Sirkulasjons mikroRNA Kvantifisering Bruke DNA-bindende Dye kjemi og Droplet Digital PCR

Bioengineering

GE Global Research must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sirkulasjons (av cellefritt) microRNAs (mirnas) blir løslatt fra celler i blodet. Mengden av spesifikke microRNAs i kretsløpet har vært knyttet til en sykdomstilstand, og har potensiale til å bli brukt som biomarkør sykdom. En følsom og nøyaktig metode for å sirkulere mikroRNA kvantifisering ved anvendelse av en fargestoffbasert kjemi og dråpe digital PCR-teknologi har nylig blitt utviklet. Nærmere bestemt, ved å bruke Låst Nucleic Acid (LNA) -baserte miRNA-spesifikke primere med en grønn fluorescerende DNA-bindende fargestoff i et kompatibelt digitalt dråpe PCR system det er mulig å oppnå den absolutte kvantifisering av spesifikke miRNAs. Her beskriver vi hvordan utfører denne teknikk for å vurdere miRNA mengde i biologiske væsker, slik som plasma og serum, er både mulig og effektivt.

Protocol

MikroRNA Isolasjon fra plasma eller serum

Merk: Plasma og serum forberedelse er en relevant skritt i sirkulerende miRNA kvantifisering. Det er ingen spesiell prosedyre for plasma og serum forberedelse. Den eneste viktige ting å vurdere er at alle prøver fra samme eksperiment må behandles med nøyaktig den samme arbeidsflyten. Start fra 200 pl serum eller plasma. Total-RNA kan isoleres fra serum eller plasma ved anvendelse av kommersielt tilgjengelige sett.

1. Protokoll for Total RNA (inkludert miRNA) Isolation

  1. Tine serum / plasmaprøver på is.
  2. Tilsett 1 ml lysereagensen (f.eks., QIAzol) til 200 mL serum / plasma.
  3. Bland ved virvling og plasser i rør inneholdende homogenat på benken ved RT i 5 min.
  4. Tilsett 3 ul av en 4,16 nM løsning av syntetisk miRNA cel-MIR-39-3p fra C. elegans.
  5. Tilsett 200 ul kloroform. Rist røret kraftig i 15 sek. Plasser the rør på benken ved romtemperatur i 2 min.
  6. Sentrifuger i 15 minutter ved 12.000 xg ved 4 ° C for å oppnå separering faser: den øvre vandige fase inneholder RNA.
  7. Overfør den vandige fase til et nytt rør, omtrent 700 ul, unngå overføring av noe hvitt inter materiale.
  8. Tilsett 1 ml 100% etanol og blandes ved inversjon.
  9. Pipetter opp 700 ul av prøven inn i en minispinnkolonne plassert på en 2 ml oppsamlingsrør. Lukk lokket og sentrifuger ved 12 000 xg i 15 sek. Kast gjennomstrømnings.
  10. Gjenta dette trinnet med den andre prøven.
  11. Legg 700 mL buffer RWT for å minispinnkolonne, lukke lokket og sentrifuger i 15 sekunder ved 12.000 xg for å vaske kolonnen. Kast gjennomstrømnings.
  12. Pipet 500 mL buffer RPE til mini spin kolonnen. Lukk lokket og sentrifuger i 15 sekunder ved 12.000 rpm. Kast gjennomstrømnings. Gjenta dette trinnet på nytt.
  13. Sentrifuger mini spin kolonne i full fart for 2 min å tørke spin kolonnemembran fra rest etanol.
  14. Overfør den minispinnkolonne til et nytt 1,5 ml samlingsrøret og-pipette 35 ul RNase-fritt vann på membranen av kolonnen.
  15. Sentrifuger i 1 min ved 12.000 xg for å eluere RNA.
  16. Oppbevar RNA ved -80 ° C.
    Merk: Siden RNA konsentrasjon ikke kan fastslås nøyaktig, bruke faste volumer som et mål for innspill beløp.

2. mikroRNA Reverse Transcription

  1. Tine revers transkripsjon (RT) reagent mix komponenter: 5x reaksjon buffer, nukleasefritt vann. Bland forsiktig snu rørene og legg dem på is. Umiddelbart før bruk, ta enzymet mix fra fryseren og legg på is. Spinn ned alle reagenser.
  2. Klargjør RT reagent mix på is som beskrevet i Tabell 1. Forbered minst 10% overstiger mix.
  3. Bland reaksjonen ved pipettering, og deretter spinne ned.
  4. Inkuber i 60 min ved 42 ° C.
  5. Heat-inaktivere reverSE-transkriptase i 5 min ved 95 ° C.
  6. Umiddelbart kul til 4 ° C.
  7. Oppbevar cDNA ved -20 ° C.

3. cDNA fortynning

  1. Fortynn mengden av cDNA som templat som er nødvendig for den planlagte ddPCR reaksjonene i nuklease fritt vann. Fortynn cDNA reaksjonen mellom 1:50 og 1: 500 i vann, avhengig av målet miRNA overflod. Oppbevar den fortynnede cDNA ved -20 ° C. Den fortynnede cDNA viste seg å være stabile i minst 3 måneder ved -20 ° C.

4. Droplet generasjon og PCR

Merk: Dråpe generasjon bør utføres på 8 prøver om gangen. Tekniske replikater er ikke nødvendig, på grunn av høy reproduserbarhet av denne teknologien 12,15 .A templat-kontroll (NTC) prøve bør kjøres i hver plate, og for hver annen ddPCR tilstand.

  1. Tine og likevekt master mix (f.eks., EvaGreen Master Mix), mikroRNA primer sett og cDNA ved RT.
  2. Bland Master Mix thoroughly ved å snu røret flere ganger. Spinn ned alle reagenser.
  3. Klargjør ddPCR blanding som beskrevet i Tabell 2. Når flere ddPCR reaksjoner utføres, utarbeide en ddPCR blande arbeids-løsning. Forbered minst 10% overstiger mix.
  4. Når montert, grundig blande og spinne ned ddPCR mix.
  5. Tilsett 12 mL av ddPCR bland inn i en 96-brønns PCR plate eller PCR-rørene.
  6. Legg 8 ul fortynnet cDNA templat i hvert rør / brønn.
  7. Sett dråpegeneratoren kassetten inn i holderen.
  8. Overføre 20 ul av hver tilberedte prøven til prøvebrønnene (midterste) av dråpegeneratoren kassetten forsiktig og samtidig unngå luftbobler i bunnen av brønnen.
  9. Fyll hver oljebrønn (nederste rad) med 70 pl dråpe generator olje.
  10. Hekt pakning løpet kassettholderen og sett inn i dråpe generator.
  11. Lukk lokket til å starte dråpe generasjon i henhold til produsentens protocol. Når dråpen generasjon er ferdig, åpne lokket, ta ut engangspakning. De øverste brønnene i patronen inneholder dråpene.
  12. Pipettes sakte og jevnt 40 ul av innholdet av de åtte øverste brønnene (dråpene) i en enkelt kolonne med en 96-brønners PCR-plate.
  13. Tett PCR plate med folie umiddelbart etter overføring dråper for å unngå fordampning. Bruk perforerbare folie plate sel som er kompatible med nålene i dråpe leseren.
  14. Begynne termiske sykluser (PCR) i løpet av 30 min fra tettende plate.
  15. Utfør sykling protokollen i henhold til tabell 3.

5. Droplet Reading

  1. Slå på dråpe leseren.
  2. Bevege platen fra termosykler til dråpe leseren.
  3. Plasser 96-brønners PCR-plate inneholdende de post-PCR dråper inn i bunnen av platen holderen.
  4. Plasser toppen av plateholderen på PCR-platen. Trykk fast begge utløsertappenened til feste PCR-platen i holderen.
  5. Start programvaren fra systemet PC.
    1. Klikk på Oppsett for å definere eksperimentet (Absolute kvantifisering) klikk Kjør for å starte dråpe lesing.
    2. Når dråpen lesing er fullført, klikker du på "Analyze" -knappen for å åpne og analysere dataene.
    3. Bruk 2D amplitude plottet i analysen programvare for å velge de positive dråper (lasso tool) (Figur 1b).
    4. Bruk kategorien Hendelser for å sjekke hvor mange positive og totale dråper. Et totalt antall på 18.000 - 21.000 dråper oppnås vanligvis med probeless ddPCR.
    5. Når de positive dråpene er valgt, eksportere miRNA konsentrasjonsverdier ved hjelp av eksport .csv alternativ fra kategorien Konsentrasjon.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den absolutte mengde av spesifikke mirnas pr ml plasma eller serum kan bestemmes ved hjelp av en grønn fluorescerende DNA-bindende fargestoff og dråpe digital PCR-teknologi. Figur 1 viser prosessen med positiv-dråper markering, som bestemmer den endelige miRNA konsentrasjon (kopier / ul ) i amplifikasjonsreaksjonen beregnet ved analyseprogramvare. Mengden av hver miRNA i blodet er svært forskjellige, blir noen miRNA arter rikere enn andre. Ved hjelp av en 1:50 fortynnet cDNA i ddPCR reaksjon er det mulig å oppnå et tilstrekkelig antall av positive og negative dråper. I tilfelle av positiv dråpemetning (f.eks., Ingen gjenværende negative dråper), kan en ytterligere fortynning av cDNA-prøvene, være nødvendig.

Hver LNA primer sett skal være optimalisert for å fungere ordentlig på dråpe digitale PCR system. Optimaliseringsprosessen for MIR-181a-5p ervist i figur 2 spesielt, å endre mengden av primer (vanligvis i området fra 0,25 til 1 ul pr ddPCR reaksjon). og glødetemperaturen (vanligvis i området på 56 - 60 ° i C), er det mulig å velge kombinasjonen som bestemmer et bedre skille mellom positive og negative dråper. I tilfelle av MIR-181a-5p, 60 ° C glødetemperaturen og både 0,5 og 1 ul primer mengder gir bedre resultat i form av dråpe amplitude.

Det kan skje at en primer sett gir noen ikke-spesifikk amplifikasjon, sannsynligvis på grunn av primer-dimerer formasjon. Når man arbeider med sirkulerende mirnas, kunne det positive signal fra prøvene, være meget lav, og derfor i likhet med den ikke-spesifikke signal. Hvis "sky" av ikke-spesifikk amplifikasjon target ikke overlapper med det virkelige signal (figur 1C), kan det likevel miRNA kvantifiseres velge bare den egentlige positive dråper. I dette tilfelle er det NTC prøven avgjørende for dråpe valg. Alle prøvene som skal inkluderes i den samme analysen må behandles ved hjelp av samme metode og identisk ddPCR tilstand.

Figur 1
Figur 1. Positive Dråper Selection. Positive dråper velges manuelt under analyse ved hjelp av en terskel over de negative dråper i 1D plot (A) eller utfører en sirkel rundt den positive dråpeskyen i 2D plot (B). Hvis noen primer sett gir en uspesifikk forsterkning, dette er dokumentert av en annen sky av positive dråper som vises i negativ kontroll (No Template Control, NTC) prøve (C). Den "sanne" positiver kan fremdeles bli valgt med unntak av den ikke-spesifikke signal i 2D-plot.e.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Primer Optimalisering for Cell-free miRNA Kvantifisering med Probeless ddPCR Øvre panel. Kvantifisering av MIR-181a-5p i to plasmaprøver (S1 og S2) med 4 forskjellige ddPCR forhold. MiR-181a-5p LNA primer konsentrasjon (0,5 og 1 ul) og glødetemperaturen (58 og 60 ° C) påvirker amplituden av positive (blå) og negative (svarte) dråper i DNA-interkalerende fargestoff ddPCR. En bedre separasjon for denne miRNA kan oppnås utførelse av PCR ved 60 ° C og ved bruk av enten 0,5 eller 1 ul primer. Kontrollutvalget (NTC, No Mal Control) har ingen positive dråper, som forventet. Midtfeltet: Sluttkonsentrasjon av MIR-181-5p i de ovennevnte betingelser. Resultatene er presentert som kopier per mikroliter i Amplifiser reaksjon. Feilfelt representerer Poisson 95% konfidensintervall. Nedre panel. Antall positive dråper (blå) på det totale antall dråper (grønn) Klikk her for å se en større versjon av dette tallet.

reagens Volum (mL)
5x Reaction buffer 4
Nukleasefritt vann 11
Enzyme mix 2
Mal total RNA 3
totalt volum 20

Tabell 1 - revers transkripsjon Reagent Mix Components

reagens Volum (mL)
2x DNA-bindende fargestoff Supermix 10
LNA primer sett variabel (0,5 - 1) *
Nukleasefritt vann variabel
Utvannet cDNA mal 8
totalt volum 20
* En første ddPCR reaksjon bør være utføre med noen prøver å etablere et best arbeidende mengde primer

Tabell 2 - ddPCR Reagent Mix Components

sykling Trinn Temperatur Tid ramping Rate Cycles
enzymaktivering 95 ° C 5 min ~ 2 ° C / sek 1
denaturering 95 ° C 30 sek 40
Gløding / utvidelse 60 ° C 1 min
signal stabilisering 4 ° C 5 min 1
90 ° C 5 min 1
Hold (valgfritt) 4 ° C uendelig 1
Bruke en oppvarmet lokk innstilt på 105 ° C og satt prøvevolumet til 40 ul.

Tabell 3 - termisk sykling Betingelser for Droplet Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sirkulerende mirnas er til stede i blod i ekstremt lave konsentrasjoner, og mengden av RNA som kan utvinnes fra plasma og serumprøver er lav. Av denne grunn, er de vanskelig å kvantifisere med andre teknikker som microarray og RNA-sekvensering. Videre er det en generell mangel på enighet om data normalisering og tilstedeværelsen av endogene "referanse" mirnas i blodet. I denne sammenheng er en følsom teknologi som dråpe digital PCR, i stand til å telle antall miRNA kopier per ml serum eller plasma, selv om meget lav, er meget attraktiv. Vi paret denne teknologien med en universell cDNA system som reverserer-transkriberer alle de sirkulerende mirnas i en reaksjon derfor sparer tid og, viktigst, RNA materiale. I vår tilnærming, er spesifisiteten iboende til bruk av LNA primere, som er utført svært godt i miRNA kvantifisering sammenlignet med andre løsninger 16.

Dropletdigital PCR er en ende-punkt analyse som tillater beregning av målgener absolutte konsentrasjon. I motsetning til kvantitativ PCR, trenger utilstrekkelig forsterkning effektivitet ikke påvirke den endelige ddPCR kvantifisering. Derfor vurderer mengden av PCR-inhibitorer er tilstede for eksempel i blodprøver, gir ddPCR et robust verktøy for sirkulering av nuklein- syrer vurdering.

På grunn av sin høye følsomhet gir teknologien et tilstrekkelig kvantifisering også av de mindre rike mirnas, selv med begrenset utgangsmateriale. I tillegg, forutsatt at hver miRNA molekyl revers transkribert i et cDNA molekyl, kan vi beregne den absolutte eksemplarer i en mikroliter plasma / serum multiplisere den oppnådde konsentrasjonen i ddPCR reaksjon verdi for en fortynningsfaktoren (145,83).

Den presenterte arbeidsflyt kan lett utføres på 8-96 samples ved et tidspunkt, og dermed gi en pålitelig og tid effektivt verktøy for mikroRNA kvantifisering i clinical prøver. Dråpe digital PCR har potensial til å bli et viktig verktøy for nukleinsyrer biomarkører vurdering i en diagnostisk innstilling, og dermed bringe flytende biopsi fra benk til sengen.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Støttet av midler fra den italienske foreningen for Cancer Research (AIRC) til MF (MFAG 11676) og MN (spesialprogram Molecular Clinical Oncology -. 5 promille n 9980, 2010/15) og fra den italienske Ministry of Instruction, Universitetet og forskning FIRB 2011 til MN (Prosjekt RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics