살아있는 세포를 엔지니어하는 합성 생물학을 사용하여 해당 프로그램 자료와 인터페이스

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 논문은 조작 된 세포와 합성 제어 프로그램 재료 표면을 조작하는 대장균을 설계 에이블 작용 표면을 개발하기위한 프로토콜의 시리즈를 제공합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

우리는 설계 세포 관능 표면의 물성을 제어 할 수있는 생물 적 생물 - 인터페이스를 개발했다. 대장균의 합성 조작 된 균주 및 관능 재 계면이 시스템은 두 개의 모듈을 생성함으로써 만들어진다. 이 논문에서, 우리는 세부 유전자 분자 복제 전략을 사용하여 대장균의 균주 내에서 선택 행동을 설계하기위한 프로토콜. 화학 유도제에 노출 될 때 회 전개,이 균주는 바이오틴의 높은 수준을 생성한다. 또한, 세포 합성 비오틴에 응답 할 수있는 각각의 두 가지 작용 표면을 만들기위한 우리 상세히 프로토콜. 종합하면, 우리는 무생물 재료 기판 상 조성물 및 조립을 제어하는 ​​셀을 설계 허용 연결된, 비 생물 - 생물학적 시스템을 생성하는 방법을 제시한다.

Introduction

여기서, 우리는 조작 세포주에서 화학적 신호에 응답 할 수있는 프로그래밍이 된 기판을 현상하는 절차를보고한다. (1) 우리는 합성 조작 된 대장균 (대장균) 세포에 의해 생성 비오틴에 응답 비오틴 - 스트렙 타비 딘 인터페이스를 작성하여이를 수행합니다. 이전 프로그램은 독소의 표면 검사 2 및 치료 시점 진단 3 방위 및 보안에서 다양한 애플리케이션을 위해 설계되었다. 프로그래머블 표면 센서 및 액추에이터로서 유용 할 수있는 4이지만, 서로 다른 환경 문제에 적응할 수있는 능력을 부여하는로 '똑똑한'할 수있다. 대조적으로, 대장균 심지어 간단한 미생물은 본래 적응성이 있고 정교 종종 예기치 솔루션 과제에 응답 할 수있다. 이 적응성은 E. 사용할 수있다복잡한 유전자 네트워크에 의해 제어 대장균 인구는 비용 효율적으로 자원을 찾아, 5 부가가치 제품, 6, 심지어 전원 마이크로 규모의 로봇을 만들 수 있습니다. 7 프로그래밍 표면을 이용하여 살아있는 세포의 적응 효과를 결합함으로써, 우리는 상이한 환경 조건에 응답 할 수있는 스마트 기판을 생성 할 수있다.

합성 생물학은 생물의 행동을 프로그래밍하는 연구자들에게 새로운 능력을 부여하고있다. 새로운 유전자 조절 네트워크를 포함하는 셀을 설계함으로써, 연구자들은 프로그래밍 동작의 범위를 나타내는 셀을 설계 할 수있다. 기초 연구 너머 (8, 9)는, 이러한 동작은 부가가치 제품을 재 조립을 제어 생물학적 생산과 같은 애플리케이션에 사용될 수있다. 10 여기, 우리가 합성 생물학의 도구를 사용하여 우리 세부 방법 엔유도에 비오틴 합성 대장균 균주 때문에 엔지니어. 이 균주는 플라스미드 pKE1-의 lacI-bioB 조립 제한 효소 클로닝 방법을 사용하여 개발되었다. 대장균 균주 K-12 MG1655로 변환 할 때, 플라스미드는 bioB 비오틴 합성에 필수적인 효소의 상승 된 수준을 발현하는 능력을 부여한다 세포. 형질 전환 된 세포가 이소 프로필 β-D-1- 티오 갈 락토 피 라노 사이드 (IPTG)를 유도 비오틴 전구체 desthiobiotin (DTB)가 제공되었을 때, 비오틴의 높은 수준이 생성되었다.

스트렙 타비 딘과 비오틴의 결합 상호 작용은 자연에서 발견 강한 비 공유 결합 중 하나입니다. 이와 같이, 비오틴 - 스트렙 트 아비딘 상호 작용은 잘 특성화 높은 바이오 채용 모두이다. 이 원고 (11) 내에서, 우리는 감지 관능면 셀 생산 바이오틴을 검출 바이오틴 - 스트렙 상호 작용을 이용하는 두 가지 전략을 제시한다. 우리"간접적"와 "직접"제어 방식으로 이러한 대조적 인면을 참조하십시오. 간접 제어 방식에서, 셀 생산 바이오틴이 결합하고 결합 부위를 스트렙 타비 딘을위한 폴리스티렌 표면 상에 고정화 된 바이오틴 경쟁. 또한, 스트렙 타비 딘은 고추 냉이 퍼 옥시 다제 (HRP)가 결합된다. HRP 3, 3 ', 5, 5'- 테트라 메틸 벤지딘 (TMB)을 450 nm의 (OD 450)에서 스펙트럼의 흡광도 (즉, 광학 밀도)을 정량함으로써 모니터링 될 수있는 광 신호 (12)를 생성하기 위하여 변경한다. 따라서, 간접적 인 제어 방식이 연구는 OD 450 attentuation 신호를 모니터링하여 셀 생산 비오틴을 측정 할 수있다.

직접 제어 방식은 재료 표면에 직접 스트렙 타비 딘을 고정화 및 결합 부위를 스트렙 타비 딘 경쟁하는 셀 생산 비오틴 및 비오틴 HRP를 허용하여 스트렙 타비 딘 - 비오틴 이벤트를 이용한다. 다시,셀 생산 비오틴의 상대적 수준은 OD 450 신호를 측정하여 모니터링됩니다.

함께 찍은, 조작 된 세포와 기능화 된 표면은 우리가 살아있는 세포에 네트워크를 유도하여 프로그램 표면의 특성을 제어 할 수 있습니다. 즉, 우리는 함께 이러한 시스템을 연결하여 조작 재 계면의 생물체의 적응성과 신뢰성 사양을 활용하는 시스템을 만들었다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 미디어와 문화 준비

  1. 탈 이온수 (DI) 물 1 L에 LB 분말 주식의 25g을 혼합하여 살균 20 분 동안 121 ° C의 솔루션을 고온 가압 멸균하여 원성 국물 (LB) 미디어를 준비합니다.
    1. , LB 플레이트를 준비 멸균 전에 LB 미디어에 15g 한천 (1.5 %)을 추가하려면
    2. DI 물에 1000 배 카르 베니 실린 (의 Cb) (50 ㎎ / ㎖)의 재고 솔루션을 준비합니다.
    3. 멸균 LB 매체의 온도가 60 ° C 이하가 될 때까지 내성 형질 전환 체의 선택을위한 항생제를 포함하는 LB 미디어를 준비하는 경우, 기다린 후 매 1 mL의 LB의 미디어에 대한 항생제 주식의 1 μL를 추가합니다.
  2. 5X M9 염 (56.4 g의 /에 L), 1 M 황산, 1 M CaCl2를 20 % 글루코스 및 2 % 비오틴 무 카사 미노산 : M9 최소 배지 (표 1)의 경우, 다음의 별도의 스톡 용액을 준비한다.
    1. 오토 클레이브 안전 병에 결합하여 20 mL의 5 배 M9의 염, 200# 181, 1M 황산, DI 물 1 M CaCl2를 20 % 글루코스 2 ㎖, 2 % 비오틴 무 카사 미노산 1 ㎖, 및 76.8 ㎖의 10 μL의 L.
    2. 20 분 동안 121 ° C에서 단계 1.2.1에서 제조 된 용액을 오토 클레이브.
  3. 400 rpm으로 교반하면서 37 ℃에서 모든 문화를 품어. 배양 시간은 실험과 변형에 따라,하지만 일반적으로 8에서 12 시간까지 지속 다릅니다.

비오틴을 일으키기 대장균의 2 세대 (플라스미드 pKE1-의 lacI-bioB)

주 : 유전자 회로는 두 부분으로 포함하십시오의 lacI 리프레하는 P의 L 구동을 TETO -1- 인해 tetR 리프레 서 단백질의 부재뿐만 아니라 P에게 TRC-2를 함유하는 비오틴 발현 시스템을 구성 적 발현의 결과 촉진제 bioB의 발현을 구동 강한 리보좀 결합 부위 (RBS) 다음 프로모터. 모든 복제는 상업적 빠르게 분할 대장균 STRA에서 실행 된에. 최종 구조는 테스트를 위해 대장균 MG1655WT로 변신했다. 프라이머 (표 2)는 상업적으로 구입 하였다.

  1. 전체 셀 중합 효소 연쇄 반응 (PCR)을 수행하여 대장균 게놈 bioB 유전자를 분리 :
    1. 37 ℃에서 밤새 E. 콜리 MG 1655WT 세포 성장.
    2. 0.2 ㎖의 PCR 용 튜브에, 멸균 DI 물 9 μL와 단계 2.1.1에서 제조 밤새 배양 1 μL를 결합한다.
    3. 열 순환기에서 5 분 동안 95 ℃에서 인큐베이션 튜브 즉시 세포 용균을 10 분 동안 -80 ° C에 냉동 튜브 옮긴다. 이것은 PCR 템플릿으로 사용할 게놈 DNA를 할 수 있습니다.
    4. (I) 2.5 μL nBioB2-F1 및 nBioB2-R 프라이머의 각 용액을 해동하고 추가 (Ⅱ) 5 배 DNA 중합 효소 완충액 μL, (ⅲ) DNA 폴리머 라제 0.25 μL (IV)의 dNTP 혼합물, 0.5 μL 및 (V) 25 μL의 총 반응 부피에 대한 DI 물 6.75 μL(표 4).
    5. 내용물을 혼합하여 (즉, 제스처)를 튜브 측 스트라이크. 다음으로, 즉시 시료 튜브의 아래쪽에 있도록 (~ 2 초)을 신속하게 튜브의 회전 속도.
    6. PCR을 된 열 순환기에 튜브를 삽입하고, 프로토콜의 시작 부분에서 95 ° C에서 3 분간의 추가의 단계를 표 3에 기재된 프로그램을 사용한다.
    7. 트리스베이스, 아세트산 및 EDTA 버퍼 (TAE)에서 - (DI 물 + 에티 디움 브로마이드 1.2 % 아가로 오스 1.0) 성공적인 PCR 겔 전기 영동을 확인합니다. PCR 산물은 긴 1,070 염기쌍 (bp의)해야한다.
    8. 단계 2.1.7에서 젤에서 DNA 조각을 추출하는 제조업체의 지침에 따라 상업 키트를 사용합니다.
  2. 는 P TRC-2 프로모터 및 플라스미드 pKDL071 13 (MIT에서 제임스 콜린스의 실험실의 제공)에서의 lacI 오페론을 격리 :
    1. 함유하는 대장균 세포 성장37 ° C에서 LB +의 Cb에서 하룻밤 pKDL071 플라스미드.
    2. 제조업체의 지시에 따라 상용 미니 프렙 키트를 사용하여 세포로부터 플라스미드 DNA를 추출한다. 플라스미드는 PCR 템플릿 역할을합니다.
    3. 단계 2.1.4에서 PCR 프로토콜을 따르십시오. 2.1.8합니다. 다음과 같이 수정과 :
    4. 단계 2.2.2에서 플라스미드 추출물 용해 세포를 교체합니다.
    5. 2.5 μL 1-F와의 lacI 카세트 추출을위한 1-R 프라이머를 각각 사용합니다. 또는, 2.5 μL P TRC-2 추출을위한 프라이머 nBioB1-F와 nBioB1-R의 각을 사용합니다.
    6. PCR 산물은 카세트의 lacI 및 P TRC-2 프로모터 사이트임을 확인할 겔 전기 영동 (단계 2.1.7)를 수행한다. 그들은 각각 1213 bp의 109 bp의 길이해야한다.
  3. 포함 된 bioB 카세트를 구축하는 중첩 확장 (SOE) PCR에 의해 접합을 사용하여 P TRC-2, 프라이머 nBioB2-F2의 합성 리보솜 결합 부위 (RBS) 및 bioB 프로그램은하기 표 3에서 발견된다.
  4. 삽입 구조 (P의 L, TETO-1 +의 lacI 및 P TRC-2 + bioB)를 pKE1-MCS 플라스미드 벡터 (13) 백본에 벡터를 소화하고 제한 효소로 삽입하여 (MIT에서 제임스 콜린스의 실험실의 제공) :
    1. 제한 효소와 겔 전기 영동을 이용하여 유전자를 추출합니다. 각각의 반응물을 포함 (I)의 10 배 반응 완충액 5 μL (Ⅱ) 제한 효소 1 1 μL, (ⅲ) 제한 효소 1/2 μL, (ⅳ) DNA의 적어도 1 μg의 및 (V) DI 물에 50 μL (표 5)에 최종 볼륨을 가지고. 의 lacI 카세트에 대한 효소 AatII 및 EcoRI로하고 bioB 카세트에 대한 효소 HindIII로하고 SacII 다이제스트.
    2. 반응이 조립 된 후 신속하게 37 ℃에서 1 시간 동안 배양 전에 간단히 원심 분리 (~ 2 초)을 소용돌이.
    3. 동안소화, 표준 프로토콜에 따라 전기 영동 젤을 준비합니다.
    4. 겔 전기 영동 6 배 로딩 버퍼를 소화 DNA를 결합합니다.
    5. 원하는 구조의 위치를 ​​확인 겔로부터 DNA 단편을 절단하고, 겔로부터 DNA 단편을 추출 제조업체의 지시에 따라 상용 겔 추출 키트를 사용하여 2 로그 사다리를 사용한다.
  5. 수학 식 1을 이용하여 벡터에 삽입 체의 몰비 1 : 1, 1 : 1 및 3 분광법을 이용하여 DNA를 정량 0 볼륨을 구한다
    식 (1) 식 (1)
    수학 식 1에서, M은 벡터에 삽입의 비율 (0, 1, 또는 3) X (I)이 삽입 DNA의 양이다 혈압 염기쌍 인서트의 길이, 혈압 V는 벡터의 길이이다 염기쌍에서, X 및 V를 벡터 (50 NG)의 양이다.
  6. 조합하여 연결 반응 믹스 (I) 1 μL 10X 리가 제 완충액 (ⅱ)1 μL T4 리가 제 (III) 50 ng의 DNA 벡터 (IV) 10 μL 총 반응 부피 (표 6)에 각각 반응하는 특정 DNA를 삽입하고, (ⅴ) DI 물 덩어리.
  7. 1 시간 동안 실온 (RT)에서 인큐베이션.
  8. 단계 2.7에서 결찰 배양하는 동안, 화학적으로 유능한 세포를 준비합니다.
    1. 1.5 ML의 원심 분리기 튜브에 하룻밤 문화의 나누어지는 1 mL를.
    2. 1 분 동안 16,200 XG에 원심 분리기.
    3. 뜨는을 가만히 따르다 및 (얼음) 냉장 200 μL 100 mM의 염화칼슘 2 펠렛을 재현 탁. 부드럽게 피펫 팅하여 펠렛을 재현 탁. 소용돌이하지 마십시오.
    4. 10 분 동안 얼음에 microcentrifuge 관을 놓습니다.
    5. 원심 분리기, 뜨는을 제거 냉장 100 mM의 CaCl2를 100 μL에 펠렛을 재현 탁하고 다시 얼음에 튜브를 배치합니다.
    6. 튜브에게 마지막 시간을 원심 분리기 및 냉각 (100)의 50 μL mM의 염화칼슘 2 펠렛을 재현 탁.
    7. 장소얼음에 튜브 즉시 화학적으로 유능한 세포를 사용합니다.
  9. 단계 2.8에서 준비 유능한 세포, 각각의 튜브에, 단계 2.6 및 2.7에서 제조 출혈도 잡았 DNA의 5 μL를 추가합니다.
  10. 측면 (즉 긋기) 튜브를 쳐서 간단히 튜브를 교반 한 다음 30 분 동안 얼음에 튜브를 배치합니다.
  11. 열은 42 ℃에서 45 초 동안 튜브를 충격과 2 분 동안 얼음에 튜브를 반환합니다.
  12. 선택적 LB 한천 플레이트와 + 항생제 위에 피펫 세포 유리 도금 비드를 사용하여 세포를 분산.
  13. 37 ℃에서 하룻밤 번호판을 품어.
  14. 다음 날 아침, 삽입 양성 판에서 식민지를 선택 (즉, 1 : 1, 3 : 1 판). 1 음성 대조군 판에는 성장을 보여줍니다, 또는 0 경우 5-8 식민지를 선택 : 0이 경우 3 식민지를 선택 한 판은 약간의 성장이있다. 5 ㎖ LB + 항생제 접종 교반과 함께 37 ℃에서 8 시간 동안 성장하는 고른 식민지를 사용합니다.
  15. minipr을 사용하여 세포로부터 플라스미드 DNA를 추출EP 키트, 제조업체의 지침에 따라. 제한 효소를 사용하여 테스트 컷 수행한다 (단계 2.4.1에서 설명 된 것과 동일한 절차에 따라 있습니다.).
  16. 정확한 구조에서 예상되는 결과 소화 DNA 단편의 길이를 비교함으로써 성공적인 구조를 가진 세포를 식별한다. 성공적인 플라스미드 구조물을 운반하는 배양액 (DI 물) 멸균 여과하고, 40 % 글리세롤 용액 등분 배양 혼합하고 -80 ℃에서 혼합물을 냉동 보존 될 수있다.
    주의 : 다른 대장균 (예 MG1655WT)로 플라스미드 변환 화학적 적격 세포를 만들기위한 상기 절차를 수행하여 달성 될 수있다.

3. 셀 특성 : 성장 곡선 및 용량 반응

  1. 적절한 항생제와 하룻밤 LB 배지에서 조작 된 균주를 성장.
  2. 성장 곡선으로하고, 0.5 M에서의 IPTG (않고 M9 최소 배지 50 ㎖를 준비째깍) 및 / 또는 500 μg의 / ML의 재고 DTB ()은 다음과 같습니다 :
    1. 0 NG / mL의 DTB (주식 0 μL) / 0 mM의 IPTG (주 0 μL)를 준비합니다.
    2. 200 NG / mL의 DTB (주식의 200 μL) / 0 mM의 IPTG (주 0 μL)를 준비합니다.
    3. 0 NG / mL의 DTB (주식 0 μL) / 0.5 mM의 IPTG (주식의 50 μL)를 준비합니다.
    4. 200 NG / mL의 DTB (주식의 200 μL) / 0.5 mM의 IPTG (주식의 50 μL)를 준비합니다.
    5. 1에서 하룻밤 문화의 예방 : 위에서 지정한 미디어 (100).
    6. 삼중, 각 웰에 96 웰 플레이트 배양 분취 200 μL에서는.
    7. OD 600 플레이트 리더 37 ° C에서 연속 진탕 배양과 5 분마다 24 시간 이상을 측정합니다.
  3. 용량 반응 연구의 경우, 실시간 광학 정량 mCherry와 pKE1-의 lacI-bioB에서 bioB 유전자 (빨간색 형광 단백질)를 교체합니다.
  4. 0.1 mM 내지 발현을 유도하는 5 mM의 IPTG에 이르기까지의 다양한 양의 추가LB 미디어입니다.
  5. 100 : 1의 희석에서 하룻밤 문화의 예방.
  6. 형광 15 시간 동안 매 30 분을 측정합니다.

엔지니어링 세포와 뜨는 준비에서 비오틴 생산을 유도 (4)

  1. LB 배지에서 하룻밤 대장균 MG1655 균주에 pKE1-의 lacI-bioB 성장.
  2. DTB는 30에서 200 NG / mL의 범위와 M9 매체를 보충합니다.
  3. 비오틴의 합성을 유도하기 위해 0.5 mM의 IPTG를 추가합니다.
  4. 1에서 하룻밤 문화 보충, 비오틴없는 최소한의 M9 매체를 접종 : 100 희석.
  5. 성장, 원심 분리기 세포의 24 시간 후, 비오틴이 풍부한 상층 액을 수집합니다.
  6. 간접 제어 및 직접 제어 작용 표면 비오틴이 풍부한 상층 액을 측정합니다. 단계 각각 5.23과 6.12에 비오틴 샘플 대신에 뜨는을 사용합니다.

5. 간접 제어 계획 기능화 표면 준비

  1. 일을 준비전자 솔루션을 다음과 같습니다.
    1. 20 mg의 구성된 SMCC 용액을 제조 / 숙신 트랜스 -4- (maleimidylmethyl) 시클로 헥산 -1- 카르 복실 레이트의 용액을 디메틸 술폭 시드 (SMCC) (DMSO).
    2. 20mg을 SPDP 이루어진 용액을 준비 / 숙신 이미 딜 -3- (2- 피리 딜 디티 오) 프로 피오 네이트의 DMSO (SPDP)의 용액.
    3. DMSO 20 ㎎ / ㎖ LC-LC-비오틴을 준비합니다.
    4. 인산 완충 식염수 (PBS)에서 10 ㎎ / ㎖의 양 고추 냉이 퍼 옥시 다제 (HRP)를 준비한다.
    5. 10 밀리그램 / PBS에서 ML의 스트렙 타비 딘 (SA)을 준비합니다.
    6. PBS에 10 ㎎ / ㎖ 소 혈청 알부민 (BSA)을 준비한다.
    7. DI 물 100 mM의 디티 오 트레이 톨 (DTT)을 준비합니다.
    8. PBS에 5 mM의 ethylenediaminetetaacetic 아세트산 (EDTA)를 준비합니다.
    9. PBS에서 0.5 % 카제인을 준비합니다.
    10. DI 물에 20 % 트윈 80 주식을 준비합니다.
    11. PBS에 0.05 % 트윈 80 (20 %의 주식을) 준비합니다.
    12. DI 물에 초산 나트륨 50 mM의 준비.
    13. DMSO에 1 % TMB를 준비합니다.
    14. 3 % H 2 O 2 전 준비N의 DI 물.
    15. DI 물에 2 MH 2 SO 4를 준비합니다.
  2. 20 μL SA 솔루션에 SPDP 솔루션의 1.4 μL를 추가합니다.
  3. 빛에 노출을 방지하기 위해 알루미늄 호일에 싸서 실온에서 1.5 시간 동안 5.2에서 솔루션을 품어. 이 단계는 SPDP 가교제는 피리 딜 디티 활성화 SA 형성 아미노기 통해 SA에 결합 할 수있다.
  4. 단계 5.3에서 솔루션에 DDT 솔루션의 2.4 μL를 추가하고 실온에서 1 시간 동안 배양. 이것은 프히 드릴 활성화 SA 결과 피리딘 -2- 티온의 절단을 허용한다.
  5. 72 μL HRP 용액에 7.5 μL SMCC 솔루션을 추가하고 빛에 노출을 방지하기 위해 알루미늄 호일에 싸서 실온에서 1.5 시간 동안 품어. 이 아미노기에 의해 결합 된 말레이 미드 - 활성화 된 HRP 초래한다.
  6. 200 μL BSA 용액 17 μL LC-LC-비오틴 솔루션을 혼합하고 빛에 노출을 방지하기 위해 알루미늄 호일에 싸서 실온에서 1.5 시간 동안 품어. 이 단계는 복합 t에 비오틴을 할 수 있습니다아미드 결합을 통해 오 BSA.
  7. 단계 5.4, 5.5에서 솔루션을 전송하고 5.6 스핀 튜브 내에서 원심 농축기를 분리 할 수 ​​있습니다.
  8. 튜브 볼륨까지 10,000 XG에서 단계 5.4, 원심 분리기에서 SA-SPDP를 포함하는 튜브 100 μL 16 분에 도달한다. PBS-EDTA 500 μL에 스핀 튜브를 입력합니다.
    1. 단계를 반복 5.8 다섯 번. 4 ° C에서 주식을 저장합니다.
  9. 볼륨이 25 μL에 도달 또는 16 분까지 10,000 XG에 단계 5.5, 원심 분리기에서 HRP-SMCC를 포함하는 튜브. PBS 500 μL에 스핀 튜브를 입력합니다.
    1. 단계를 반복 5.9 다섯 번. 4 ° C에서 주식을 저장합니다.
  10. 볼륨이 100 μL에 도달 또는 12 분까지 10,000 XG에 단계 5.6, 원심 분리기에서, BSA - 비오틴을 포함하는 튜브. PBS 500 μL에 스핀 튜브를 입력합니다.
    1. 단계를 반복 5.10 네 번.
    2. 10,000 XG에 원심 분리기 볼륨이 100 μL에 도달 할 때까지12 분 동안. 튜브에 PBS 100 μL를 추가합니다. 4 ° C에서 주식을 저장합니다.
  11. 밤새 4 ° C에서 10 ㎎ / ㎖ SA 솔루션 및 저장의 25 μL와 10 ㎎ / ㎖의 HRP 용액 25 μL를 추가합니다. 이 SA는 티오 에테르 결합을 통해 HRP와 접합하게됩니다.
    1. 4 ° C 냉장고에서 하룻밤 솔루션 및 저장 4 작업 솔루션 : 1을 준비합니다. -20 ° C에서 보관 남아있는 솔루션입니다.
  12. PBS의 490 μL에 BSA - 비오틴 주식 (또는 10 μL BSA 주식)의 10 μL를 추가하여, PBS에서 BSA - 비오틴 (또는 BSA)으로 구성된이 솔루션을 준비합니다.
  13. 96 웰 폴리스티렌 플레이트의 각 웰을 5.12 단계에서 용액 100 μL를 추가한다.
  14. 호일에 싸서 1 시간 동안 37 ° C에서 접시를 품어.
  15. 0.05 % 트윈 80과 플레이트의 우물을 씻으십시오.
    1. 우물에 0.05 % PBS-트윈 80의 200 μL를 추가합니다. 실온에서 2 분 동안 품어. 액체를 가만히 따르다.
    2. <리> 단계를 반복 5.15.1 세 번.
  16. 96 웰 플레이트의 각 웰에 0.5 % 카제인 용액 200 μL를 추가한다.
  17. 1 시간 동안 37 ° C에서 접시를 품어.
  18. 단계를 반복 5.15은 우물을 세 번 씻어.
  19. 0.05 % 트윈 80 7.5 μL와 0.5 % 카제인 용액 12 mL를 혼합하여 용액을 제조 하였다.
  20. 단계 5.19에서 제조 한 용액을 사용하여 10,000 다음 SA-HRP의 1 개를 희석.
  21. 96 웰 플레이트의 각 웰을 5.20 단계에서 제조 한 용액 80 μL를 추가한다.
  22. 폴리스티렌 플레이트의 각 웰에 제조 된 비오틴 샘플의 20 μL를 추가합니다. 4.6 제조 상등액이 단계에서 바이오틴 샘플로서 사용될 수있다.
  23. 1 시간 동안 37 ° C에서 접시를 품어. 이 단계는 경쟁력 무료 비오틴 사이의 바인딩과 SA-HRP 결합 부위에 대한 BSA - 비오틴을 고정 수 있습니다.
  24. 단계를 반복 5.15은 우물을 세 번 씻어.
  25. 50 mM의 아세트산 나트륨 용액, 1 % TMB 용액 믹스및 1000에서 3 % H 2 O 2 용액 : 10 : 1의 비율 (20 ㎖ 총 부피).
  26. 또한 각 단계 5.25에서 용액 200 μL를 추가하고 호일로 덮여 실온에서 15 분 동안 앉아 할 수 있습니다.
  27. 반응을 중지 각 웰에 2 MH 2 SO 4의 50 μL를 추가합니다. 플레이트 판독기를 사용하여 450 OD를 측정한다.

6. 직접 제어 계획 기능화 표면 준비

  1. 다음과 같은 솔루션을 준비합니다.
    1. DMSO 20 ㎎ / ㎖ LC-LC-비오틴을 준비합니다.
    2. 10 밀리그램 / PBS에서 ML의 HRP를 준비합니다.
    3. PBS에서 0.17 μg의 / mL의 SA를 준비합니다.
    4. PBS에서 0.5 % 카제인을 준비합니다.
    5. DI 물에 20 % 트윈 80 주식을 준비합니다.
    6. PBS에 0.05 % 트윈 80 (20 %의 주식을) 준비합니다.
    7. DI 물에 초산 나트륨 50 mM의 준비.
    8. DMSO에 1 % TMB를 준비합니다.
    9. DI 물에 3 % H 2 O 2를 준비합니다.
    10. 준비 2 MH 2 SO 4 물이다.
  2. 72 μL의 HRP 7.5 μL LC-LC-비오틴 추가하고 빛에 노출을 방지하기 위해 알루미늄 호일에 싸서 실온에서에서 1.5 시간을 품어. 이 단계는 아미드 결합을 통해 HRP 접합체에 비오틴시킨다.
  3. 스핀 튜브 내에서 원심 농축기로 단계 6.2에서 솔루션을 전송
    1. 부피 100 μL 도달 또는 12 분까지 10,000 XG에 용액을 원심 분리기. PBS 500 μL에 스핀 튜브를 입력하고 원심 분리 및 PBS 추가 네 번 반복합니다. 4 ° C에서 주식을 저장합니다.
  4. 96 웰 폴리스티렌 플레이트에서 각 웰에 6.1.3에서 SA 솔루션의 100 μL를 추가합니다.
  5. 호일에 싸서 1 시간 동안 37 ° C에서 접시를 품어.
  6. 0.05 % 트윈 80과 플레이트의 우물을 씻으십시오.
    1. 우물에 0.05 %의 200 μL를 트윈 80을 추가합니다. 실온에서 2 분 동안 품어. 액체를 가만히 따르다.
    2. 6.6.1 세 번 반복합니다.
  7. 96 웰 플레이트의 각 웰에 0.5 % 카제인 용액 200 μL를 추가한다.
  8. 1 시간 동안 37 ° C에서 접시를 품어.
  9. 단계를 반복 6.6 세 번 우물을 씻어.
  10. 비오틴-HRP 1 개를 희석 : 10,000 단계 6.3에서 제조 된 용액을 사용.
  11. 96 웰 플레이트의 각 웰을 6.10 단계에서 제조 한 용액 80 μL를 추가한다.
  12. 폴리스티렌 플레이트의 각 웰에 제조 된 비오틴 샘플의 20 μL를 추가합니다. 4.6 제조 상등액이 단계에서 바이오틴 샘플로서 사용될 수있다.
  13. 1 시간 동안 37 ° C에서 접시를 품어. 이 단계는 경쟁력이 고정 SA 결합 부위에 대한 무료 비오틴 및 비오틴 - HRP 사이의 바인딩 수 있습니다.
  14. 단계를 반복 6.6 우물을 세 번 씻어.
  15. 10 : 1의 비율 (20 ㎖ 총 부피) 1000 50 mM의 아세트산 나트륨 용액, 1 % TMB 용액, 및 3 % H 2 O 2 용액을 혼합한다.
  16. 6 단계에서 용액 200 μL를 추가합니다.(15)도 각각 호일로 덮여 실온에서 15 분 동안 배양한다.
  17. 반응을 중지 각 웰에 2 MH 2 SO 4 용액 50 μL를 추가합니다. 플레이트 판독기를 사용하여 450 OD를 측정한다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

대표 결과 첨부 다섯 수치로 표시됩니다. 리더 시각적 합성 조작 된 대장균 균주를 생성하기위한 중요한 단계를 수행 할 수 있도록 먼저, 그래픽 복제 프로세스 (도 1)을 제시한다. 세포 집단의 동력학을 특성화하기 위해, 우리는 인구의 600 나노 미터 (OD 600)에서 광학 밀도를 측정함으로써 생성되는 성장 곡선 (도 2)을 제공한다. 그 후, 우리는 조절 유전자 네트워크 우리 광학적 IPTG로 유도시 세포에 의해 생성 될 bioB의 상대적인 양을 측정 할 수 bioB 대한 프록시로서 (도 3) mCherry를 이용하여 검증하는 방법을 보여준다. 다음은 간접적 인 제어 및 직접 제어 작용면에 대해 응답 데이터를 제시한다. 이러한 데이터 그래프 (그림 4)는 무료의 측정 솔루션을 사용하여 개발되었다비오틴은 표면 기능화 '응답 프로파일을 특성화. 마지막으로, 우리는 이에 작용면 수정 조작 된 세포를 비오틴 (도 5)을 생성하도록 유도하는 방법을 나타내는 특성 데이터를 제시한다.

그림 1
그림 1 : 설계 및 유도 성, 엔지니어링 세포의 건설. (A) 프라이머 비오틴 합성 경로에서 중요한 효소를 코딩하는 대장균 게놈에서 bioB 유전자를 분리하기 위해 설계되었다. (B)가 P의 L은 TETO -lacI-1P-2 TRC 서열 대응 프라이머 유전자 전환 스위치를 포함하는 플라스미드로부터 분리 될 수있다. (C) 추출 bioB 유전자 상기 전환 스위치로부터의 두 단편은 그 유전자 회로를 생성하는데 사용될 수있다. 다음 산업사 수 IPTG의 첨가DTB가 bioB 용 기질로서 첨가하면 bioB하여 비오틴 합성 식 UCE. (D) 조립 된 플라스미드 K-12 MG1655 대장균에 형질 전환 하였다. 이것은 DTB을 기판으로 제공 될 때 조작 세포주에서 bioB하여 비오틴 합성의 발현을 유도하기 위해 IPTG의 존재를 일으켰다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : 설계된 세포에 대한 성장 곡선. 공학적, 유도 MG1655 야생형 세포 성장 및 최소 배지 (즉, 바이오틴없는 M9 배지)뿐만 아니라, 최소 배지 DTB 보충 (200 NG / ㎖) 및 / 또는 IPTG (0.5 mM)을 모니터링 하였다. 플롯은 OD 600 독서, 측정을 매 5 마일 표시 24 시간 동안 N. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : 엔지니어링 유전자 네트워크 테스트. 형광 단백질 mCherry는 대신에 사용 조작 된 세포 IPTG로 유도했을 때 우리는 광학적으로 유도 프로파일을 측정 할 수 있도록 bioB 유전자. 우리는 IPTG (블루 다이아몬드)로 유도되지 않은 세포에 IPTG (적색 다이아몬드)에 의한 세포 대비. 이러한 결과는 유도 유전자 네트워크의 효능을 입증한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

/55300/55300fig4.jpg "/>
그림 4 : 기능화 소재 인터페이스의 확인. 비오틴 농도의 변화에 대한 우리의 기능화 된 표면을 노출시킴으로써, 우리는 OD 450 흡광도를 측정하여 광학 응답을 측정 할 수있다. 이러한 결과는 반응의 광 강도 비오틴의 농도를 잇는 우리 교정 곡선을 생성 할 수있다. 여기, 우리는 모두 간접 (왼쪽)와 직접 (오른쪽) 작용 표면 체계를위한 광 신호 곡선 대 비오틴을 제시한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 5 : 엔지니어링 세포는 재질 인터페이스를 제어 할 수 있습니다. 프로토콜 절 5 또는 6을 이용함으로써 유도 조작 C의 제품을 사용할 수있다ELL 학생은 화학적으로 기능화 된 표면을 수정합니다. 우리는 OD 450을 측정하여 광학적으로 이러한 반응을 모니터링 할 수 있습니다. 또한,도 4에서 개발 한 검량선을 이용함으로써 농도 내 바이오틴에 응답하여 광 강도를 연결할 수있다. 우리는 여기서, 야생형 세포 (흰색)의 pKE1-의 lacI-bioB 플라스미드 (오렌지)를 포함하는 유도되지 않은 셀에 대한 우리의 간접 제어 방식 관능면에 의해 측정 된 다른 비오틴 농도, 및 pKE1-의 lacI-bioB 함유 유도 세포를 제시 플라스미드 (회색). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

화학 최종 농도
5 배 M9 염 1 배 20 ㎖
1 M 황산 2 밀리미터 200 μL
1 M CaCl2를 0.1 mM의 10 μL
20 % 글루코스 0.40 % 2 mL의
2 % 비오틴 무 카사 미노산 0.02 % 1 mL의
DI 물 N / A 76.8 mL의

표 1 : M9 미디어 레시피.

이름 프라이머 시퀀스 용법
1-F CCGCCGGAATTCTCCCTATCAGTGATAGAGATT 카세트의 lacI 추출
1-R 기음CGACGTCTCACTGCCCGCTTTCCAGTC 카세트의 lacI 추출
nBioB1-F CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P의 TRC-2 추출
nBioB1-R GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P의 TRC-2 추출
nBioB2-F1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB 추출
nBioB2-R TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB 추출
nBioB2-F2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC 합성 RBS 추가

표 2 : 프라이머의 목록입니다.

1 단계
2 단계 3 단계 4 단계 5 단계 6 단계 7 단계 8 단계 9 단계
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
0시 반 0시 10분 0시 반 01 : 00 / 킬로바이트 0시 10분 0시 반 01 : 00 / 킬로바이트 2시
12 회 반복 25 회 반복
-1 C / 사이클 °

표 3 : PCR 프로그램.

이름 음량
세포 용 해물 (템플릿) 10 μL
프라이머 (각) 0.625 μL (각)
5 배 Q5 버퍼 5 μL
Q5의 중합 0.25 μL
의 dNTP 믹스 0.5 μL
DI 물 6.75 μL

표 4 : 전체 세포 PCR 반응 (25 μL).

이름 음량
(10)X 반응 버퍼 5 μL
효소 1 1 μL
효소 2 1 μL
템플릿 DNA 1 μg의
DI 물 43 μL - DNA의 볼륨

표 5 : 제한 효소 분해 반응 (50 μL).

이름 음량
DNA + X μg의 인서트 50 μg의 벡터
10 배 리가 버퍼 1 μL
T4 리가 1 μL
DI 물 8 μL - DNA의 볼륨

도표 6 : 연결 반응 (10 μL).

이름 집중 노트
염화칼슘 (2) 100 밀리미터
Carbeniccilin 50 ㎎ / ㎖ (1000X)
DTB 50 μg의 / mL의
IPTG 0.5 M
SMCC 20 ㎎ / ㎖ 100 ㎕ DMSO에 2 mg의
SPDP 20 ㎎ / ㎖ 100 ㎕ DMSO에 2 mg의
LC-LC-비오틴 20 ㎎ / ㎖ 100 ㎕ DMSO에 2 mg의
HRP 10 ㎎ / ㎖ PBS에서
SA (경유) 10 ㎎ / ㎖ PBS에서
SA (직접) 0.17 μg의 / mL의 PBS에서
BSA 20 ㎎ / ㎖ PBS에서
DTT 100MM DI 물에
EDTA 5 밀리미터 10 mL의 PBS에 18.6 mg의
카세인 0.50 % PBS에서
트윈 80 20 % DI 물에
PBS의 트윈 80 0.05 %
아세트산 나트륨 50 mM의 DI 물에, 3 M 염산을 사용하여 5.1 pH로 조정
TMB 1% DMSO에서
H 2 O 2 삼% DI 물에
H 2 SO 4 2 M DI 물에

도표 7 : 시약 솔루션의 목록입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

우리는 작용 물질의 표면과 생활 설계 세포를 인터페이스하기위한 새로운 전략을 발표했다. 이 IPTG로 유도 할 때 비오틴 수준 상승을 합성 할 수있는 세포주를 개발함으로써 달성되었다. 비오틴의 상승 된 수준은 기능화 된 표면을 수정하는 데 사용될 수있다. 프로토콜은 대장균 세포 라인을 설계하는 방법에 두 가지 작용 표면을 생성하는 방법을 상세히.

이 프로토콜에서 중요한 단계는 설계 세포주의 구축에 걸쳐 발생한다. 다운 스트림 문제, 모두 성장 곡선으로 설계 세포주의 특성 (그림 2)와 형광 응답 (그림 3)을 방지하기 위해 권장합니다. 절차상의 문제가 발생하는 경우, 이러한 PCR 추출 및 깁슨 조립체 (14)와 같은 다른 분자 클로닝 전략, 여기서 단계 적절한 치환 될 수있다. 비오틴 yie을 최적화조작 된 세포주 LD, DTB 충분한 양의 세포에 제공되는 것을 보장하기 위해 중요하다. 우리의 연구에서 우리는 세포 IPTG로 유도했을 때 200 NG가 / mL의 DTB는 비오틴 생산에 상당한 통계적으로 유의 한 증가를 유발 한 것으로 나타났습니다. 또한, BSA - 비오틴, SA-HRP 및 비오틴-HRP의 성공적인 결합을 효과적으로 수행하고 간접 및 직접 제어 방식을 모니터링하기위한 중요합니다. 빛에 불필요한 노출을 방지하고 접합체 효과적인 복합체를 형성하기 위해 4 ° C에서 하룻밤 배양 할 수 있도록주의하십시오.

우리 프로토콜 인해 이러한 4'- hydroxyazobenzene -2- 카복실산 기반으로하는 시판 비오틴 검출 키트에 비해 (pg / ml 인 스케일) 생물학적 관련성 비오틴 적은 양을 검출 할 수있는 능력을 다른 방법 (15)에 비해 많은 장점을 제공한다 경쟁적 결합 전략. 스트렙토 아비딘을 이용한 바이오 비록주석 시스템 생명 공학 16, 17에서 일반적이며, 비오틴의 적은 양에 대응하는 우리의 시스템의 능력은 직접 작용 표면과 우리의 유전자 조작 세포 라인을 연결하는 우리를 할 수 있습니다.

우리의 프로토콜의 하나의 잠재적 인 제한은 비오틴 검출 결과의 동적 범위입니다. 간접 및 직접 제어 방식에서 우리는 (4도)는 각각 / mL로, 페이지 4 -10 6 -10이 10 ~ 10 비오틴을 감지 할 수 있습니다. 다행히 간접 제어 방식의 저역은 우리가 쉽게 조작 된 세포에서 비오틴 생산을 감지 할 수 있습니다. 그러나 간접 제어 다이나믹 레인지의 타이트한 밴드 비오틴 농도의 큰 변화 (100 배)을 감지하는 능력을 제한한다. 모두 간접 및 직접 제어 방식에 대한 동적 범위를 변경하는 추가적인 기술을 필요로한다. 그러나, 검출 셀 생산할 경우D 비오틴은 간접 제어 방식 (그림 5)의 동적 범위를 대상으로 연구를 허용해야 단계 4.6에서 비오틴 상층 액의 희석을 준비 문제입니다. 상층 액의 5 희석 우리가 효과적으로 간접 제어 방식의 동적 범위를 타겟팅 할 수 : 우리는 1 것을 발견했다. 이 희석 전략 직접 동적 범위를 변경하는 요구를 완화한다.

여기에 제시된 두 부분, 세포 물질 시스템은 기능화 된 표면의 구성을 수정하는 셀을 설계 허용한다. 동적, 살아있는 세포는 유전 적 반응을 생산하기 위해 화학적 환경을 해석 할 수 있습니다. 비오틴 증산이 유전 반응을 설계함으로써 기능화 된 표면을 통제하고 조작하는 능력을 설계 살아있는 세포를 부여 할 수있다. 제시된 프로토콜에 따라, 조작 된 세포는 판독 처리 가능한 동적 센서를 작동 할 수 있으며, 제 주변 기록 조건작용 인터페이스를 통해 그들. 이 기술은 분자 의학에서 환경 개선에 대한 분석 검출에 이르기까지 다양한 분야에 영향을 미칠 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 아무것도 없어.

Acknowledgments

저자는 기꺼이 미국의 과학 연구의 공군 사무실에서 수상 FA9550-13-1-0108 지원을 인정합니다. 저자는 또한 버지니아 폴리 테크닉 연구소 및 주립 대학에서 중요한 기술 및 응용 과학 연구소에서와 국립 과학 재단 (National Science Foundation) 대학원 연구에서 자금, 미국의 해군 연구소의 사무실에서 수상 N00014-15-1-2502의 지원을 인정 원정대 프로그램, 보너스 번호 1607310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics