El uso de la biología sintética para Ingeniero células vivas que interactúan con materiales programables

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este artículo presenta una serie de protocolos para el desarrollo de células modificadas y las superficies funcionalizadas que permiten sintéticamente por ingeniería genética de E. coli para controlar y manipular las superficies de materiales programables.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hemos desarrollado una interfaz abiótico-bióticos que permite a las células por ingeniería genética para el control de las propiedades materiales de una superficie funcionalizada. Este sistema se hace mediante la creación de dos módulos: una cepa sintéticamente ingeniería de células de E. coli y una interfaz de material funcionalizado. Dentro de este manuscrito detallamos un protocolo para la ingeniería genética de los comportamientos seleccionados dentro de una cepa de E. coli usando las estrategias de clonación molecular. Una vez desarrollado, esta cepa produce niveles elevados de biotina cuando se expone a un inductor químico. Adicionalmente, detalle protocolos para la creación de dos superficies funcionalizadas diferentes, cada uno de los cuales es capaz de responder a la biotina sintetizada por células. Tomados en conjunto, se presenta una metodología para la creación de un sistema enlazado, abiótico-bióticos que permite que las células para controlar la composición del material y montaje en sustratos inertes ingeniería.

Introduction

Aquí, se presenta los procedimientos para desarrollar un sustrato programable capaz de responder a una señal química a partir de una línea celular diseñada. 1 Hacemos esto mediante la creación de una interfaz de biotina-estreptavidina que responde a la biotina producida por las células sintéticamente ingeniería Escherichia coli (E. coli). Anteriormente, las superficies programables han sido diseñados para una amplia gama de aplicaciones, desde la detección de la toxina 2 y en el punto de atención de diagnóstico 3 con la defensa y la seguridad. 4 Mientras superficies programables pueden ser útiles como sensores y actuadores, que se pueden hacer más "inteligente" dotándolos de la capacidad de adaptarse a diferentes retos medioambientales. Por el contrario, incluso los microorganismos simples, tales como E. coli, tienen la capacidad de adaptación inherente y son capaces de responder a los desafíos con soluciones sofisticadas y, a menudo inesperados. Esta adaptabilidad ha permitido E.poblaciones coli, controladas por sus redes de genes complejos, de manera rentable buscar recursos, 5 crear productos de valor añadido, 6 e incluso potencia robótica micro-escala. 7 Mediante el acoplamiento de las ventajas adaptativas de las células vivas con el uso de superficies programables, podemos crear un sustrato inteligente capaz de dar respuesta a diferentes condiciones ambientales.

La biología sintética ha dado a los investigadores nuevas habilidades para programar el comportamiento de los organismos vivos. Mediante el diseño de las células que contienen las redes de regulación de genes nuevos, los investigadores pueden diseñar células que exhiben una gama de comportamientos programados. 8, 9 Más allá de la investigación básica, estos comportamientos pueden ser utilizados para aplicaciones tales como el control conjunto de materiales y biológicamente la producción de productos de valor añadido. 10 En esto, nos detalle la forma en que utilizamos las herramientas de la biología sintética para bañogineer una cepa de E. coli que sintetiza la biotina a la inducción. Esta cepa se desarrolló mediante el uso de métodos de clonación de enzimas de restricción para montar un plásmido, pKE1-lacI-bioB. Este plásmido, cuando se transforma en la cepa de E. coli K-12 MG1655, dota a las células con la capacidad de expresar niveles elevados de bioB, una enzima esencial para la síntesis de la biotina. Cuando se indujeron células transformadas con isopropil β-D-1-tiogalactopiranósido (IPTG) y provisto de un precursor de biotina, destiobiotina (DTB), se produjeron niveles elevados de biotina.

interacción de unión de biotina con estreptavidina es uno de los enlaces más fuertes no covalentes que se encuentran en la naturaleza. Como tal, la interacción biotina-estreptavidina es a la vez bien caracterizado y altamente empleado en la biotecnología. 11 Dentro de este manuscrito, se presentan dos estrategias que emplean la interacción biotina-estreptavidina para detectar y detectar la biotina producida por células con una superficie funcionalizada. Nosotrosreferirse a estas superficies contrastantes como los esquemas de control "indirectos" y "directos". En el esquema de control indirecto, la biotina producida por células compite con biotina que se ha conjugado e inmovilizado en una superficie de poliestireno para estreptavidina sitios de unión. Además, la estreptavidina está conjugado con peroxidasa de rábano (HRP). HRP modifica 3, 3 ', 5, 5' tetrametilbencidina (TMB), para producir una señal óptica, 12 que pueden ser controlados mediante la cuantificación de la absorbancia espectral (es decir, densidad óptica) a 450 nm (OD 450). Por lo tanto, el esquema de control indirecto permite a los investigadores medir la biotina producida por células mediante el control de la atenuación de la señal de OD 450.

El esquema de control directo explota el caso de estreptavidina-biotina mediante la inmovilización de estreptavidina directamente a una superficie del material y permitiendo que la biotina producida por células y HRP biotinilada para competir por los sitios de unión de estreptavidina. Una vez más, lalos niveles relativos de biotina producida por células son monitoreados mediante la medición de una señal OD 450.

En su conjunto, las células modificadas y las superficies funcionalizadas nos permiten controlar las propiedades de una superficie programable mediante la inducción de las redes en las células vivas. En otras palabras, hemos creado un sistema que aprovecha la capacidad de adaptación de los organismos vivos y la fiabilidad y la especificación de una interfaz material de ingeniería mediante la vinculación de estos sistemas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Medios y Cultura Preparación

  1. Preparar el caldo de medios lysogeny (LB) mezclando 25 g de polvo stock LB con 1 litro de agua desionizada (DI) y el tratamiento en autoclave de la solución a 121 ° C durante 20 minutos para esterilizar.
    1. Para preparar placas de LB, añadir 15 g de agar (1,5%) a los medios LB antes de la esterilización
    2. Preparar soluciones madre de 1,000x carbenicilina (Cb) en agua DI (50 mg / ml).
    3. Si la preparación de medio LB que incluye un antibiótico para la selección de transformantes resistentes, espere hasta que la temperatura del medio LB esterilizada está por debajo de 60 ° C y, a continuación, añadir 1 l de estándar de antibióticos por cada 1 ml de medios LB.
  2. Para M9 medio mínimo (Tabla 1), se preparan soluciones madre separadas de los siguientes: sales de 5X M9 (56,4 g / L), M MgSO4, 1 M CaCl 2, 20% de glucosa, y 2% de casaminoácidos libre de biotina 1.
    1. En una botella segura autoclave, se combinan 20 ml de 5x M9 sales, y 200# 181; L de 1M MgSO 4, 10 l de 1 M CaCl 2, 2 ml de 20% de glucosa, 1 ml de casaminoácidos sin biotina 2%, y 76,8 ml de agua DI.
    2. Esterilizar en autoclave la solución preparada en el paso 1.2.1 a 121 ° C durante 20 min.
  3. Incubar todas las culturas a 37 ° C con agitación a 400 rpm. Los tiempos de incubación varían en función del experimento y la tensión, pero por lo general una duración de 8 a 12 h.

2. Generación de E. coli que produce biotina (plásmido pKE1-lac-bioB)

NOTA: El circuito genético contiene dos partes: un represor lacI, impulsados por un P L, teto-1 promotor resulta en la expresión constitutiva debido a la ausencia de una proteína represora tetR, así como un sistema de expresión de la biotina que contiene el P trc-2 promotor seguido por un sitio de unión al ribosoma fuerte (rbs) la expresión de bioB de conducción. Toda la clonación fue ejecutado, que se dividen rápidamente stra coli comercial E.en. La construcción final se transformó en E. coli MG1655WT para la prueba. Los cebadores (Tabla 2) fueron adquiridos comercialmente.

  1. Aislar genes bioB del genoma de E. coli mediante la realización de la reacción en cadena de la polimerasa de células enteras (PCR):
    1. Se cultivan las células de E. coli MG 1655WT la noche a 37 ° C.
    2. En un tubo de 0,2 ml PCR, combine 1 l de cultivo de una noche preparada en el paso 2.1.1 con 9 l de agua DI estéril.
    3. Incubar el tubo a 95 ° C durante 5 min en un termociclador y transferir inmediatamente el tubo a un congelador C -80 ° durante 10 minutos para lisar las células. Esto permite que el ADN genómico para servir como una plantilla de PCR.
    4. Descongelar la solución y añadir (i) de 2,5 l cada uno de los cebadores nBioB2-F1 y nBioB2-R, (ii) 5 l de tampón de ADN polimerasa 5x, (iii) 0,25 l de ADN polimerasa, (iv) 0,5 l de mezcla de dNTP y (v) 6,75 l de agua DI para un volumen total de reacción de 25 l(Tabla 4).
    5. Golpear al lado de (es decir, recorre) el tubo para mezclar su contenido. A continuación, girar inmediatamente hacia abajo del tubo rápidamente (~ 2 s) para asegurar que la muestra está en el fondo del tubo.
    6. Colocar el tubo en un termociclador PCR y usar el programa descrito en la Tabla 3 con un paso adicional de 3 min a 95 ° C al comienzo del protocolo.
    7. Confirmar usando electroforesis en gel PCR exitosa (1,0 a 1,2% de agarosa en agua DI + bromuro de etidio) en la base de Tris, ácido acético, y el tampón de EDTA (TAE). El producto de PCR debería ser 1.070 pares de bases (pb) de largo.
    8. Utilice kits comerciales de acuerdo con las instrucciones del fabricante para extraer los fragmentos de ADN a partir de gel de la etapa 2.1.7.
  2. Aislar el TRC-2 promotor P y el operón lac del plásmido pKDL071 13 (cortesía del laboratorio de James Collins en el MIT):
    1. Se cultivan las células de E. coli que contienenel plásmido pKDL071 durante la noche en LB + Cb a 37 ° C.
    2. Extraer el ADN plásmido de las células usando un kit miniprep comercial de acuerdo con las instrucciones del fabricante. El plásmido servirá como una plantilla de PCR.
    3. Siga el protocolo de PCR a partir de medidas 2.1.4. a 2.1.8. con las siguientes modificaciones:
    4. Reemplazar las células lisadas con el extracto de plásmido en el paso 2.2.2.
    5. Use 2,5 l cada uno de los cebadores 1-F y 1-r para la extracción de casete lacI. Como alternativa, utilice 2,5 l cada uno de los cebadores nBioB1-F y nBioB1-R para la extracción de P-2 trc.
    6. Realizar electroforesis en gel (etapa 2.1.7) para confirmar los productos de PCR son el casete de lacI y P trc-2 sitio promotor. Deben ser 1.213 pb y 109 pb, respectivamente.
  3. Utilice empalme por extensión de solapamiento (SOE) PCR para construir el casete de bioB que contiene P trc-2, un sitio de unión a ribosoma sintético (RBS) en el cebador nBioB2-f2, y la bioB Tabla 3.
  4. Construcciones de inserción (P L, teto-1 + lacI y P-2 + TRC bioB) en el pKE1-MCS plásmido vector columna vertebral 13 (cortesía del laboratorio de James Collins en el MIT) digiriendo el vector e inserte con enzimas de restricción:
    1. Extracto de genes utilizando enzimas de restricción y electroforesis en gel. Cada reacción contiene (i) 5 l de 10x tampón de reacción, (ii) 1 l de enzima de restricción 1, (iii) 1 l de enzima de restricción 2, (iv) al menos 1 g de ADN, y (v) de agua DI a llevar el volumen final a 50 l (Tabla 5). Digerir con las enzimas EcoRI y AatII para el casete lacI y con las enzimas HindIII y SacII para el casete bioB.
    2. Después de las reacciones se montan, de forma rápida vórtice ellos y centrifugar brevemente (~ 2 s) antes de la incubación durante 1 hora a 37 ° C.
    3. Durantela digestión, preparar geles para electroforesis de acuerdo con protocolos estándar.
    4. Combinar ADN digerido con tampón de carga 6x electroforesis en gel.
    5. Use una escalera 2-log para verificar la ubicación de construcción deseada, cortar fragmento de ADN desde el gel, y el uso de kits de extracción de gel comerciales de acuerdo con las instrucciones del fabricante para extraer los fragmentos de ADN del gel.
  5. Cuantificar el ADN usando espectroscopia y calcular los volúmenes de 0: 1, 1: 1, y 3: 1 relaciones molares de inserción al vector usando la ecuación 1:
    Ecuación 1 Ecuación 1
    En la ecuación 1, M es la relación de inserción a vector (0, 1, o 3), X i es la cantidad de inserto de ADN, pb i es la longitud de la inserción en pares de bases, pb v es la longitud del vector en pares de bases, y X v es la cantidad de vector (50 ng).
  6. Mezcla de reacción de ligación mediante la combinación de (i) 1 l de ligasa 10X Buffer, (ii)1 l de T4 ligasa, (iii) 50 ng de ADN vector, (iv) una masa de ADN del inserto específico a cada reacción, y (v) de agua DI a 10 l de volumen de reacción total (Tabla 6).
  7. Se incuba a temperatura ambiente (RT) durante 1 h.
  8. Durante la incubación de ligación en el paso 2.7, preparar células químicamente competentes.
    1. Alícuota de 1 ml de cultivos de una noche en tubos de centrífuga de 1,5 ml.
    2. Centrifugar a 16.200 xg durante 1 min.
    3. Se decanta el sobrenadante y resuspender el precipitado en 200 l de frío (en hielo) 100 mM CaCl2. Resuspender el precipitado pipeteando con suavidad. No hacer vórtice.
    4. Se coloca el tubo de microcentrífuga en hielo durante 10 min.
    5. Centrífuga, eliminar el sobrenadante, resuspender el precipitado en 100 l de frío mM CaCl2 100, y colocar el tubo en hielo nuevo.
    6. Centrifugar el tubo por última vez y resuspender el precipitado en 50 l de enfriado 100 mM CaCl 2.
    7. Lugarel tubo en hielo y el uso de las células químicamente competentes inmediatamente.
  9. Añadir 5 l de ADN ligado, preparados en los pasos 2.6 y 2.7, a cada tubo de las células competentes, preparados en el paso 2.8.
  10. Agitar el tubo brevemente al golpear el lado (es decir, parpadeo) de los tubos y luego se colocan los tubos en hielo durante 30 min.
  11. Choque térmico de los tubos durante 45 s a 42 ° C y salir de los tubos en hielo durante 2 min.
  12. células pipeta sobre selectivo de agar LB + placas de antibióticos y se propagan las células usando perlas de vidrio de chapado.
  13. Se incuban las placas durante la noche a 37 ° C.
  14. A la mañana siguiente, pick-colonias de las placas de inserción positiva (es decir, 1: 1 y 3: 1 placas). Pick 3 colonias si el 0: 1 placa de control negativo no muestra crecimiento, o recoger 5-8 colonias si el 0: 1 placa tiene un cierto crecimiento. Utilice las colonias escogidas para inocular 5 ml de LB + antibiótico y crecer durante 8 horas a 37 ° C con agitación.
  15. Extraer el ADN plásmido de las células utilizando un miniprkit ep, siguiendo las instrucciones del fabricante. Realizar un corte de prueba utilizando enzimas de restricción (siguiendo el mismo procedimiento que se detalla en el paso 2.4.1.).
  16. Identificar las células con construcciones de éxito mediante la comparación de la longitud de los fragmentos de ADN digeridos con los resultados esperados de una construcción correcta. Los cultivos que llevan construcciones de plásmidos de éxito se pueden conservar mediante la mezcla de partes iguales de cultivo con una solución de, 40% de glicerol esterilizada por filtración (en agua DI) y la congelación de la mezcla a -80 ° C.
    NOTA: Transformaciones de plásmidos en otras cepas de E. coli (es decir, MG1655WT) pueden llevarse a cabo siguiendo el procedimiento anterior para la fabricación de células químicamente competentes.

3. Caracterización de la célula: Curva de Crecimiento y de respuesta a la dosis

  1. Crecer cepas de ingeniería durante la noche en medio LB con un antibiótico apropiado.
  2. Para las curvas de crecimiento, preparar 50 ml de medio mínimo M9 con y sin IPTG (de unos 0,5 M stac) y / o DTB (de una 500 mg / mL de stock) como sigue:
    1. Preparar 0 ng / ml DTB (0 l de la acción) / 0 mM IPTG (0 l de la acción).
    2. Preparar 200 ng / ml DTB (200 l de existencias) / 0 mM IPTG (0 l de la acción).
    3. Preparar 0 ng / ml DTB (0 l de la acción) / mM IPTG 0,5 (50 l de la acción).
    4. Preparar 200 ng / ml DTB (200 l de existencias) / mM IPTG 0,5 (50 l de la acción).
    5. Inocular con la cultura durante la noche a 1: 100 en el medio especificado anteriormente.
    6. En una placa de 96 pocillos, alícuota de 200 l de la cultura, por triplicado, a cada pocillo.
    7. Medir OD 600 cada 5 min durante 24 h con agitación continua y la incubación a 37 ° C en un lector de placas.
  3. Para los estudios de dosis-respuesta, reemplazar el gen bioB en pKE1-lacI-bioB con mCherry (una proteína fluorescente de color rojo) para la cuantificación óptica en tiempo real.
  4. Añadir cantidades variables de IPTG que van desde 0,1 mM a 5 mM para inducir la expresiónen medio LB.
  5. Inocular con cultivo durante la noche en una dilución de 1: 100.
  6. Medir la fluorescencia cada 30 min durante 15 h.

4. Inducir Biotina La producción de células de ingeniería y el sobrenadante Preparación

  1. Crecer pKE1-lac-bioB en la cepa de E. coli MG1655 durante la noche en medio LB.
  2. Suplemento medio M9 con DTB que van de 30 a 200 ng / mL.
  3. Añadir IPTG 0,5 mM para inducir la síntesis de la biotina.
  4. Inocular suplementados, medio M9 mínimo exento de biotina con cultivo de una noche en la dilución 1: 100.
  5. Después de 24 h de crecimiento, las células de centrífuga y se recoge el sobrenadante de biotina-enriquecido.
  6. Medir sobrenadante biotina-enriquecido con el control indirecto y el control directo superficies funcionalizadas. Usar el sobrenadante en lugar de la muestra de biotina en los pasos 5.23 y 6.12, respectivamente.

5. indirecta Preparación de la superficie Esquema de control funcionalizado

  1. preparar THe las siguientes soluciones.
    1. Preparar una solución de SMCC que consiste en 20 mg / ml de succinimidilo trans-4- (maleimidylmethyl) ciclohexano-1-carboxilato de etilo (SMCC) en sulfóxido de dimetilo (DMSO).
    2. Preparar una solución de SPDP que consiste en 20 mg / ml de succinimidil 3- (2-piridilditio) propionato (SPDP) en DMSO.
    3. Preparar 20 mg / mL LC-LC-biotina en DMSO.
    4. Preparar 10 mg / ml de peroxidasa de rábano (HRP) en solución salina tamponada con fosfato (PBS).
    5. Preparar 10 mg / ml de estreptavidina (SA) en PBS.
    6. Preparar 10 mg / ml de albúmina de suero bovino (BSA) en PBS.
    7. Preparar ditiotreitol 100 mM (DTT) en agua DI.
    8. Preparar ácido 5 mM ethylenediaminetetaacetic (EDTA) en PBS.
    9. Preparar 0,5% de caseína en PBS.
    10. Preparar el 20% de Tween 80 acciones de agua DI.
    11. Preparar un 0,05% de Tween 80 (de 20% en acciones) en PBS.
    12. Preparar 50 mM de acetato de sodio en agua DI.
    13. Preparar 1% de TMB en DMSO.
    14. Preparar 3% de H 2 O 2 in agua DI.
    15. Preparar 2 MH 2 SO 4 en agua DI.
  2. Añadir 1,4 l de la solución de SPDP a 20 l solución SA.
  3. Incubar la solución de 5,2 durante 1,5 horas a temperatura ambiente, envuelto en papel de aluminio para evitar la exposición a la luz. Este paso permite que el agente de reticulación con SPDP se una a SA a través de un grupo amino formando un SA-piridilditio activado.
  4. Añadir 2,4 l de la solución de DDT a la solución de la etapa 5.3 y se incuba durante 1 h a TA. Esto permite una piridina escisión 2-tiona, resultando en una SA sulfhidrilo activado.
  5. Añadir 7,5 l solución de SMCC a 72 l solución de HRP y se incuba durante 1,5 horas a temperatura ambiente, envueltas en papel de aluminio para evitar la exposición a la luz. Esto resulta en una HRP activada por maleimida unido por un grupo amino.
  6. Mezcle la solución 17 l LC-LC-biotina con 200 l solución de BSA y se incuban durante 1,5 horas a temperatura ambiente, envuelto en papel de aluminio para evitar la exposición a la luz. Este paso permite a biotina conjugado to BSA a través de un enlace amida.
  7. La transferencia de las soluciones de los pasos 5.4, 5.5 y 5.6 para separar concentradores centrífugos dentro de tubos de centrifugado.
  8. Para los tubos que contienen SA-SPDP, desde el paso 5.4, se centrifuga a 10.000 xg hasta que el volumen del tubo alcanza los 100 l o durante 16 min. Llenar el tubo de centrifugado de 500 l con PBS-EDTA.
    1. Repita el paso 5.8 de cinco veces. Guarde el archivo a 4 ° C.
  9. Para los tubos que contienen HRP-SMCC, desde el paso 5.5, se centrifuga a 10.000 xg hasta que el volumen alcanza los 25 l o durante 16 min. Llenar el tubo de centrifugado de 500 l con PBS.
    1. Repita el paso 5.9 de cinco veces. Guarde el archivo a 4 ° C.
  10. Para los tubos que contienen BSA-biotina, de la etapa 5.6, se centrifuga a 10.000 xg hasta que el volumen alcanza los 100 l o 12 min. Llenar el tubo de centrifugado de 500 l con PBS.
    1. Repita el paso 5.10 cuatro veces.
    2. Se centrifuga a 10.000 xg hasta que el volumen alcanza los 100 lo durante 12 min. Añadir 100 ml de PBS al tubo. Guarde el archivo a 4 ° C.
  11. Añadir 25 l de la solución de HRP de 10 mg / ml con 25 l de 10 mg / ml solución SA y se almacena a 4 ° C durante la noche. Esto hace que el SA para ser conjugado con la HRP a través de un enlace tioéter.
    1. Preparar una solución 1: 4 de trabajo con la solución durante la noche y en la tienda de 4 ° C nevera. Almacenar la solución restante a -20 ° C.
  12. Se preparan dos soluciones que consisten en BSA-biotina (o BSA) en PBS, mediante la adición de 10 l de acciones de BSA-biotina (o 10 l de BSA acciones) a 490 l de PBS.
  13. Añadir 100 l de la solución de la etapa 5.12 a cada pocillo de una placa de poliestireno de 96 pocillos.
  14. Incubar la placa a 37 ° C durante 1 h, envuelto en papel de aluminio.
  15. Lavar los pocillos de la placa con 0.05% de Tween 80.
    1. Añadir 200 l de 0,05% PBS-Tween 80 a los pocillos. Incubar durante 2 min a TA. Se decanta el líquido.
    2. <li> Repita el paso 5.15.1 tres veces.
  16. Añadir 200 l de la solución de caseína 0,5% a cada uno de los pocillos de la placa de 96 pocillos.
  17. Incubar la placa a 37 ° C durante 1 h.
  18. Repita el paso de 5,15 a lavar tres veces los pocillos.
  19. Se prepara una solución mediante la mezcla de 12 ml de solución de caseína 0,5% con 7,5 l de 0,05% de Tween 80.
  20. Diluir el Stock SA-HRP 1: 10000 utilizando la solución preparada en la etapa 5.19.
  21. Añadir 80 l de la solución preparada en la etapa 5.20 a cada pocillo de una placa de 96 pocillos.
  22. Añadir 20 l de la muestra de biotina preparada a cada pocillo de la placa de poliestireno. El sobrenadante preparado en 4.6 se puede utilizar como la muestra de biotina en este paso.
  23. Incubar la placa a 37 ° C durante 1 h. Este paso permite la unión competitiva entre la biotina libre e inmovilizar BSA-biotina para sitios de unión SA-HRP.
  24. Repita el paso de 5,15 a lavar tres veces los pocillos.
  25. Mezclar la solución de acetato de sodio 50 mM, solución de TMB 1%,y el 3% de solución de H 2 O 2 a un 1,000: 1 relación (20 ml de volumen total): 10.
  26. Añadir 200 l de la solución del paso de 5,25 a cada pocillo y deje reposar durante 15 minutos a temperatura ambiente, cubierto con papel de aluminio.
  27. Añadir 50 l de 2 MH 2 SO 4 a cada pocillo para detener la reacción. Medir la DO 450 utilizando un lector de placas.

6. Control Directo Esquema funcionalizado Preparación de la superficie

  1. Preparar las siguientes soluciones.
    1. Preparar 20 mg / mL LC-LC-biotina en DMSO.
    2. Preparar 10 mg / ml de HRP en PBS.
    3. Preparar 0,17 mg / ml en PBS SA.
    4. Preparar 0,5% de caseína en PBS.
    5. Preparar el 20% de Tween 80 acciones de agua DI.
    6. Preparar un 0,05% de Tween 80 (de 20% en acciones) en PBS.
    7. Preparar 50 mM de acetato de sodio en agua DI.
    8. Preparar 1% de TMB en DMSO.
    9. Preparar 3% de H 2 O 2 en agua DI.
    10. Preparar 2 MH 2 SO 4 DI.
  2. Añadir 7,5 l LC-LC-biotina a 72 l HRP e incubar a durante 1,5 horas a temperatura ambiente, envuelto en papel de aluminio para evitar la exposición a la luz. Este paso hace que la biotina en el conjugado a HRP a través de un enlace amida.
  3. Transferir la solución de la etapa 6.2 a un concentrador centrífugo dentro de un tubo de centrifugado
    1. Se centrifuga la solución a 10.000 xg hasta que el volumen alcanza 100 L o durante 12 min. Llenar el tubo de centrifugado de 500 l con PBS y repetir la centrifugación y la adición de PBS cuatro veces. Guarde el archivo a 4 ° C.
  4. Añadir los 100 l de la solución de SA 6.1.3 a cada pocillo en una placa de 96 pocillos de poliestireno.
  5. Incubar la placa a 37 ° C durante 1 h, envuelto en papel de aluminio.
  6. Lavar los pocillos de la placa con 0.05% de Tween 80.
    1. Añadir 200 l de 0,05% de Tween 80 a los pocillos. Incubar durante 2 min a TA. Se decanta el líquido.
    2. 6.6.1 Repetir tres veces.
  7. Añadir 200 l de la solución de caseína 0,5% a cada uno de los pocillos de la placa de 96 pocillos.
  8. Incubar la placa a 37 ° C durante 1 h.
  9. Repita los pasos 6,6 y tres veces para lavar los pozos.
  10. Diluir el stock 1 biotina-HRP: 10000 utilizando la solución preparada en la etapa 6.3.
  11. Añadir 80 l de la solución preparada en la etapa 6.10 a cada pocillo de una placa de 96 pocillos.
  12. Añadir 20 l de la muestra de biotina preparada a cada pocillo de la placa de poliestireno. El sobrenadante preparado en 4.6 se puede utilizar como la muestra de biotina en este paso.
  13. Incubar la placa a 37 ° C durante 1 h. Este paso permite la unión competitiva entre la biotina libre y biotina-HRP de sitios de unión inmovilizados SA.
  14. Repita el paso 6.6 para lavar los pocillos tres veces.
  15. Mezclar mM solución 50 acetato de sodio, solución de TMB 1% y 3% de H 2 O 2 solución en un 1000: relación de 1 (20 ml de volumen total): 10.
  16. Añadir 200 l de la solución del paso 6.15 a cada pocillo y se incuba durante 15 min a TA, cubierto con papel de aluminio.
  17. Añadir 50 l de solución de 2 MH 2 SO 4 a cada pocillo para detener la reacción. Medir la DO 450 utilizando un lector de placas.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Los resultados representativos se presentan en las cinco figuras adjuntas. En primer lugar, se presenta el proceso de clonación gráficamente (Figura 1) para que el lector pueda seguir visualmente los pasos críticos para la creación de la cepa de E. coli sintéticamente ingeniería. Con el fin de caracterizar la dinámica poblacional de las células, proporcionamos una curva de crecimiento (Figura 2) generado por la medición de la densidad óptica a 600 nm (OD 600) de la población. A continuación, se muestra cómo se verifica la red de regulación de genes, mediante el uso de mCherry como un proxy para bioB (Figura 3), lo que nos permite medir ópticamente la cantidad relativa de bioB que sería producida por la célula tras la inducción con IPTG. A continuación, se presentan los datos de respuesta para el control indirecto y superficies funcionalizadas de control directo. Estos gráficos de datos (Figura 4) se desarrollaron mediante el uso de soluciones de medición de librebiotina para caracterizar los perfiles de respuesta de las superficies funcionalizadas. Finalmente, se presentan los datos característicos que muestran cómo se inducen las células modificadas para producir biotina (Figura 5), modificando de este modo las superficies funcionalizadas.

Figura 1
Figura 1: Diseño y construcción de inducible, las células manipuladas. Los cebadores (A) fueron diseñados para aislar el gen bioB a partir del genoma de E. coli, que codifica una enzima crucial en la vía de síntesis de la biotina. (B) El P L, teto-1 y P -lacI trc-2 secuencias puede ser aislado de un plásmido que contiene un interruptor de palanca genética con correspondientes cebadores. (C) El gen bioB extraído y los dos fragmentos de el interruptor de palanca se pueden utilizar para crear el circuito de genes. La adición de IPTG a continuación, puede indUCE la expresión de bioB y la síntesis de este modo biotina cuando se añade DTB como sustrato para bioB. (D) El plásmido ensamblado se transformó en K-12 MG1655 de E. coli. Esto hizo que la presencia de IPTG para inducir la expresión de bioB y la síntesis de este modo la biotina por la línea celular sometida a ingeniería cuando DTB se proporcionó como sustrato. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Curvas de crecimiento para células modificadas. Los, células de tipo salvaje MG1655 inducibles por ingeniería se cultivaron y monitoreados en medio mínimo (es decir,-biotina libre M9 medios de comunicación), así como medios mínimos complementados con DTB (200 ng / ml) y / o IPTG (0,5 mM). Los gráficos muestran la lectura de DO 600, medida cada 5 millas n para 24 h. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Prueba de la red de genes de ingeniería. La proteína fluorescente mCherry se utilizó en lugar de la gen bioB para que pudiéramos ópticamente medir el perfil de inducción cuando se indujeron células modificadas con IPTG. Contrastamos las células inducidas con IPTG (diamantes rojos) con las células no inducidas con IPTG (diamantes azules). Estos resultados demuestran la eficacia de la red de genes inducible. Haga clic aquí para ver una versión más grande de esta figura.

/55300/55300fig4.jpg "/>
Figura 4: Verificación de la interfaz del material funcionalizado. Al exponer nuestra superficie funcionalizado para diferentes concentraciones de biotina, que son capaces de medir la respuesta óptica mediante la medición de OD 450 absorbancia. Estos resultados nos permiten generar una curva de calibración, que une la concentración de biotina a la intensidad óptica de la respuesta. A continuación, presentamos la biotina frente a curvas de señales ópticas, tanto para los esquemas de superficie indirecta (izquierda) y directo (derecha) funcionalizados. Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5: Diseñado células de control de interfaz de materiales. Mediante la utilización de secciones de protocolo 5 ó 6, que son capaces de utilizar los productos de inducido, c ingenieríaells para modificar químicamente la superficie funcionalizado. Podemos controlar estas respuestas ópticamente midiendo la DO 450. Además, utilizando la curva de calibración desarrollada en la figura 4, podemos relacionar la intensidad óptica de la respuesta a la biotina dentro de la concentración. Presentamos aquí las diferentes concentraciones de biotina, medida por la superficie de nuestro esquema funcionalizado control indirecto, para células de tipo salvaje (blanco), células no inducidas que contienen el plásmido pKE1-lac-bioB (naranja), y células inducidas que contienen el pKE1-lac-bioB plásmido (gris). Haga clic aquí para ver una versión más grande de esta figura.

Químico concentración final Cantidad
5x sales M9 1x 20 ml
1 M MgSO 4 2 mM 200 l
1 M CaCl 2 0.1 mM 10 l
20% de glucosa 0,40% 2 ml
casaminoácidos libre de biotina al 2% 0,02% 1 ml
Agua DI N / A 76,8 ml

Tabla 1: M9 Medios receta.

Nombre Secuencia Primer Uso
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT la extracción de casete lacI
1-r doCGACGTCTCACTGCCCGCTTTCCAGTC la extracción de casete lacI
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-2 de extracción
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-2 de extracción
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG extracción bioB
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC extracción bioB
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Además sintética RBS

Tabla 2: Lista de los cebadores.

Paso 1
Paso 2 Paso 3 Etapa 4 paso 5 paso 6 paso 7 paso 8 paso 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
doce y media doce y diez doce y media 01: 00 / kb doce y diez doce y media 01: 00 / kb 02:00
Repetir 12 veces Repetir 25 veces
-1 ° C / ciclo

Tabla 3: Programa de PCR.

Nombre Volumen
Cell lisado (plantilla) 10 l
Primer (cada uno) 0.625 l (cada uno)
tampón 5x Q5 5 l
polimerasa Q5 0,25 l
dNTP Mix 0,5 l
Agua DI 6,75 l

Tabla 4: Whole Cell reacción de PCR (25 l).

Nombre Volumen
10x tampón de reacción 5 l
enzima 1 1 l
enzima 2 1 l
El ADN molde 1 g
Agua DI 43 l - volumen de ADN

Tabla 5: Restricción Digestión enzimática La reacción (50 l).

Nombre Volumen
ADN 50 g vector + X g inserto
10x Ligase Buffer 1 l
T4 ligasa 1 l
Agua DI 8 l - volumen de ADN

Tabla 6: reacción de ligación (10 l).

Nombre Concentración notas
CaCl 2 100 mM
Carbeniccilin 50 mg / mL (1000x)
DTB 50 mg / ml
IPTG 0,5 M
CCPA 20 mg / mL 2 mg en 100uL DMSO
SPDP 20 mg / mL 2 mg en 100uL DMSO
LC-LC-biotina 20 mg / mL 2 mg en 100uL DMSO
HRP 10 mg / mL en PBS
SA (indirecto) 10 mg / mL en PBS
SA (directo) 0,17 g / ml en PBS
BSA 20 mg / mL en PBS
TDT 100 mM En Agua DI
EDTA 5 mM 18,6 mg en 10 ml de PBS
Caseína 0,50% en PBS
Tween 80 20% En Agua DI
Tween 80 en PBS 0,05%
Acetato de sodio 50 mM En Agua DI, 5.1 Ajuste de pH con HCl 3 M
TMB 1% en DMSO
H 2 O 2 3% En Agua DI
H 2 SO 4 2 M En Agua DI

Tabla 7: Lista de Soluciones de reactivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hemos presentado una nueva estrategia para interconectar células modificadas que viven con una superficie de material funcionalizado. Esto se logró mediante el desarrollo de una línea celular capaz de sintetizar niveles elevados de biotina cuando se induce con IPTG. Los niveles elevados de biotina pueden entonces ser utilizados para modificar la superficie funcionalizada. Los protocolos detallados de cómo la ingeniería de la línea de células de E. coli y cómo crear dos superficies funcionalizadas diferentes.

Los pasos críticos en este protocolo se producen a lo largo de la construcción de la línea celular sometida a ingeniería. Para evitar problemas de aguas abajo, que caracterizan a las cepas de células de ingeniería con las dos curvas de crecimiento (Figura 2) y la respuesta fluorescente (Figura 3) se anima. Si surgen cuestiones de procedimiento, otras estrategias de clonación molecular, como la extracción de PCR y el conjunto de Gibson 14, pueden ser sustituidos por pasos en su caso. Para optimizar el Yie biotinald de la línea celular diseñada, es crucial para asegurar que una cantidad suficiente de DTB se proporciona a las células. En nuestros estudios, se encontró que 200 ng / ml DTB provocó un incremento sustancial y estadísticamente significativo en la producción de biotina cuando las células fueron inducidas con IPTG. Además, la conjugación exitosa de BSA-biotina, SA-HRP, y biotina-HRP es crucial para la realización y el seguimiento de los esquemas de control indirecto y directo con eficacia. Tenga cuidado para evitar la exposición innecesaria a la luz y permitir que los conjugados de incubar durante la noche a 4 ° C para asegurar se forma un conjugado eficaz.

El protocolo ofrece ventajas sobre los métodos alternativos 15 debido a su capacidad para detectar pequeñas cantidades de biotina que son biológicamente relevantes (pg escala / ml) en comparación con los kits de detección de biotina disponibles en el mercado, tales como los basados en ácido 4 'hydroxyazobenzene-2-carboxílico las estrategias de unión competitiva. Aunque el uso de la estreptavidina-bioSistema de estaño es común en la biotecnología 16, 17, la capacidad de nuestro sistema para responder a las pequeñas cantidades de biotina nos permite enlazar directamente a nuestra línea de células de ingeniería genética con la superficie funcionalizada.

Una limitación potencial de nuestro protocolo es el rango dinámico resultante de la detección de biotina. En los esquemas de control indirectos y directos, que son capaces de detectar la biotina entre 10 -10 2 3 y 4 10 -10 6 pg / ml, respectivamente (Figura 4). Afortunadamente, la gama baja del esquema de control indirecta nos permite detectar fácilmente la producción de biotina a partir de células modificadas. Sin embargo, la banda estrecha de la gama dinámica control indirecto limita su capacidad de detectar cambios de gran tamaño (100 veces) en concentraciones de biotina. La alteración de la gama dinámica, tanto para los esquemas de control indirecto y directo requeriría ingeniería adicional. Sin embargo, si la detección de células producend biotina es un problema, la preparación de diluciones del sobrenadante de biotina en el paso 4.6 se debe permitir que el investigador para orientar el rango dinámico del sistema de control indirecto (Figura 5). Se encontró que una dilución 1: 5 del sobrenadante nos permitió dirigimos el rango dinámico del sistema de control indirecto con eficacia. Esta estrategia de dilución debería aliviar la necesidad de modificar el rango dinámico directamente.

El, sistema de pila de material de dos partes presentado aquí permite a las células diseñada para modificar la composición de una superficie funcionalizada. células vivas, dinámicas pueden interpretar su entorno químicos para producir una respuesta genética. Por Engineering esta respuesta genética para aumentar la producción de biotina, podemos dotar a las células de vida de ingeniería con la capacidad de controlar y manipular una superficie funcionalizada. Siguiendo los protocolos presentados, células diseñadas son capaces de actuar como sensores dinámicos, capaces de lectura, el procesamiento y el registro de las condiciones alrededor de THem a través de interfaces funcionalizados. Esta tecnología podría impactar campos que van desde la medicina molecular para la detección de analitos para la remediación ambiental.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores agradecen el apoyo de la adjudicación FA9550-13-1-0108 de la Fuerza Aérea Oficina de Investigación Científica de los EE.UU.. Los autores reconocen, además, el apoyo de la adjudicación N00014-15-1-2502 de la Oficina de Investigación Naval de los EE.UU., la financiación del Instituto de Tecnología crítico y Ciencias Aplicadas en el Instituto Politécnico de Virginia y la Universidad del Estado, y de la Fundación Nacional de Ciencia de Graduados de Investigación Programa de Becas, adjudicación número 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics