vez, proporcionando así una herramienta eficaz y fiable de tiempo para la cuantificación de microARN en clinicaL muestras. Gotita de PCR digital tiene el potencial de convertirse en una herramienta esencial para los ácidos nucleicos biomarcadores evaluación en un entorno de diagnóstico, con lo que la biopsia líquida desde el banco al lado de la cama.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Con el apoyo de fondos de la Asociación Italiana para la Investigación del Cáncer (AIRC) en MF (GPA 11676) y MN (Oncología Clínica Molecular Programa Especial -. 5 por mil n 9980, 2010/15) y del Ministerio Italiano de Instrucción, Universidad y Investigación FIRB 2011 al MN (Proyecto RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics