Использование синтетической биологии инженеру живых клеток, которые взаимодействуют с программируемыми материалов

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Эта статья представляет собой серию протоколов для разработки сконструированных клеток и функционализированных поверхности , которые дают возможность синтетически сконструированных E.coli , чтобы контролировать и управлять программируемыми поверхности материалов.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Мы разработали абиотическую-биотических интерфейс, который позволяет сконструированные клетки контролировать свойства материала функционализированного поверхности. Эта система сделана путем создания двух модулей: синтетически сконструированного штамма клеток E.coli и функционализированный интерфейс материала. В этой статье мы подробно протокол для генной инженерии выбранного поведения в пределах штамма E.coli , при использовании стратегий молекулярного клонирования. После разработки, этот штамм продуцирует повышенные уровни биотина при воздействии химического индуктора. Кроме того, мы подробно протоколы для создания двух различных функционализированных поверхностей, каждая из которых способна реагировать на клетки синтезированный биотина. Взятые вместе, мы представляем методологию для создания связанного, абиотическую-биотических система, которая позволяет сконструированные клетки для контроля состава материала и сборки на неживых субстратах.

Introduction

Мы сообщаем процедуры разработки программируемую субстрат, способный реагировать на химический сигнал от сконструированного клеточной линии. 1 Мы делаем это путем создания биотин-стрептавидин интерфейс , который реагирует с биотином получают синтетически сконструированного Escherichia coli (E.coli) клетках. Ранее программируемые поверхности были разработаны для широкого спектра применений от обнаружения токсина 2 и пункт-ухода диагностики 3 обороны и безопасности. 4 В то время как программируемые поверхности могут быть использованы в качестве датчиков и исполнительных устройств, они могут быть сделаны "умнее" , наделяя их способностью приспосабливаться к различным экологическим проблемам. В отличие от этого , даже простые микроорганизмы, такие как E.coli, имеют присущую адаптивность и способны реагировать на вызовы со сложными и зачастую неожиданные решения. Эта адаптивность позволила Е.популяции Coli, под контролем их сложных генных сетей, экономически эффективно изыскивать ресурсы, 5 создавать продукты с добавленной стоимостью, 6 и даже мощности микро-масштаба робототехники. 7 сочетанием адаптивных преимуществ живых клеток с использованием программируемых поверхностей, мы можем создать смарт - субстрат , способный реагировать на различных условиях окружающей среды.

Синтетическая биология дала исследователям новые способности программировать поведение живых организмов. Машиностроительным клетки содержат новый ген регуляторных сетей, исследователи могут конструировать клетки, которые демонстрируют целый ряд запрограммированных форм поведения. 8, 9 Помимо фундаментальных исследований, эти модели поведения могут быть использованы для приложений , таких как управление Сборочный материал и биологически производства продукции с высокой добавленной стоимостью. 10 Здесь мы подробно , как мы использовали инструменты синтетической биологии для ваннойgineer штамм E.coli , который синтезирует биотин при индукции. Этот штамм был разработан с использованием методов фермента рестрикции клонирования для сборки плазмиды, pKE1-Лачи-bioB. Эта плазмида, когда трансформировали в E.coli штамм К-12 MG1655, жертвует клетки со способностью выражать повышенные уровни bioB, жизненно важного фермента для синтеза биотина. Когда трансформированные клетки индуцировали изопропиловым бета-D-1-тиогалактопиранозида (IPTG) и при условии, с предшественником биотин, desthiobiotin (DTB), были получены повышенные уровни биотина.

связывающее взаимодействие биотин с стрептавидином является одним из самых сильных нековалентных связей, существующих в природе. Таким образом, взаимодействие биотин-стрептавидин и хорошо охарактеризованных и высоко занятых в области биотехнологии. 11 В рамках этой рукописи мы представляем две стратегии , использующие взаимодействие биотин-стрептавидин чувствовать и обнаруживать клеток производства биотина с функционализированного поверхностью. Мыотносятся к этим контрастных поверхностей, как «косвенные» и «прямых» схем управления. В косвенном схеме управления, клетка производства биотин конкурирует с биотином, который был конъюгированным и иммобилизованного на поверхности полистирола для стрептавидина-сайтов. Кроме того, стрептавидин конъюгирован с пероксидазой хрена (HRP). ПХ изменяет 3, 3 ', 5, 5'-тетраметилбензидином (ТМВ), для получения оптического сигнала, 12 , которые могут быть проверены количественной оценки спектральной поглощательной (т.е. оптической плотности) при 450 нм (OD 450). Таким образом, косвенная схема управления позволяет исследователям измерять клеток производства биотин путем мониторинга затуханием сигнала OD 450.

Схема прямого управления использует стрептавидин-биотин событие иммобилизацией стрептавидин непосредственно к поверхности материала и позволяя клеток производства биотина и биотинилированного HRP, чтобы конкурировать за сайты связывания стрептавидина. Опять же,Относительные уровни клеточного производства биотина контролируются путем измерения сигнала OD 450.

Взятые вместе, сконструированные клетки и функционализованные поверхности позволяют нам контролировать свойства программируемой поверхности путем индуцирования сетей в живых клетках. Другими словами, мы создали систему, которая использует преимущества приспособляемости живых организмов и надежности и спецификации сконструированной интерфейса материала, связывая эти системы вместе.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Средства массовой информации и культуры Подготовка

  1. Подготовка лизогении бульона (LB) носителя путем смешивания 25 г порошка LB запаса 1 л деионизированной (ДИ) воды и автоклавированием раствора при температуре 121 ° С в течение 20 мин , чтобы стерилизовать.
    1. Для приготовления LB пластин, добавьте 15 г агар (1,5%) в средствах массовой информации LB перед стерилизацией
    2. Подготовка исходных растворов 1,000x карбенициллином (Cb) в деионизированной воде (50 мг / мл).
    3. При подготовке LB носитель, который включает антибиотик для селекции устойчивых трансформантов, подождать, пока температура стерилизованным LB СМИ не ниже 60 ° С, а затем добавляют 1 мкл запаса антибиотика для каждого 1 мл LB сред.
  2. Для M9 минимальных средах (таблица 1), подготовить отдельные растворы следующих: соли 5X М9 (56,4 г / л), 1 М MgSO 4, 1 М CaCl 2, 20% глюкозы и 2% биотина свободных казаминокислот.
    1. В автоклаве безопасной бутылки, смешайте 20 мл 5х солей M9, 200 &# 181; л 1 М MgSO 4, 10 мкл 1 М CaCl 2, 2 мл 20% глюкозы, 1 мл 2% биотина свободных казаминокислот, и 76,8 мл дистиллированной воды.
    2. Автоклава раствора, полученного на стадии 1.2.1 при температуре 121 ° С в течение 20 мин.
  3. Инкубируйте все культуры при 37 ° С при перемешивании при 400 оборотах в минуту. инкубационные времена меняются в зависимости от опыта и деформации, но, как правило, длится от 8 до 12 ч.

2. Генерация Биотин продуцирующей E. coli (Плазмида pKE1-Лачи-bioB)

Примечание: Генетическая схема содержит две части: репрессора lāči, движимый P L, Teto-1 промотор , что приводит к конститутивной экспрессии в связи с отсутствием тетр белка - репрессора, а также в качестве системы экспрессии , биотин , содержащий Р - TRC-2 промотор с последующим сильным сайт связывания рибосом (РБС) вождения выражение bioB. Все клонирование было выполнено в коммерческом, быстро делящегося кишечной палочки Страв. Окончательный конструкцию трансформировали в E.coli MG1655WT для тестирования. Праймеры (Таблица 2) были приобретены на коммерческой основе .

  1. Изолировать ген bioB из E.coli генома путем проведения целой клетки полимеразной цепной реакции (ПЦР):
    1. Grow клетки E.coli М.Г. 1655WT в течение ночи при температуре 37 ° С.
    2. В 0,2 мл ПЦР-пробирку, смешайте 1 мкл ночной культуры, полученного на стадии 2.1.1 с 9 мкл стерильной дистиллированной воды.
    3. Инкубируйте пробирку при 95 ° С в течение 5 мин в амплификатор и немедленно передать трубку до C морозильнике -80 ° в течение 10 мин для лизиса клеток. Это позволяет геномную ДНК, чтобы служить в качестве матрицы для ПЦР.
    4. Разморозить решение и добавьте (I) 2,5 мкл каждого из праймеров nBioB2-f1 и nBioB2-R, (II), 5 мкл 5х ДНК-полимеразы буфера, (III), 0,25 мкл ДНК-полимеразы, (IV), 0,5 мкл дНТФ смеси и (v) 6,75 мкл деионизированной воды при общем объеме реакционной смеси 25 мкл(Таблица 4).
    5. Удар в сторону (т.е. быстрого перемещения) трубы , чтобы смешать его содержимое. Затем, сразу же спином вниз трубку быстро (~ 2 сек), чтобы обеспечить образец находится в нижней части трубы.
    6. Поместите пробирку в амплификатор ПЦР и использовать программу , описанную в таблице 3 , с дополнительным шагом 3 мин при 95 ° С в начале протокола.
    7. Подтверждение успешного ПЦР с использованием гель-электрофореза (1,0 - 1,2% агарозы в деионизированной воде + этидий бромид) в Трис-основание, уксусную кислоту, и ЭДТА буфере (ТАЕ). Продукт ПЦР должен быть 1070 пар оснований (п.о.) в длину.
    8. Использование коммерческих наборов в соответствии с инструкциями изготовителя, чтобы извлечь фрагменты ДНК из геля со стадии 2.1.7.
  2. Изолировать P TRC-2 и промотор оперона LĀČI из плазмиды pKDL071 13 (любезно лаборатории Джеймса Коллинза в Массачусетском технологическом институте):
    1. Рост клеток E.coli , содержащихплазмида pKDL071 в течение ночи в LB + Cb при 37 ° С.
    2. Экстракт плазмидной ДНК из клеток с использованием коммерческого набора минипрепаративную в соответствии с инструкциями изготовителя. Плазмида будет служить в качестве матрицы для ПЦР.
    3. Следуйте протоколу ПЦР из шагов 2.1.4. до 2.1.8. со следующими изменениями:
    4. Заменить лизированных клеток плазмидой экстракта на стадии 2.2.2.
    5. Используйте 2,5 мкл каждого из праймеров 1-F и 1-г для извлечения кассеты Лачи. С другой стороны , использовать 2,5 мкл каждого из праймеров nBioB1-F и nBioB1-R для P экстракции TRC-2.
    6. Выполните гель - электрофореза (этап 2.1.7) для подтверждения ПЦР - продукты кассета Лачи и P TRC-2 промоутер сайта. Они должны быть 1213 пар оснований и 109 пар оснований, соответственно.
  3. Используйте сплайсинг путем расширения перекрытия (SOE) ПЦР построить кассету , содержащую bioB P TRC-2, сайт связывания рибосомы синтетический (RBS) в праймера nBioB2-f2 и bioB таблице 3.
  4. Вставка конструкции (P L, Teto-1 + Лачи и P TRC-2 + bioB) в pKE1-MCS плазмидного вектора 13 позвоночником (любезно лаборатории Джеймса Коллинза в MIT) путем переваривания вектора и вставки с помощью ферментов рестрикции:
    1. Извлечение генов с использованием ферментов рестрикции и гель-электрофореза. Каждая реакционная смесь содержит (I) 5 мкл 10-кратного буфера для реакции, (II), 1 мкл рестриктазы 1, (III), 1 мкл рестриктазы 2, (IV), по меньшей мере, 1 мкг ДНК, и (v) деионизированной воды в довести конечный объем до 50 мкл (таблица 5). Дайджест ферментами AatII и EcoRI для кассеты Лачи и ферментами HindIII и SacII для кассеты bioB.
    2. После реакции собирают, быстро вихрь их и кратко центрифуге (~ 2 сек) до инкубации в течение 1 ч при 37 ° С.
    3. В течениеПереваривание, готовят гели для электрофореза в соответствии со стандартными протоколами.
    4. Объединить с расщепленной ДНК гель-электрофореза буфера 6х загрузки.
    5. Используйте 2 журнала лестницу, чтобы проверить расположение нужной конструкции, вырезать фрагмент ДНК из геля, и использовать коммерческие наборы для экстракции из геля в соответствии с инструкциями производителя, чтобы извлечь фрагменты ДНК из геля.
  5. Количественная ДНК с помощью спектроскопии и вычислить объемы для 0: 1, 1: 1, 3: 1 молярные соотношения вставки в вектор с использованием уравнения 1:
    Уравнение 1 Уравнение 1
    В уравнении 1, M представляет собой отношение вставки к вектору (0, 1, или 3), Х I является количество ДНК - вставки, п.н. I является длина вставки в парах оснований, п.о. V есть длина вектора в пар оснований, а X v является величина вектора (50 нг).
  6. Смешать реакции лигирования путем объединения (I) 1 мкл 10х буфера для лигазы, (II)1 мкл лигазы Т4, (III) вектор ДНК 50 нг, (IV) , масса ДНК - вставки для каждой конкретной реакции, и (v) ДИ водой до 10 мкл Общий объем реакционной смеси (таблица 6).
  7. Инкубируют при комнатной температуре (RT) в течение 1 ч.
  8. Во время лигирования инкубации на стадии 2.7, готовят химически компетентных клеток.
    1. Алиготе 1 мл в течение ночи культурами, в 1,5 мл центрифужные пробирки.
    2. Центрифуга при 16200 х г в течение 1 мин.
    3. Слейте супернатант и ресуспендируют осадок в 200 мкл охлажденной (на льду) 100 мМ CaCl 2. Ресуспендируют осадок осторожно пипеткой. Не вихрь.
    4. Поместите микроцентрифужных пробирку на льду в течение 10 мин.
    5. Центрифуга, удалить супернатант, ресуспендируют осадок в 100 мкл охлажденного 100 мМ CaCl 2, и поместите пробирку на льду снова.
    6. Отцентрифугировать пробирку в последний раз и вновь суспендируют таблетку в 50 мкл охлажденного 100 мМ CaCl 2.
    7. Местотрубка на льду и сразу же использовать химически компетентных клеток.
  9. Добавьте 5 мкл лигированной ДНК, приготовленные на этапах 2.6 и 2.7, в каждую пробирку компетентных клеток, приготовленной на стадии 2.8.
  10. Перемешайте трубку на короткое время, ударяя сторону (т.е. стряхивая) трубы, а затем поместить пробирки на льду в течение 30 мин.
  11. Теплового шока пробирки в течение 45 с при 42 ° С и возвращают пробирки на лед на 2 мин.
  12. Пипетировать клеток на селективной LB агар + антибиотических пластин и распространение клеток с использованием стеклянной обшивки бисером.
  13. Инкубируйте пластин в течение ночи при температуре 37 ° С.
  14. На следующее утро, забрать колоний из вставных-положительных пластин (то есть, 1: 1 и 3: 1 пластины). Pick 3 колонии, если 0: 1 отрицательный контроль пластина не показывает никакого роста, или выбрать 5-8 колоний, если 0: 1 пластина имеет некоторый рост. С помощью отобранных колоний для инокуляции 5 мл LB + антибиотик и расти в течение 8 ч при 37 ° С при перемешивании.
  15. Экстракт плазмидной ДНК из клеток с использованием miniprер комплект, следуя инструкциям производителя. Выполните пробную порезах рестриктаз (следуя той же методике, описанной в пункте 2.4.1.).
  16. Выявление клеток с успешным конструктов путем сравнения длины расщепленных фрагментов ДНК с ожидаемыми результатами от правильной конструкции. Культуры, несущие успешные плазмидные конструкции могут быть сохранены путем смешивания равных частей культуры с раствором стерилизованного фильтрацией, 40% глицерина (в деионизированной воде) и замораживания смеси при -80 ° С.
    Примечание: Трансформации плазмид в другие штаммы E. coli (т.е. MG1655WT) может осуществляться с помощью следующих вышеуказанную процедуру для создания химически компетентных клеток.

3. Характеристика Cell: Кривая роста и реакции от дозы

  1. Grow сконструированных штаммов в течение ночи в LB среде с соответствующим антибиотиком.
  2. Для кривых роста, подготовить 50 мл минимальной среды М9 с и без IPTG (от 0,5 М сTock) и / или DTB (от 500 мкг / мл стоковый) следующим образом:
    1. Подготовьте 0 нг / мл DTB (0 мкл в наличии) / 0 мМ IPTG (0 мкл на складе).
    2. Подготовьте 200 нг / мл DTB (200 мкл на складе) / 0 мМ IPTG (0 мкл на складе).
    3. Подготовьте 0 нг / мл DTB (0 мкл в наличии) / 0,5 мМ IPTG (50 мкл на складе).
    4. Подготовьте 200 нг / мл DTB (200 мкл на складе) / 0,5 мМ IPTG (50 мкл на складе).
    5. Привить с ночной культуры в соотношении 1: 100 в средствах массовой информации, указанных выше.
    6. В 96-луночный планшет, аликвоты по 200 мкл культуры, в трех экземплярах, в каждую лунку.
    7. Мера OD 600 через каждые 5 мин в течение 24 ч при непрерывном встряхивании и инкубирования при 37 ° С в ридере.
  3. Для исследований доза - ответ, заменить ген bioB в pKE1-Лачи-bioB с mCherry (красный флуоресцентный белок) в режиме реального времени оптической количественной оценке.
  4. Добавить различные количества IPTG в диапазоне от 0,1 мМ до 5 мМ, чтобы индуцировать экспрессиюв LB СМИ.
  5. Инокулируйте с ночной культурой в разведении 1: 100.
  6. Измерение флюоресценции, каждые 30 мин в течение 15 ч.

4. Склонение биотина Производство из сконструированные клетки и супернатанта Подготовка

  1. Grow pKE1-Лачи-bioB в E.coli штамма MG1655 в течение ночи в LB СМИ.
  2. Дополнение М9 с DTB в пределах от 30 до 200 нг / мл.
  3. Добавьте 0,5 мМ IPTG, чтобы индуцировать синтез биотина.
  4. Привить дополненные, биотин свободных минимальных средах M9 с ночной культурой в разведении 1: 100.
  5. Через 24 ч роста, центрифужные клеток и собирают биотин обогащенного супернатант.
  6. Мера биотин обогащенный супернатанта с косвенным контролем и непосредственным контролем функционализованные поверхностей. Используйте супернатант вместо образца биотина с шагом 5,23 и 6,12, соответственно.

5. Косвенное Подготовка поверхности Схема управления функционализированного

  1. Приготовьте тысе следующие решения.
    1. Готовят раствор SMCC, состоящий из 20 мг / мл сукцинимидил транс-4- (maleimidylmethyl) циклогексан-1-карбоксилат (SMCC) в диметилсульфоксиде (ДМСО).
    2. Готовят раствор SPDP, состоящий из 20 мг / мл сукцинимидил 3- (2-пиридилдитио) пропионата (СПДП) в ДМСО.
    3. Готовят 20 мг / мл LC-LC-биотина в DMSO.
    4. Готовят 10 мг / мл пероксидазы хрена (HRP) в фосфатно-солевом буфере (PBS).
    5. Готовят 10 мг / мл стрептавидина (SA) в PBS.
    6. Готовят 10 мг / мл бычьего сывороточного альбумина (BSA) в PBS.
    7. Подготовьте 100 мМ дитиотреитола (DTT) в деионизированной воде.
    8. Подготовка 5 мМ ethylenediaminetetaacetic кислота (ЭДТА) в PBS.
    9. Готовят 0,5% казеина в PBS.
    10. Готовят 20% Tween 80 запас в деионизированной воде.
    11. Приготовьте 0,05% твин-80 (от 20% акций) в PBS.
    12. Готовят 50 мМ ацетата натрия в деионизированной воде.
    13. Готовят 1% ТМБ в ДМСО.
    14. Подготовьте 3% Н 2 O 2 Iп DI воды.
    15. Подготовьте 2 М H 2 SO 4 в деионизированной воде.
  2. Добавить 1,4 мкл раствора SPDP в 20 мкл раствора СА.
  3. Выдержите раствор из 5,2 в течение 1,5 ч при комнатной температуре, заворачивали в алюминиевую фольгу, чтобы избежать воздействия света. Этот шаг позволяет сшивающий СПДП приклеиться SA через аминогруппу, образующей пиридилдитио активированные SA.
  4. Добавить 2,4 мкл DDT раствора к раствору с шага 5.3 и инкубировать в течение 1 часа при комнатной температуре. Это позволяет пиридинового 2-тиона расщеплению, что приводит к сульфгидрильных активированные SA.
  5. Добавить 7,5 мкл раствора SMCC 72 мкл раствора HRP и инкубировать в течение 1,5 ч при комнатной температуре, завернутые в алюминиевую фольгу, чтобы избежать воздействия света. Это приводит к HRP Активированный малеимидом связанного с аминогруппой.
  6. Смешайте 17 мкл LC-LC-биотин раствора с 200 мкл раствора BSA и инкубировать в течение 1,5 ч при комнатной температуре, завернутые в алюминиевую фольгу, чтобы избежать воздействия света. Этот шаг позволяет биотина сопряженного то БСА посредством амидной связи.
  7. Передача решения от шагов, 5.4, 5.5 и 5.6 для разделения центробежных концентраторов внутри спиновых трубок.
  8. Для труб, не содержащих SA-SPDP, начиная с шага 5.4, центрифуге при 10000 мкг до объема трубки достигает 100 мкл или в течение 16 мин. Заполните формующей трубки до 500 мкл с PBS-ЭДТА.
    1. Повторите шаг 5,8 пять раз. Хранить запас при температуре 4 ° С.
  9. Для труб , содержащих HRP-SMCC, с шагом 5,5, центрифуге при 10000 х г до тех пор , пока объем не достигнет 25 мкл или в течение 16 мин. Заполните формующей трубки до 500 мкл с PBS.
    1. Повторите шаг 5.9 в пять раз. Хранить запас при температуре 4 ° С.
  10. Для труб , содержащих БСА-биотин, с шагом 5.6, центрифуге при 10000 х г до тех пор , пока объем не достигнет 100 мкл или в течение 12 мин. Заполните формующей трубки до 500 мкл с PBS.
    1. Повторите шаг 5.10 в четыре раза.
    2. Центрифуга при 10000 х г до тех пор, пока объем не достигнет 100 мклили в течение 12 мин. Добавьте 100 мкл PBS на пробирку. Хранить запас при температуре 4 ° С.
  11. Добавить 25 мкл 10 мг / мл раствора HRP с 25 мкл 10 мг / мл раствора СА и хранят при температуре 4 ° С в течение ночи. Это приводит к тому , SA стать конъюгированные с HRP через тиоэфирную связь.
    1. Подготовьте 1: рабочий раствор 4 с раствором в течение ночи и хранят в 4 ° C холодильник. Хранить оставшийся раствор при -20 ° С.
  12. Готовят два раствора, состоящие из БСА-биотин (или БСА) в PBS, путем добавления 10 мкл БСА-биотин запаса (или 10 мкл БСА имеющихся в наличии) до 490 мкл PBS.
  13. Добавьте 100 мкл раствора со стадии 5,12 в каждую лунку 96-луночного полистирола пластины.
  14. Инкубируйте планшет при 37 ° С в течение 1 ч, в фольге.
  15. Промыть лунки планшета с 0,05% Tween 80.
    1. Добавить 200 мкл 0,05% PBS-Tween 80 в лунки. Инкубировать в течение 2 мин при комнатной температуре. Декантируют жидкость.
    2. <li> Повторите шаг 5.15.1 три раза.
  16. Добавить 200 мкл 0,5% раствора казеина в каждую из лунок, в 96-луночный планшет.
  17. Инкубируйте планшет при 37 ° С в течение 1 ч.
  18. Повторите шаг 5,15 мыть лунки три раза.
  19. Готовят раствор путем смешивания 12 мл 0,5% -ного раствора казеина с 7,5 мкл 0,05% Tween 80.
  20. Развести SA-HRP запас 1: 10000 с использованием раствора, полученного на стадии 5.19.
  21. Добавляют 80 мкл раствора, полученного на стадии 5.20 в каждую лунку 96-луночного планшета.
  22. Добавьте 20 мкл приготовленного образца биотина в каждую лунку полистирольного пластины. Супернатанта, полученную в 4,6 могут быть использованы в качестве образца биотина в этом шаге.
  23. Инкубируйте планшет при 37 ° С в течение 1 ч. Этот шаг позволяет конкурентного связывания между свободным биотина и иммобилизации БСА-биотин для сайтов связывания SA-HRP.
  24. Повторите шаг 5,15 мыть лунки три раза.
  25. Смешайте 50 мМ раствор ацетата натрия, 1% раствора ТМБ,и 3% -ного раствора H 2 O 2 при 1000: 1 отношение (20 мл общего объема): 10.
  26. Добавьте 200 мкл раствора со стадии 5,25 в каждую лунку и позволяют сидеть в течение 15 мин при комнатной температуре, покрытой фольгой.
  27. Добавляют 50 мкл 2 М H 2 SO 4 в каждую лунку , чтобы остановить реакцию. Мера OD 450 , используя планшет - ридер.

Подготовка поверхности 6. Прямая Схема управления функционализированного

  1. Подготовьте следующие решения.
    1. Готовят 20 мг / мл LC-LC-биотина в DMSO.
    2. Готовят 10 мг / мл HRP в PBS.
    3. Приготовьте 0,17 мкг / мл SA в PBS.
    4. Готовят 0,5% казеина в PBS.
    5. Готовят 20% Tween 80 запас в деионизированной воде.
    6. Приготовьте 0,05% твин-80 (от 20% акций) в PBS.
    7. Готовят 50 мМ ацетата натрия в деионизированной воде.
    8. Готовят 1% ТМБ в ДМСО.
    9. Подготовьте 3% H 2 O 2 в деионизированной воде.
    10. Подготовьте 2 H 2 SO 4 воде.
  2. Добавить 7,5 мкл LC-LC-биотин до 72 мкл HRP и инкубировать при температуре в течение 1,5 ч при комнатной температуре, заворачивали в алюминиевую фольгу, чтобы избежать воздействия света. Этот шаг вызывает биотина к сопряженной с HRP посредством амидной связи.
  3. Передача раствора со стадии 6.2 в центробежный концентратор внутри формующей трубки
    1. Центрифуга решение при 10000 х г до тех пор, пока объем не достигнет 100 мкл или в течение 12 мин. Заполните формующей трубки до 500 мкл с PBS и повторить центрифугирование и PBS добавление в четыре раза. Хранить запас при температуре 4 ° С.
  4. Добавьте 100 мкл раствора SA с разделом 6.1.3 в каждую лунку в 96-луночные полистирольной пластины.
  5. Инкубируйте планшет при 37 ° С в течение 1 ч, в фольге.
  6. Промыть лунки планшета с 0,05% Tween 80.
    1. Добавить 200 мкл 0,05% Tween 80 в лунки. Инкубировать в течение 2 мин при комнатной температуре. Декантируют жидкость.
    2. Повторите 6.6.1 три раза.
  7. Добавить 200 мкл 0,5% раствора казеина в каждую из лунок, в 96-луночный планшет.
  8. Инкубируйте планшет при 37 ° С в течение 1 ч.
  9. Повторите шаг 6,6 три раза, чтобы промыть лунки.
  10. Развести биотин-ПХ запас 1: 10000 с использованием раствора, полученного на стадии 6.3.
  11. Добавляют 80 мкл раствора, полученного на стадии 6.10 в каждую лунку 96-луночного планшета.
  12. Добавьте 20 мкл приготовленного образца биотина в каждую лунку полистирольного пластины. Супернатанта, полученную в 4,6 могут быть использованы в качестве образца биотина в этом шаге.
  13. Инкубируйте планшет при 37 ° С в течение 1 ч. Этот шаг позволяет конкурентного связывания между свободным биотин и биотин-HRP для иммобилизованных сайтов связывания SA.
  14. Повторите шаг 6.6 мыть лунки три раза.
  15. Смешайте 50 мМ раствор ацетата натрия, 1% -ный раствор ТМБ и 3% H 2 O 2 раствор при 1000: 1 отношение (20 мл общего объема): 10.
  16. Добавьте 200 мкл раствора со стадии 6.15 в каждую лунку и инкубировать в течение 15 мин при комнатной температуре, покрытой фольгой.
  17. Добавить 50 мкл 2 М H 2 SO 4 раствора в каждую лунку , чтобы остановить реакцию. Мера OD 450 , используя планшет - ридер.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Типичные результаты представлены в прилагаемой пяти фигур. Во- первых, мы представляем процесс клонирования графически (рис 1) , так что читатель может визуально следить за критические шаги для создания синтетически сконструированного штамма E.coli. Для того чтобы охарактеризовать динамику популяций клеток, мы обеспечиваем кривую роста (рисунок 2) , порожденную измерения оптической плотности при 600 нм (OD 600) населения. Затем мы покажем , как проверяется регуляторная генная сеть, используя mCherry в качестве прокси для bioB (рисунок 3), что позволяет нам оптически измерить относительную величину bioB , которые будут производиться клеткой при индукции с помощью IPTG. Далее мы приводим данные ответа для косвенного контроля и прямого управления функциональными поверхностями. Эти графики данных (Рисунок 4) были разработаны с использованием измеренных растворов бесплатнобиотин, чтобы охарактеризовать профили отклика функционализованный поверхностей. Наконец, мы приводим характерные данные , показывающие , каким образом сконструированные клетки индуцировали для получения биотин (рисунок 5), тем самым изменяя функционализированных поверхности.

Рисунок 1
Рисунок 1: Проектирование и строительство Индуцибельные, сконструированные клетки. (A) Праймеры были предназначены для выделения гена bioB из кишечно генома E., который кодирует фермент , решающий в синтез биотина пути. (B) P L, Teto-1 и Р -lacI TRC-2 последовательности могут быть выделены из плазмиды , содержащей генетический переключатель с соответствующими праймерами. (С) Извлеченный ген bioB и два фрагмента из тумблера затем может быть использован для создания схемы гена. Добавление IPTG затем может индUCE экспрессию bioB и , таким образом , биотин синтеза , когда DTB добавляют в качестве субстрата для bioB. (D) , Собранный плазмиду трансформировали в K-12 1655 E.coli. Это вызвало присутствие IPTG , чтобы индуцировать экспрессию bioB и , таким образом , биотин синтез с помощью сконструированной клеточной линии , когда DTB была представлена в качестве субстрата. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2: Кривые роста для сконструированные клетки. В сконструированные, адаптивные 1655 клетки дикого типа выращивали и контролировали в минимальных средах (например, биотин , свободных от М9), а также минимальные дополненной DTB (200 нг / мл) и / или IPTG (0,5 мМ). Графики показывают показания OD 600, измеренный через каждые 5 миль N в течение 24 ч. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3: Тестирование генной сети Engineered. Флуоресцентный белок mCherry был использован вместо ген bioB таким образом , чтобы мы могли оптически измерить профиль индукции , когда сконструированные клетки индуцировали IPTG. Мы контрастируют клетки, индуцированные IPTG (красные ромбы) с клетками не индуцированных IPTG (голубыми бриллиантами). Эти результаты демонстрируют эффективность индуцируемого генной сети. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

/55300/55300fig4.jpg "/>
Рисунок 4: Проверка функционализованный материала интерфейса. Подвергая нашу функционализированного поверхность различных концентраций биотина, мы можем измерить оптический отклик путем измерения OD 450 абсорбцию. Эти результаты позволяют генерировать калибровочной кривой, связывающей концентрацию биотин оптической интенсивности реакции. Здесь мы представляем биотина против оптических кривых сигнала для обоих косвенных (слева) и прямой (справа) функционализированных схем поверхности. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 5
Рисунок 5: сконструированные клетки контрольного материала интерфейса. При использовании разделов протокола 5 или 6, мы можем использовать продукты наведенной, сконструированного Cгезов химически модифицировать поверхность функционализированный. Мы можем контролировать эти реакции оптически путем измерения OD 450. Кроме того, с помощью калибровочной кривой на рисунке 4, мы можем связать оптическую интенсивность реакции на биотин в концентрации. Мы представляем здесь различные концентрации биотин, измеренные нашим косвенным контролем схемы функционализированный поверхности, для клеток дикого типа (белый), неиндуцированные клетки, содержащие плазмиду pKE1-Лачи-bioB (оранжевый) и индуцированные клетки, содержащие pKE1-Лачи-bioB плазмида (серый). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

химическая Конечная концентрация Количество
соли 5x M9 1x 20 мл
1 М MgSO 4 2 мМ 200 мкл
1 М CaCl 2 0,1 мМ 10 мкл
20% глюкозы 0,40% 2 мл
2% биотин свободной казаминокислота 0,02% 1 мл
DI воды N / A 76,8 мл

Таблица 1: М9 Рецепт.

имя Праймер Последовательность Применение
1-е CCGCCGGAATTCTCCCTATCAGTGATAGAGATT Извлечение кассеты LĀČI
1-р СCGACGTCTCACTGCCCGCTTTCCAGTC Извлечение кассеты LĀČI
nBioB1-е CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P TRC-2 экстракции
nBioB1-р GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P TRC-2 экстракции
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG добыча bioB
nBioB2-р TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC добыча bioB
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Синтетические РБС дополнение

Таблица 2: Список праймерами.

Шаг 1
Шаг 2 Шаг 3 Шаг 4 Шаг 5 Шаг 6 Шаг 7 Шаг 8 Шаг 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
0:30 0:10 0:30 01: 00 / кб 0:10 0:30 01: 00 / кб 2:00
Повторите 12 раз Повторить 25 раз
-1 ° C / цикл

Таблица 3: ПЦР программы.

имя объем
Клеточный лизат (шаблон) 10 мкл
Праймер (каждый) 0,625 мкл (каждого)
5x буфера Q5 5 мкл
Q5 полимеразной 0,25 мкл
дНТФ Mix 0,5 мкл
DI воды 6,75 мкл

Таблица 4: Цельноклеточные реакции ПЦР (25 мкл).

имя объем
10х буфера реакции 5 мкл
Фермент 1 1 мкл
Фермент 2 1 мкл
Шаблон ДНК 1 мкг
DI воды 43 мкл - объем ДНК

Таблица 5: рестриктазой реакции (50 мкл).

имя объем
ДНК 50 мкг вектор + X мкг вставки
10x лигазы буфера 1 мкл
лигазы Т4 1 мкл
DI воды 8 мкл - объем ДНК

Таблица 6: Лигирование реакции (10 мкл).

имя концентрация Заметки
CaCl 2 100 мМ
Carbeniccilin 50 мг / мл (1000x)
DTB 50 мкг / мл
IPTG 0,5 М
SMCC 20 мг / мл 2 мг в 100 мкл ДМСО
SPDP 20 мг / мл 2 мг в 100 мкл ДМСО
LC-LC-биотин 20 мг / мл 2 мг в 100 мкл ДМСО
HRP 10 мг / мл В PBS
SA (непрямой) 10 мг / мл В PBS
SA (прямой) 0,17 мкг / мл В PBS
БСА 20 мг / мл В PBS
DTT 100mM В DI воде
ЭДТА 5 мМ 18,6 мг в 10 мл PBS
казеин 0,50% В PBS
твина 80 20% В DI воде
Твин 80 в PBS 0,05%
Ацетат натрия 50 мМ В DI воды, Регулировка рН до 5,1 с помощью 3 М HCl
TMB 1% В ДМСО
H 2 O 2 3% В DI воде
H 2 SO 4 2 М В DI воде

Таблица 7: Список реактива Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Мы представили новую стратегию для взаимодействия сконструированных живых клеток с функциональными группами поверхности материала. Это было достигнуто путем разработки клеточной линии, способной синтезировать повышенные уровни биотина при индуцированных IPTG. Повышенные уровни биотина затем могут быть использованы для модификации функционализированный поверхности. Протоколы подробно , как спроектировать кишечно линии клеток E. и как создать два различных функционализированных поверхности.

Критические шаги в этом протоколе происходят по всей конструкции сконструированной клеточной линии. Чтобы избежать проблем , вниз по течению, характеризуя сконструированные штаммы клеток с обеих кривых роста (рис 2) и флуоресцентного отклика (рисунок 3) приветствуется. В случае возникновения процедурных вопросов, другие стратегии Molecular Cloning, такие как экстракция ПЦР и Gibson узла 14, может быть заменен на шаги , где это необходимо. Для оптимизации биотин YieЛД из сконструированной клеточной линии, крайне важно, чтобы гарантировать, что достаточное количество DTB предоставляется клеткам. В наших исследованиях мы обнаружили, что 200 нг / мл DTB вызвало значительное и статистически значимое увеличение производства биотин, когда клетки индуцировали с помощью IPTG. Кроме того, успешное сопряжение БСА-биотин, SA-HRP и биотин-HRP имеет решающее значение для эффективного выполнения и мониторинга косвенных и прямых схем управления. Позаботьтесь, чтобы избежать ненужного воздействия света и позволить конъюгаты инкубировать в течение ночи при 4 ° С, чтобы обеспечить формируется эффективный конъюгат.

Наш протокол предлагает преимущества по сравнению с альтернативными методами 15 из - за его способности обнаруживать небольшие количества биотина , которые являются биологически значимым (пг / мл шкалы) по сравнению с имеющимися в продаже наборов для обнаружения биотин, таких как те , которые основаны на 4'-hydroxyazobenzene-2-карбоновой кислоты конкурентного связывания стратегии. Несмотря на то, используя стрептавидин-биооловом система распространена в области биотехнологии 16, 17, способность нашей системы реагировать на небольшие количества биотина позволяет непосредственно связать нашу методами генной инженерии линии клеток с функционализированного поверхностью.

Одним из потенциальных ограничений нашего протокола является результирующий динамический диапазон обнаружения биотина. В косвенных и прямых схем управления, мы можем обнаружить биотин между 10 2 -10 3 и 10 4 -10 6 пг / мл, соответственно (Рисунок 4). К счастью, низкий диапазон косвенного схемы управления позволяет легко обнаружить продукцию биотин из сконструированных клеток. Тем не менее, тесная полоса косвенного контроля динамического диапазона ограничивает его способность чувствовать большие изменения (в 100 раз) в концентрациях биотина. Изменение динамического диапазона для обоих косвенных и прямых схем управления потребует дополнительных инженерных. Тем не менее, если определение клеточно-производитьd биотин является проблемой, готовя разведения биотин супернатанта на стадии 4.6 , должен позволять исследователю целевой динамический диапазон косвенной схемы управления (рисунок 5). Мы обнаружили, что разведение 1: 5 супернатанта позволило нам эффективно распределять динамический диапазон концепцию косвенного управления. Эта стратегия разведения должна облегчить необходимость изменения динамического диапазона напрямую.

Из двух частей, система клеточного материала, представленный здесь позволяет сконструированные клетки, чтобы изменить состав функционализированного поверхности. Динамические, живые клетки могут интерпретировать их химического окружения для получения генетического ответа. Инженерными этот генетический ответ на увеличение производства биотин, мы можем наделить сконструированные живых клеток с возможностью контролировать и управлять функционализированный поверхность. Следуя протоколы, представленные, сконструированные клетки способны действовать как динамические датчики, способные чтения, обработки и записи условий вокруг гоет с помощью функционализированных интерфейсов. Эта технология может оказать воздействие полей в диапазоне от молекулярной медицины для обнаружения аналита для восстановления окружающей среды.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Авторы выражают благодарность поддержку от премии FA9550-13-1-0108 от Управления ВВС научных исследований США. Авторы дополнительно признают поддержку от премии N00014-15-1-2502 из Управления военно-морских исследований США, финансирование из Института важнейших технологий и прикладных наук в Вирджинии политехнического института и государственного университета, а также от Национального научного фонда Graduate исследований Программа стипендий, награда номер 1607310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics