Använda Syntetisk biologi ingenjör levande celler som har gränssnitt programmerbara material

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Detta dokument presenterar en serie av protokoll för att utveckla manipulerade celler och funktionaliserade ytor som möjliggör syntetiskt engineered E. coli för att styra och manipulera programmerbara materialytor.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi har utvecklat en abiotisk-biotisk gränssnitt som gör att gentekniskt modifierade celler för att styra materialegenskaper hos en funktionaliserad yta. Detta system görs genom att skapa två moduler: en syntetiskt konstruerad stam av E. coli-celler och ett funktionaliserat material gränssnitt. Inom detta papper, vi detalj ett protokoll för genetisk manipulering utvalda beteenden inom en stam av E. coli med användning av molekylära kloningsstrategier. När de har utvecklats, producerar denna stam förhöjda nivåer av biotin när den utsätts för en kemisk inducerare. Dessutom, vi detalj protokoll för att skapa två olika funktionaliserade ytor, vilka var och en är i stånd att svara på cell syntetiserade biotin. Sammantaget presenterar vi en metod för att skapa en länkad, abiotisk-biotiska system som tillåter engineered celler för att styra materialsammansättning och montering på icke-levande substrat.

Introduction

Här rapporterar vi förfarandena för att utveckla en programmerbar substrat kan svara på en kemisk signal från en konstruerad cellinje. 1 Vi gör detta genom att skapa ett biotin-streptavidin gränssnitt som reagerar på biotin produceras av syntetiskt konstruerad Escherichia coli (E. coli) celler. Tidigare har programmerbara ytor är konstruerad för ett brett spektrum av applikationer från toxin upptäckt två och point-of-care diagnos 3 till försvar och säkerhet. 4 Medan programmerbara ytor kan vara användbara som sensorer och ställdon, kan de göras "smartare" genom att förse dem med förmågan att anpassa sig till olika miljöutmaningar. I motsats, även enkla mikroorganismer, såsom E. coli, har inneboende anpassningsförmåga och är i stånd att svara på utmaningarna med sofistikerade och ofta oväntade lösningar. Denna anpassningsförmåga har gjort det möjligt E.coli populationer, som styrs av deras komplexa gennätverk, att kostnadseffektivt söka resurser, 5 skapar förädlade produkter, 6 och strömmikroskala robotik. 7 Genom att koppla de adaptiva fördelarna med levande celler med användning av programmerbara ytor, kan vi skapa en smart substrat som kan svara mot olika miljöförhållanden.

Syntetisk biologi har gett forskarna nya förmågor att programmera beteendet hos levande organismer. Genom att konstruera celler att innehålla nya regulatoriskt gennätverk kan forskare utforma celler som uppvisar en rad programmerade beteenden. 8, 9 Utöver grundforskning, kan dessa beteenden användas för applikationer såsom styrning av material montering och biologiskt producera förädlade produkter. 10 Häri vi detalj hur vi använt verktyg för syntetisk biologi till eningenjören en E. coli-stam som syntetiserar biotin vid induktion. Denna stam har utvecklats med hjälp av restriktionsenzymkloningsmetoder för att montera en plasmid, pKE1-lacl-bioB. Denna plasmid, när transformerades in i E. coli stam K-12 MG1655, förser celler med förmågan att uttrycka förhöjda halter av bioB, ett essentiellt enzym för biotin syntes. När transformerade celler inducerades med isopropyl β-D-1-tiogalaktopyranosid (IPTG) och försedd med en biotin-prekursor, destiobiotin (DTB), var förhöjda nivåer av biotin som produceras.

Biotin: s bindningsinteraktion med streptavidin är en av de starkaste icke-kovalenta bindningar som finns i naturen. Som sådan är biotin-streptavidin samspel både väl karaktäriserade och ytterst användas inom bioteknik. 11 Inom detta manuskript, presenterar vi två strategier som utnyttjar biotin-streptavidin samspel för att känna och upptäcka cell producerade biotin med en funktionaliserade ytan. Vihänvisa till dessa kontrasterande ytor som "indirekta" och "direkta" styrscheman. I den indirekta kontrollschema, konkurrerar cell-producerade biotin med biotin som har konjugerats och immobiliseras på en polystyren yta för streptavidin bindningsställen. Dessutom är den streptavidin konjugerat med pepparrotsperoxidas (HRP). HRP modifierar 3, 3 ', 5, 5'-tetrametylbensidin (TMB), för att producera en optisk signal, 12 som kan övervakas genom att kvantifiera den spektrala absorbansen (dvs optisk densitet) vid 450 nm (OD 450). Således, den indirekta kontrollschema tillåter forskare att mäta cellproducerade biotin genom att övervaka dämpning av OD 450 signalen.

Direkt kontroll systemet utnyttjar streptavidin-biotin händelse genom att immobilisera streptavidin direkt till en materialytan och tillåter cellproducerade biotin och biotinylerad HRP att konkurrera om streptavidin bindningsställen. Återigen, denrelativa nivåerna av cell-producerade biotin övervakas genom att mäta en OD 450-signal.

Sammantaget manipulerade celler och funktionaliserade ytor tillåter oss att styra egenskaperna hos en programmerbar yta genom att inducera nätverk i levande celler. Med andra ord har vi skapat ett system som utnyttjar anpassningsförmåga levande organismer och tillförlitlighet och specifikation av en konstruerad material gränssnitt genom att koppla dessa system tillsammans.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Media och kultur Förberedelse

  1. Förbereda lysogeni buljong (LB) medium genom att blanda 25 g av LB pulver lager med ett L avjoniserat (DI) vatten och autoklavera lösningen vid 121 ° C under 20 min för att sterilisera.
    1. För att förbereda LB-plattor, 15 g agar (1,5%) till LB-medium före sterilisering
    2. Framställa stamlösningar av 1,000x karbenicillin (Cb) i avjoniserat vatten (50 mg / ml).
    3. Om förbereda LB-medium som innehåller ett antibiotikum för selektion av resistenta trans vänta tills steriliserade LB-medium temperatur är under 60 ° C, och sedan lägga till en mikroliter av antibiotika lager för varje 1 ml LB-media.
  2. För M9 minimalt medium (tabell 1), förbereda separata stamlösningar av följande: 5X M9-salter (56,4 g / L), 1 M MgSO 4, 1 M CaCl2, 20% glukos och 2% biotin fria kasaminosyror.
    1. I en autoklav säker flaska, kombinera 20 ml 5x M9 salter, 200 &# 181; L 1 M MgSO 4, 10 mikroliter av 1 M CaCl2, 2 ml 20% glukos, 1 ml 2% biotin-fri kasaminosyror, och 76,8 ml Dl-vatten.
    2. Autoklavera lösning som framställts i steg 1.2.1 vid 121 ° C under 20 min.
  3. Inkubera alla kulturer vid 37 ° C under omröring vid 400 varv per minut. Inkubationstider varierar beroende på experiment och stam, men vanligtvis varar 8-12 timmar.

2. Framställning av Biotin producerande E. coli (Plasmid pKE1-lacl-bioB)

OBS: Den genetiska krets innehåller två delar: en lacl-repressom, som drivs av en P L, tetO-1-promotorn resulterar i konstitutivt uttryck på grund av frånvaron av en tetR repressorprotein, samt ett biotin expressionssystem innehållande P trc-2 promotor följt av en stark ribosom bindningsställe (rbs) som driver expression av bioB. All kloning utfördes i en kommersiell, snabbt delande E. coli strai. Den slutliga konstruktionen transformerades in i E. coli MG1655WT för testning. Primrar (tabell 2) köptes kommersiellt.

  1. Isolera bioB-genen från E. coli-genomet genom att utföra hela celler polymeraskedjereaktion (PCR):
    1. Växer E. coli MG 1655WT celler över natten vid 37 ° C.
    2. I en 0,2 ml PCR-rör, kombinerar en mikroliter av övernattskultur som framställts i steg 2.1.1 med 9 mikroliter sterilt avjoniserat vatten.
    3. Inkubera röret vid 95 ° C under 5 min i en termocykler och omedelbart överföra röret till en -80 ° C frys under 10 min för att lysera cellerna. Detta möjliggör genom-DNA att tjäna som en PCR-mall.
    4. Tina lösningen och tillsätt (i) 2,5 | il vardera av primrarna nBioB2-F1 och nBioB2-R, (ii) 5 | il av 5x-DNA-polymerasbuffert, (iii) 0,25 mikroliter av DNA-polymeras, (iv) 0,5 mikroliter av dNTP-blandning och (v) 6,75 mikroliter av DI-vatten för en total reaktionsvolym av 25 | il(Tabell 4).
    5. Strike sidan av (dvs, flick) röret för att blanda innehållet. Nästa, omedelbart spinn ner röret snabbt (~ 2 s) för att säkerställa att provet är i botten av röret.
    6. Placera röret i en PCR-termocykler och använda det program som beskrivs i tabell 3 med ett ytterligare steg med 3 min vid 95 ° C vid början av protokollet.
    7. Bekräfta lyckad PCR med användning av gelelektrofores (1,0-1,2% agaros i Dl-vatten + etidiumbromid) i Tris-bas, ättiksyra, och EDTA-buffert (TAE). PCR-produkten bör vara 1,070 baspar (bp) långa.
    8. Använda kommersiella kit enligt tillverkarens instruktioner för att extrahera DNA-fragment från gelén från steg 2.1.7.
  2. Isolera P TRC-2-promotorn och lacl operonet från plasmiden pKDL071 13 (artighet av labbet av James Collins vid MIT):
    1. Växer E. coli-celler som innehållerden pKDL071 plasmiden över natten i LB + Cb vid 37 ° C.
    2. Extrahera plasmid-DNA från cellerna med användning av ett kommersiellt miniprep kit enligt tillverkarens instruktioner. Plasmiden kommer att fungera som en PCR-mall.
    3. Följ PCR-protokollet från steg 2.1.4. till 2.1.8. med följande ändringar:
    4. Ersätt lyserade celler med plasmiden extraktet i steg 2.2.2.
    5. Använd 2,5 mikroliter vardera av primers 1-f och 1-R för lacl kassett extraktion. Alternativt kan du använda 2,5 mikroliter vardera av primers nBioB1-f och nBioB1-R för P TRC-2 extraktion.
    6. Utför gelelektrofores (steg 2.1.7) för att bekräfta PCR-produkterna är lacl kassetten och P trc-2 promotorställe. De bör vara 1213 bp och 109 bp långa, respektive.
  3. Använda splitsning genom överlappningsförlängning (SOE) PCR för att bygga den bioB kassett innehållande P trc-2, ett syntetiskt ribosombindande ställe (RBS) i primer nBioB2-f2, och bioB tabell 3.
  4. Sätt konstruktioner (P L, tetO-1 + lacl och P TRC-2 + bioB) i pKE1-MCS plasmidvektor 13 ryggrad (artighet av labbet av James Collins vid MIT) genom uppslutning av vektorn och sätt med restriktionsenzymer:
    1. Extrahera gener med användning av restriktionsenzymer och gelelektrofores. Varje reaktion innehåller (i) 5 ^ il 10 x reaktionsbuffert, (ii) en mikroliter av restriktionsenzym 1, (iii) en mikroliter av restriktionsenzym 2, (iv) åtminstone ett xg DNA, och (v) DI vatten till bringa den slutliga volymen till 50 | il (tabell 5). Smälta med enzymer Aatll och EcoRI för lacl kassetten och med enzymer Hindlll och SacII för bioB kassetten.
    2. Efter reaktionerna är ihopsatta, snabbt virvel dem och kort centrifug (~ 2 s) före inkubation under 1 h vid 37 ° C.
    3. Underdigestion, förbereda geler för elektrofores enligt standardprotokoll.
    4. Kombinera digererad DNA med gelelektrofores 6x laddningsbuffert.
    5. Använda en två-log stege för att kontrollera placeringen av önskade konstruktionen, skär DNA-fragmentet från gelén, och använda kommersiella Gel Extraction kit enligt tillverkarens instruktioner för att extrahera DNA-fragmenten från gelén.
  5. Kvantifiera DNA med spektroskopi och beräkna volymer för 0: 1, 1: 1, och 3: 1 molförhållanden insatsen vektor med hjälp av ekvation 1:
    ekvation 1 ekvation 1
    I ekvation 1, M är förhållandet av insatsen till vektor (0, 1, eller 3), Xi är mängden insatt DNA, i är bp längden av insatsen i baspar, är bp v längden av vektorn i baspar, och Xv är mängden av vektor (50 ng).
  6. Blanda ligeringsreaktion genom att kombinera (i) en mikroliter 10 x ligasbuffert, (ii)1 mikroliter T4-ligas, (iii) 50 ng vektor-DNA, (iv) en massa av insert-DNA som är specifik för varje reaktion, och (v) DI-vatten till 10 | il total reaktionsvolym (tabell 6).
  7. Inkubera vid rumstemperatur (RT) under 1 h.
  8. Under ligeringen inkubation i steg 2,7, förbereda kemiskt kompetenta celler.
    1. Alikvotera 1 ml övernattskulturer i 1,5 ml centrifugrör.
    2. Centrifugera vid 16.200 xg under 1 minut.
    3. Dekantera supernatanten och suspendera pelleten i 200 mikroliter av kylda (på is) 100 mM CaCl2. Suspendera pelleten genom att försiktigt pipettera. Inte virvel.
    4. Placera mikrocentrifugrör på is under 10 min.
    5. Centrifug, avlägsna supernatanten, suspendera pelleten i 100 mikroliter av kylda 100 mM CaCl2, och placera röret på is igen.
    6. Centrifugera röret en sista gång och återsuspendera pelleten i 50 mikroliter av kylda 100 mM CaCl2.
    7. Platsröret på is och använda de kemiskt kompetenta celler omedelbart.
  9. Tillsätt 5 mikroliter av ligerat DNA, som framställts i steg 2.6 och 2.7, till varje rör av kompetenta celler, som framställts i steg 2,8.
  10. Agitera röret en kort stund genom att slås an mot sido (dvs. snärta) rören och sedan placera rören på is under 30 min.
  11. Värmechock rören under 45 s vid 42 ° C och retur rören till is under 2 min.
  12. Pipett celler på selektiv LB-agar + antibiotikaplattor och sprida cellerna med hjälp av glas plätering pärlor.
  13. Inkubera plattorna över natten vid 37 ° C.
  14. Följande morgon, plocka kolonier från insats-positiva plattor (dvs, 1: 1 och 3: 1-plattor). Välj 3 kolonier om 0: 1 negativa kontrollplatta visar ingen tillväxt, eller plocka 5-8 kolonier om 0: 1 platta har en viss tillväxt. Använd plockade kolonier för att inokulera 5 ml LB + antibiotikum och växa under 8 h vid 37 ° C med omrörning.
  15. Extrahera plasmid-DNA från cellerna med användning av en miniprep-kit, enligt tillverkarens instruktioner. Utföra ett test snitt med användning av restriktionsenzymer (enligt samma förfarande som beskrivs i steg 2.4.1.).
  16. Identifiera celler med framgångsrika konstruktioner genom att jämföra längden av de spjälkade DNA-fragment med de förväntade resultaten av en korrekt konstruktion. Kulturer som bär lyckade plasmidkonstruktioner kan konserveras genom att blanda lika delar kultur med en lösning av sterilfiltrerad, 40% glycerol (i avjoniserat vatten) och frysning av blandningen vid -80 ° C.
    OBS: Transformationer av plasmider in i andra E. coli-stammar (dvs MG1655WT) kan åstadkommas genom att följa ovanstående förfarande för framställning av kemiskt kompetenta celler.

3. Cell karakterisering: tillväxtkurvan och dosrespons

  1. Växa manipulerade stammar över natten i LB-medium med ett lämpligt antibiotikum.
  2. För tillväxtkurvor, förbereda 50 ml av minimalt M9 media med och utan IPTG (från en 0,5 M stock) och / eller DTB (från en 500 | j, g / ml stam) enligt följande:
    1. Förbered 0 ng / mL DTB (0 mikroliter av lager) / 0 mM IPTG (0 mikroliter av lager).
    2. Förbered 200 ng / ml DTB (200 mikroliter av lager) / 0 mM IPTG (0 mikroliter av lager).
    3. Förbered 0 ng / mL DTB (0 mikroliter av lager) / 0,5 mM IPTG (50 mikroliter av lager).
    4. Förbered 200 ng / ml DTB (200 mikroliter av lager) / 0,5 mM IPTG (50 mikroliter av lager).
    5. Inokulera med övernattning kultur på 1: 100 i media som anges ovan.
    6. I en 96-brunnars platta, alikvot 200 mikroliter av kulturen, i tre exemplar, till varje brunn.
    7. Mäta OD 600 var 5 min under 24 h med kontinuerlig skakning och inkubation vid 37 ° C i plattläsare.
  3. För dos-responsstudier ersätta bioB genen i pKE1-lacl-bioB med mCherry (en röd fluorescerande protein) för realtids optisk kvantifiering.
  4. Lägg varierande mängder av IPTG som sträcker sig från 0,1 mM till 5 mM för att inducera uttrycki LB-media.
  5. Inokulera med övernattskultur vid en utspädning av 1: 100.
  6. Mäta fluorescensen var 30 min under 15 timmar.

4. Induktion Biotin Produktion från manipulerade celler och Supernatant Förberedelse

  1. Väx pKE1-lacl-bioB i E. coli MG1655 stammen över natten i LB-medium.
  2. Komplettera M9 media med DTB mellan 30 och 200 ng / ml.
  3. Lägg 0,5 mM IPTG för att inducera biotin syntes.
  4. Inokulera kompletteras biotin fria minimala M9 media med odling över natten vid 1: 100 utspädning.
  5. Efter 24 h tillväxt, centrifugera celler och samla biotin-anrikad supernatant.
  6. Mät biotin-berikade supernatanten med indirekt kontroll och direkta kontroll funktionaliserade ytor. Använda supernatanten i stället för biotin provet i steg 5.23 och 6.12, respektive.

5. Indirekt kontrollschema funktionaliserad Ytpreparering

  1. förbereda the efter lösningar.
    1. Bered en SMCC lösning bestående av 20 mg / ml av succinimidyl-trans-4- (maleimidylmethyl) cyklohexan-1-karboxylat (SMCC) i dimetylsulfoxid (DMSO).
    2. Bered en SPDP-lösning bestående av 20 mg / ml av succinimidyl-3- (2-pyridylditio) propionat (SPDP) i DMSO.
    3. Förbered 20 mg / ml LC-LC-biotin i DMSO.
    4. Förbered 10 mg / ml pepparrotsperoxidas (HRP) i fosfatbuffrad saltlösning (PBS).
    5. Förbered 10 mg / ml streptavidin (SA) i PBS.
    6. Förbered 10 mg / ml bovint serumalbumin (BSA) i PBS.
    7. Förbereda 100 mM ditiotreitol (DTT) i DI-vatten.
    8. Förbereda 5 mM ethylenediaminetetaacetic (EDTA) i PBS.
    9. Bered 0,5% kasein i PBS.
    10. Förbered 20% Tween 80 lager i DI vatten.
    11. Förbered 0,05% Tween 80 (från 20% lager) i PBS.
    12. Förbered 50 mM natriumacetat i DI-vatten.
    13. Förbereda en% TMB i DMSO.
    14. Förbereda 3% H2O 2 in Dl-vatten.
    15. Förbered två MH 2 SO 4 i DI-vatten.
  2. Lägg 1,4 mikroliter av SPDP lösning till 20 mikroliter SA lösning.
  3. Inkubera lösningen från 5,2 till 1,5 h vid RT, inlindad i aluminiumfolie för att undvika exponering för ljus. Detta steg gör det möjligt för SPDP tvärbindare att binda till SA via en aminogrupp bildar en pyridylditio-aktiverad SA.
  4. Lägga 2,4 mikroliter av den DDT-lösning till lösningen från steg 5,3 och inkubera i 1 h vid RT. Detta medger en pyridin 2-tion-klyvning, vilket resulterar i en sulfhydryl-aktiverade SA.
  5. Lägg 7,5 mikroliter SMCC lösning till 72 mikroliter HRP-lösning och inkubera under 1,5 timmar vid RT, inslagna i aluminiumfolie för att undvika exponering för ljus. Detta resulterar i en maleimid-aktiverad HRP bunden av en aminogrupp.
  6. Blanda 17 mikroliter LC-LC-biotin lösning med 200 mikroliter BSA-lösning och inkubera i 1,5 timmar vid RT, insvept i aluminiumfolie för att undvika exponering för ljus. Detta steg kan biotin till konjugat to BSA via en amidbindning.
  7. Överför lösningar från steg 5,4, 5,5 och 5,6 för att separera centrifugala anriknings inom spinnrören.
  8. För rör innehållande SA-SPDP, från steg 5,4, centrifugera vid 10.000 xg tills röret volymen uppgår till 100 mikroliter eller under 16 minuter. Fyll rotationsröret till 500 mikroliter med PBS-EDTA.
    1. Upprepa steg 5,8 fem gånger. Förvara lager vid 4 ° C.
  9. För rör innehållande HRP-SMCC, från steg 5,5, centrifugera vid 10.000 xg tills volymen nått 25 mikroliter eller 16 min. Fyll rotationsröret till 500 mikroliter med PBS.
    1. Upprepa steg 5,9 fem gånger. Förvara lager vid 4 ° C.
  10. För rör innehållande BSA-biotin, från steg 5,6, centrifugera vid 10.000 xg tills volymen nått 100 mikroliter eller 12 min. Fyll rotationsröret till 500 mikroliter med PBS.
    1. Upprepa steg 5,10 fyra gånger.
    2. Centrifugera vid 10000 xg tills volymen nått 100 mikrolitereller 12 min. Tillsätt 100 | il av PBS till röret. Förvara lager vid 4 ° C.
  11. Tillsätt 25 mikroliter av 10 mg / ml HRP-lösning med 25 mikroliter av 10 mg / ml SA lösning och förvara vid 4 ° C över natten. Detta bringar SA att bli konjugerad med HRP via en tioeterbindning.
    1. Förbered en 1: 4 arbetslösning med över natten lösning och förvara i 4 ° C kylskåp. Förvara återstående lösning vid -20 ° C.
  12. Bered två lösningar bestående av BSA-biotin (eller BSA) i PBS, genom att tillsätta 10 mikroliter BSA-biotin lager (eller 10 mikroliter BSA lager) till 490 mikroliter PBS.
  13. Tillsätt 100 mikroliter av lösningen från steg 5,12 till varje brunn i en 96-håls polystyren platta.
  14. Inkubera plattan vid 37 ° C under 1 h, insvept i folie.
  15. Tvätta brunnarna i plattan med 0,05% Tween 80.
    1. Tillsätt 200 | il av 0,05% PBS-Tween 80 till brunnarna. Inkubera under 2 min vid rumstemperatur. Häll vätskan.
    2. <li> Upprepa steg 5.15.1 tre gånger.
  16. Tillsätt 200 | il av kasein lösning 0,5% till var och en av brunnarna i 96-brunnar.
  17. Inkubera plattan vid 37 ° C under 1 h.
  18. Upprepa steg 5,15 för att tvätta brunnarna tre gånger.
  19. Bered en lösning genom att blanda 12 ml av 0,5% kasein-lösning med 7,5 mikroliter av 0,05% Tween 80.
  20. Späd SA-HRP lager 1: 10000 med användning av den lösning som framställts i steg 5,19.
  21. Tillsätt 80 mikroliter av lösningen som framställts i steg 5,20 till varje brunn i en 96-brunnsplatta.
  22. Tillsätt 20 mikroliter av det beredda biotin provet till varje brunn i polystyrenplatta. Supernatanten framställd i 4,6 kan användas som den biotin provet i detta steg.
  23. Inkubera plattan vid 37 ° C under 1 h. Detta steg gör det möjligt för konkurrerande bindning mellan fri biotin och immobilisera BSA-biotin för SA-HRP bindningsställen.
  24. Upprepa steg 5,15 för att tvätta brunnarna tre gånger.
  25. Blanda 50 mM natriumacetatlösning, 1% TMB-lösning,och 3% H2O 2-lösning vid en 1000: 10: 1-förhållande (20 ml total volym).
  26. Tillsätt 200 mikroliter av lösningen från steg 5,25 till varje brunn och låt stå i 15 min vid RT, täckt med folie.
  27. Tillsätt 50 | il av 2 MH 2 SO 4 till varje brunn för att stoppa reaktionen. Mäta OD 450 med användning av en plattläsare.

6. direktstyrning Scheme funktionaliserad Ytpreparering

  1. Bered följande lösningar.
    1. Förbered 20 mg / ml LC-LC-biotin i DMSO.
    2. Förbered 10 mg / ml HRP i PBS.
    3. Förbered 0,17 mikrogram / ml SA i PBS.
    4. Bered 0,5% kasein i PBS.
    5. Förbered 20% Tween 80 lager i DI vatten.
    6. Förbered 0,05% Tween 80 (från 20% lager) i PBS.
    7. Förbered 50 mM natriumacetat i DI-vatten.
    8. Förbereda en% TMB i DMSO.
    9. Förbereda 3% H2O 2 i DI-vatten.
    10. Förbered två MH 2 SO 4 vatten.
  2. Lägg 7,5 mikroliter LC-LC-biotin till 72 mikroliter HRP och inkubera vid under 1,5 timmar vid RT, insvept i aluminiumfolie för att undvika exponering för ljus. Detta steg medför biotin till konjugat till HRP via en amidbindning.
  3. Överför lösningen från steg 6,2 till en centrifugalkoncentrator inom en rör-
    1. Centrifugera lösningen vid 10.000 xg tills volymen nått 100 mikroliter eller 12 min. Fyll rör- till 500 mikroliter med PBS och upprepa centrifugering och PBS dessutom fyra gånger. Förvara lager vid 4 ° C.
  4. Tillsätt 100 | il av SA-lösningen från 6.1.3 till varje brunn i en 96-brunnars polystyrenplatta.
  5. Inkubera plattan vid 37 ° C under 1 h, insvept i folie.
  6. Tvätta brunnarna i plattan med 0,05% Tween 80.
    1. Tillsätt 200 mikroliter av 0,05% Tween 80 till brunnarna. Inkubera under 2 min vid rumstemperatur. Häll vätskan.
    2. Upprepa 6.6.1 tre gånger.
  7. Tillsätt 200 | il av kasein lösning 0,5% till var och en av brunnarna i 96-brunnar.
  8. Inkubera plattan vid 37 ° C under 1 h.
  9. Upprepa steg 6,6 tre gånger för att tvätta brunnarna.
  10. Späd biotin-HRP-lager 1: 10000 med användning av den lösning som framställts i steg 6,3.
  11. Tillsätt 80 mikroliter av lösningen som framställts i steg 6,10 till varje brunn i en 96-brunnsplatta.
  12. Tillsätt 20 mikroliter av det beredda biotin provet till varje brunn i polystyrenplatta. Supernatanten framställd i 4,6 kan användas som den biotin provet i detta steg.
  13. Inkubera plattan vid 37 ° C under 1 h. Detta steg gör det möjligt för konkurrerande bindning mellan fri biotin och biotin-HRP för immobiliserade SA bindningsställen.
  14. Upprepa steg 6,6 för att tvätta brunnarna tre gånger.
  15. Blanda 50 mM natriumacetat-lösning, 1% TMB-lösning och 3% H2O 2-lösning vid en 1000: 10: 1-förhållande (20 ml total volym).
  16. Tillsätt 200 mikroliter av lösningen från steg 6.15 till varje brunn och inkubera under 15 min vid RT, täckt med folie.
  17. Tillsätt 50 | il av 2 MH 2 SO 4-lösning till varje brunn för att stoppa reaktionen. Mäta OD 450 med användning av en plattläsare.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Representativa resultat presenteras i de bifogade fem figurer. Först presenterar vi kloning processen grafiskt (figur 1) så att läsaren visuellt kan följa de kritiska stegen för att skapa syntetiskt konstruerad E. coli-stam. För att karakterisera populationsdynamiken hos cellerna, tillhandahåller vi en tillväxtkurva (fig 2), som alstras genom mätning av den optiska densiteten vid 600 nm (OD 600) av befolkningen. Sedan visar vi hur den reglergenen nätverket verifieras, genom att använda mCherry som en proxy för bioB (figur 3), vilket tillåter oss att optiskt mäta den relativa mängden av bioB som skulle produceras av cellen vid induktion med IPTG. Därefter presenterar vi svarsdata för den indirekta-kontroll och direktkontroll funktionaliserade ytor. Dessa data tomter (Figur 4) har utvecklats med hjälp av uppmätta lösningar av fribiotin för att karakterisera de funktionaliserade ytor svar profiler. Slutligen presenteras karakteristiska data som visar hur de modifierade cellerna induceras för att producera biotin (fig 5), och därigenom modifiera de funktionaliserade ytor.

Figur 1
Figur 1: Design och konstruktion av Inducerbara, manipulerade celler. (A) Primrar utformades för att isolera bioB-genen från E. coli-genomet, som kodar för ett avgörande enzym i biotin syntesvägen. (B) P L, kan tetO-1 -lacI och P trc-2-sekvenserna isoleras från en plasmid som innehåller en genetisk vippströmbrytare med motsvarande primrar. (C) Den extraherade bioB-genen och de två fragmenten från vippkontakten kan sedan användas för att skapa den gen kretsen. Tillsatsen av IPTG kan sedan indUCE uttrycket av bioB och därigenom biotin syntes när den DTB tillsätts som ett substrat för bioB. (D) Den sammansatta plasmiden transformerades till K-12 MG1655 E. coli. Detta orsakade närvaron av IPTG för att inducera uttryck av bioB och därigenom biotin syntes genom den manipulerade cellinjen när DTB tillhandahölls som ett substrat. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2: tillväxtkurvor för manipulerade celler. De manipulerade, inducerbara MG1655 av vildtyp-celler odlades och övervakades i minimalt media (dvs biotin-free M9 media), såväl som minimalt medium kompletterat med DTB (200 ng / ml) och / eller IPTG (0,5 mM). Kurvorna visar OD 600 läsning, mätt var 5 mi n under 24 timmar. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3: Testa Engineered Gene Network. Det fluorescerande proteinet mCherry användes i stället för den bioB-genen så att vi optiskt kunde mäta induktionsprofilen när manipulerade celler inducerades med IPTG. Vi kontrastera celler inducerade med IPTG (röda diamanter) med cellerna inte inducerade med IPTG (blå diamanter). Dessa resultat visar effekten av den inducerbara genen nätverk. Klicka här för att se en större version av denna siffra.

/55300/55300fig4.jpg "/>
Figur 4: Kontroll av den funktionaliserade Material gränssnitt. Genom att exponera vår funktionaliserade ytan till varierande koncentrationer av biotin, har vi möjlighet att mäta det optiska svaret genom att mäta OD 450-absorbans. Dessa resultat tillåter oss att generera en kalibreringskurva, som förbinder den koncentration av biotin till den optiska intensiteten av svaret. Här presenterar vi biotin kontra optiska signalkurvor för både indirekt (till vänster) och direkt (höger) funktionaliserade ytan system. Klicka här för att se en större version av denna siffra.

figur 5
Figur 5: Konstruerad Celler kontrollmaterialet Interface. Genom att använda protokoll avsnitten 5 eller 6, vi kan använda produkter från inducerade, konstruerad calnar att kemiskt modifiera den funktionaliserade ytan. Vi kan övervaka dessa svar optiskt genom att mäta OD 450. Vidare, genom att använda kalibreringskurvan enligt figur 4, kan vi koppla den optiska intensiteten i svaret till biotin inom koncentrations. Vi presenterar här de olika biotin koncentrationer, mätt med vår indirekta kontrollschema funktionaliserade ytan, för vildtyp celler (vita), icke-inducerade celler innehållande pKE1-lacl-bioB plasmid (orange) och inducerade celler innehållande pKE1-lacl-bioB plasmid (grå). Klicka här för att se en större version av denna siffra.

Kemisk slutlig koncentration mängd
5x M9-salter 1x 20 ml
1 M MgSO 4 2 mM 200 mikroliter
1 M CaCl2 0,1 mM 10 mikroliter
20% glukos 0,40% 2 ml
2% biotin-fri kasaminosyra 0,02% 1 ml
DI vatten N / A 76,8 ml

Tabell 1: M9 Media Recept.

namn primer sekvens Användande
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT lacl kassett extraktion
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC lacl kassett extraktion
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P TRC-2 extraktion
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P TRC-2 extraktion
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB extraktion
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB extraktion
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Syntetiskt RBS tillsats

Tabell 2: Förteckning över Primers.

Steg 1
Steg 2 steg 3 steg 4 steg 5 steg 6 steg 7 steg 8 steg 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
Upprepa 12 gånger Upprepa 25 gånger
-1 ° C / cykel

Tabell 3: PCR-program.

namn Volym
Cellysat (mall) 10 mikroliter
Primer (vardera) 0,625 mikroliter (vardera)
5x Q5 buffert 5 mikroliter
Q5 polymeras 0,25 mikroliter
dNTP Mix 0,5 | il
DI vatten 6,75 mikroliter

Tabell 4: Hela Cell PCR-reaktion (25 | il).

namn Volym
10x reaktionsbuffert 5 mikroliter
enzym 1 1 mikroliter
enzym 2 1 mikroliter
mall-DNA 1 ^ g
DI vatten 43 mikroliter - volym av DNA

Tabell 5: Restriktionsenzymdigerering Reaktion (50 mikroliter).

namn Volym
DNA 50 mikrogram vektor + X ig insats
10 x ligasbuffert 1 mikroliter
T4-ligas 1 mikroliter
DI vatten 8 mikroliter - volym av DNA

Tabell 6: Ligering Reaktion (10 mikroliter).

namn Koncentration Anmärkningar
CaCl2 100 mM
Carbeniccilin 50 mg / ml (1000x)
DTB 50 | j, g / ml
IPTG 0,5 M
SMCC 20 mg / ml 2 mg till 100 pl DMSO
SPDP 20 mg / ml 2 mg till 100 pl DMSO
LC-LC-biotin 20 mg / ml 2 mg till 100 pl DMSO
HRP 10 mg / ml i PBS
SA (indirekt) 10 mg / ml i PBS
SA (direkt) 0,17 | ig / ml i PBS
BSA 20 mg / ml i PBS
DTT 100 mM I avjoniserat vatten
EDTA 5 mM 18,6 mg i 10 ml PBS
Kasein 0,50% i PBS
Tween 80 20% I avjoniserat vatten
Tween 80 i PBS 0,05%
Natriumacetat 50 mM I DI vatten, justera till 5,1 pH med användning av 3 M HCI
TMB 1% i DMSO
H2O 2 3% I avjoniserat vatten
H 2 SO 4 2 M I avjoniserat vatten

Tabell 7: Förteckning över reagenslösningar.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi har presenterat en ny strategi för samverkan manipulerade levande celler med ett funktionaliserat material yta. Detta åstadkoms genom att utveckla en cellinje med förmåga att syntetisera förhöjda nivåer av biotin vid induktion med IPTG. De förhöjda nivåerna av biotin kan sedan användas för att modifiera den funktionaliserade ytan. De protokoll som beskrivs hur man konstruera E. coli-cell linje och hur man skapar två olika funktionaliserade ytor.

Kritiska steg i detta protokoll förekommer i hela konstruktionen av den manipulerade cellinjen. För att undvika problem nedströms, som kännetecknar de tekniska cellstammar med både tillväxtkurvor (figur 2) och fluorescerande svar (Figur 3) uppmuntras. Skulle procedurfrågor uppstår, andra molekylära kloningsstrategier, såsom PCR extraktion och Gibson aggregat 14, kan ersätta steg där så är lämpligt. För att optimera biotin Yield av den modifierade cellinjen, är det viktigt att se till att en tillräcklig mängd DTB ges till cellerna. I våra studier fann vi att 200 ng / ml DTB framkallade en betydande och statistiskt signifikant ökning biotin produktionen när celler inducerades med IPTG. Dessutom är avgörande för att effektivt utföra och övervaka de indirekta och direkta styrscheman framgångsrik konjugering av BSA-biotin, SA-HRP och biotin-HRP. Vara noga med att undvika onödig exponering för ljus och tillåta konjugaten att inkubera över natten vid 4 ° C för att säkerställa en effektiv konjugat bildas.

Vår protokoll erbjuder fördelar jämfört med alternativa metoder 15 på grund av dess förmåga att detektera små mängder av biotin som är biologiskt relevant (pg / ml-skalan) i jämförelse med kommersiellt tillgängliga biotin detektionssatser, såsom de baserade på 4'-hydroxyazobenzene-2-karboxylsyra konkurrerande bindningsstrategier. Även om användning av streptavidin-biotenn-systemet är vanligt inom bioteknik 16, 17, vår systemets förmåga att svara på små mängder av biotin ger oss möjlighet att direkt länka vår genetiskt manipulerade cellinje med den funktionaliserade ytan.

En potentiell begränsning av våra protokoll är den resulterande dynamiska området för biotin detektering. I de indirekta och direkta styrscheman, vi kan upptäcka biotin mellan 10 2 -10 3 och 10 4 -10 6 pg / ml, respektive (Figur 4). Lyckligtvis, den lägsta kategorin av den indirekta kontrollschema ger oss möjlighet att snabbt detektera biotin produktion från manipulerade celler. Men den täta band av indirekt kontroll dynamiska omfånget begränsar dess förmåga att känna stora förändringar (100-faldig) i biotin koncentrationer. Ändra det dynamiska omfånget för både de indirekta och direkta kontroll system skulle kräva ytterligare teknik. Om emellertid detektion av cell producerad biotin är ett problem, förbereder utspädningar av biotin supernatanten i steg 4,6 bör göra det möjligt forskaren att rikta det dynamiska omfånget av den indirekta kontrollschema (Figur 5). Vi funnit att en 1: 5 spädning av supernatanten tillät oss att rikta den indirekta kontrollschema dynamiska omfång effektivt. Denna utspädning strategi bör minska behovet av att ändra det dynamiska omfånget direkt.

Den tvådelade, cell-materialsystem som presenteras här tillåter engineered celler för att modifiera sammansättningen av en funktionaliserad yta. Dynamiska, levande celler kan tolka deras kemiska omgivning för att producera en genetisk respons. Genom att konstruera denna genetiska svar att öka biotin produktion, kan vi förse manipulerade levande celler med förmågan att kontrollera och manipulera en funktionaliserad yta. Genom att följa protokollen som presenteras, manipulerade celler kan fungera som dynamiska givare, som kan läsa, bearbetning och registrering av förhållanden runt them via funktionaliserade gränssnitt. Denna teknik kan påverka områden som sträcker sig från molekylärmedicin till analytdetektering för miljöåterställning.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Författarna erkänner tacksamt stöd från tilldelning FA9550-13-1-0108 från Air Force Office of Scientific Research i USA. Författarna dessutom erkänner stöd från tilldelning N00014-15-1-2502 från Office of Naval Research i USA, finansiering från Institutet för kritisk teknik och tillämpad vetenskap vid Virginia Polytechnic Institute och State University och från National Science Foundation Graduate Research Fellowship Program, utmärkelse nummer 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics