Usando biologia sintética para manipular células vivas que fazem interface com materiais programáveis

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este artigo apresenta uma série de protocolos para o desenvolvimento de células manipuladas e superfícies funcionalizadas que permitem sinteticamente engenharia E. coli para controlar e manipular superfícies de materiais programáveis.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nós desenvolvemos uma interface abiótico-bióticos que permite que as células manipuladas para controlar as propriedades do material de uma superfície funcionalizada. Este sistema é feito através da criação de dois módulos: um sinteticamente estirpe de células de E. coli e uma interface de material funcionalizado. Dentro deste artigo, detalhamos um protocolo para a engenharia genética de comportamentos selecionados dentro de uma estirpe de E. coli utilizando estratégias de clonagem molecular. Uma vez desenvolvidas, esta estirpe produz níveis elevados de biotina quando exposta a um indutor químico. Adicionalmente, protocolos para a criação de detalhe duas superfícies funcionalizadas diferentes, cada um dos quais é capaz de responder a biotina sintetizado por células. Tomados em conjunto, apresentamos uma metodologia para a criação de um sistema ligado, abiótico-biótico que permite que as células para controlar a composição do material e montagem em substratos inanimados engenharia.

Introduction

Aqui, relatamos os procedimentos para o desenvolvimento de um substrato programável capaz de responder a um sinal químico a partir de uma linha celular de engenharia. 1 Fazemos isso através da criação de uma interface de biotina-estreptavidina que responde a biotina produzida pelas células Escherichia coli sinteticamente engenharia (E. coli). Anteriormente, superfícies programáveis foram projetados para uma ampla gama de aplicações de detecção de toxina 2 e point-of-care diagnóstico 3 a defesa e segurança. 4 Enquanto superfícies programáveis podem ser úteis como sensores e atuadores, eles podem ser feitos "mais inteligentes", dotando-os com a capacidade de se adaptar a diferentes desafios ambientais. Em contraste, mesmo microorganismos simples, tais como E. coli, têm adaptabilidade inerente e são capazes de responder aos desafios com soluções sofisticadas e muitas vezes inesperados. Esta adaptação tem permitido E.populações coli, controladas por suas redes de genes complexos, de forma rentável para buscar recursos, 5 criar produtos de valor acrescentado, 6 e até robótica micro-escala de energia. 7, por acoplamento das vantagens adaptativas de células vivas com o uso de superfícies programáveis, podemos criar um substrato inteligente capaz de responder às diferentes condições ambientais.

A biologia sintética tem dado aos pesquisadores novas habilidades para programar o comportamento de organismos vivos. Pela engenharia células para conter redes reguladoras novo gene, os pesquisadores podem criar células que exibem uma gama de comportamentos programados. 8, 9 Além pesquisa básica, esses comportamentos podem ser usados para aplicações como controle de montagem de material e biologicamente a produção de produtos de valor agregado. 10 Nisto, nós detalhe como usamos as ferramentas da biologia sintética para engenheiro uma estirpe de E. coli que sintetiza biotina após indução. Esta estirpe foi desenvolvida utilizando métodos de clonagem da enzima de restrição para montar um plasmídeo, pKE1-LACI-BIOB. Este plasmídeo, quando usado para transformar a estirpe de E. coli K-12 MG1655, dota células com a capacidade para expressar níveis elevados de BIOB, uma enzima essencial para a síntese de biotina. Quando as células transformadas foram induzidas com isopropil β-D-1-tiogalactopiranósido (IPTG) e fornecido com um precursor de biotina, destiobiotina (DTB), níveis elevados de biotina foram produzidos.

interacção de ligação da biotina com estreptavidina é um dos mais fortes ligações não covalentes encontrados na natureza. Como tal, a interacção biotina-estreptavidina é tanto bem caracterizados e altamente utilizado em biotecnologia. 11 Dentro deste manuscrito, apresentamos duas estratégias que empregam a interacção biotina-estreptavidina para detectar e detectar a biotina produzidos em células com uma superfície funcionalizada. Nósreferem-se a estas superfícies contrastantes como esquemas de controle "diretos" "indiretas" e. No esquema de controlo indirecto, biotina produzidos em células compete com biotina que foi conjugado e imobilizados numa superfície de poliestireno para locais de ligação a estreptavidina. Além disso, a estreptavidina é conjugado com peroxidase de rábano (HRP). HRP modifica 3, 3 ', 5, 5'-tetrametilbenzidina (TMB), para produzir um sinal óptico, 12, a qual pode ser monitorizada por quantificação da absorvância espectral (ou seja, a densidade óptica) a 450 nm (OD 450). Assim, o esquema de controle indireto permite aos pesquisadores para medir biotina produzida por células monitorando a attentuation do sinal de OD 450.

O esquema de controlo directo explora o evento estreptavidina-biotina estreptavidina imobilizando directamente para uma superfície do material e permitindo biotina produzidos por células e de HRP biotinilada para competir por sítios de ligação a estreptavidina. Mais uma vez, oníveis relativos de biotina produzidos de células são monitorizados pela medição de uma sinal de OD 450.

Tomadas em conjunto, as células manipuladas e superfícies funcionalizadas permitem controlar as propriedades de uma superfície programável através da indução de redes em células vivas. Em outras palavras, nós criamos um sistema que aproveita a capacidade de adaptação dos organismos vivos e a confiabilidade ea especificação de uma interface de material de engenharia, ligando estes sistemas juntos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Mídia e Preparação Cultura

  1. Prepare meios caldo lisogenia (LB) por mistura de 25 g de pó de estoque LB com 1 L de água desionizada (Dl) e autoclavagem da solução a 121 ° C durante 20 minutos para esterilizar.
    1. Para preparar placas de LB, adicione 15 g de ágar (1,5%) para a mídia LB antes da esterilização
    2. Preparar soluções stock de carbenicilina 1.000x (Cb) em água Dl (50 mg / mL).
    3. Se preparando meios LB, que inclui um antibiótico para selecção de transformantes resistentes, espere até que a temperatura do meio LB esterilizado é inferior a 60 ° C e, em seguida, adicione 1 mL de estoque antibiótico para todos os meios de 1 mL de LB.
  2. Para M9 meio mínimo (Tabela 1), preparar soluções de reserva separadas dos seguintes: sais de 5X M9 (56,4 g / L), M MgSO4, 1 M de CaCl2, 20% de glicose e ácidos de casamino 1 2% isentas de biotina.
    1. Em uma garrafa segura autoclave, misture 20 mL de 5x M9 sais, 200 &# 181; L de MgSO4 1M, 10 ul de 1 M de CaCl2, 2 ml de glicose a 20%, 1 mL de casaminoácidos isentos de biotina 2%, e 76,8 mL de água DI.
    2. Autoclavar a soluo preparada no passo 1.2.1 se a 121 ° C durante 20 min.
  3. Incubar todas as culturas a 37 ° C com agitação a 400 rpm. Os tempos de incubação variam dependendo da experiência e estirpe, mas duram tipicamente de 8 a 12 h.

2. Geração de Biotina Producing E. coli (plasmídeo pKE1-LACI-BIOB)

NOTA: O circuito genética contém duas partes: um repressor lacl, impulsionadas por um P L, tetO-1 promotor resultando na expressão constitutiva, devido à ausência de uma proteína do repressor tet, bem como um sistema de expressão de biotina contendo o P trc-2 promotor seguido por um local de ligação ao ribossoma forte (RBS) expressão de BIOB condução. Todos clonagem foi executado em divisão rápida stra coli comercial, E.no. A construção final foi transformado em E. coli MG1655WT para teste. Os iniciadores (Tabela 2) foram adquiridos comercialmente.

  1. Isolar gene BIOB do genoma de E. coli através da realização de célula inteira de reacção em cadeia da polimerase (PCR):
    1. Crescer as células de E. coli MG 1655WT durante a noite a 37 ° C.
    2. Em um tubo de PCR de 0,2 ml, combinar um mL da cultura durante a noite, preparado no passo 2.1.1 com 9 ul de água desionizada estéril.
    3. Incubar o tubo a 95 ° C durante 5 min num termociclador e transfere imediatamente o tubo até -80 ° C congelador durante 10 min para lisar as células. Isso permite que o ADN genómico para servir como um molde de PCR.
    4. Descongelar a solução e adicionar (i) 2,5 mL de cada um dos iniciadores nBioB2-f1 e nBioB2-R, (ii) 5 ul de tampão de polimerase de ADN de 5x, (iii) 0,25 mL de polimerase de ADN, (iv) 0,5 mL de mistura de dNTP e (v) a 6,75 mL de água desionizada para um volume total de reacção de 25 uL(Tabela 4).
    5. Golpear o lado (ou seja, súbito) do tubo para misturar o conteúdo. Em seguida, imediatamente girar para baixo o tubo rapidamente (~ 2 s) para assegurar que a amostra está na parte inferior do tubo.
    6. Colocar o tubo em um termociclador de PCR e utiliza o programa descrito na Tabela 3, com um passo adicional de 3 min a 95 ° C no início do protocolo.
    7. Confirmar utilizando electroforese em gel de PCR bem sucedida (1,0-1,2% de agarose em água Dl + brometo de etídio) em Tris base, ácido acético, e tampão de EDTA (TAE). O produto da PCR deve ser 1.070 pares de bases (pb) de comprimento.
    8. Utilizar-se kits comerciais, de acordo com as instruções do fabricante para extrair fragmentos de ADN a partir do gel a partir do passo 2.1.7.
  2. Isolar o TRC-2 promotor P eo operon lacI do plasmídeo pKDL071 13 (cortesia do laboratório de James Collins no MIT):
    1. Crescer as células de E. coli que contêmo plasmídeo pKDL071 dia para o outro em LB + Cb a 37 ° C.
    2. Extrai-se a ADN de plasmídeo a partir das células utilizando um kit de miniprep comercial de acordo com as instruções do fabricante. O plasmídeo vai servir como um molde de PCR.
    3. Siga o protocolo de PCR a partir das etapas 2.1.4. a 2.1.8. com as seguintes modificações:
    4. Substituir as células lisadas com o extracto de plasmídeo no passo 2.2.2.
    5. Use 2,5 mL de cada um dos iniciadores 1-F e 1-r para extração cassete lacl. Como alternativa, use 2,5 mL de cada um dos iniciadores nBioB1-F e nBioB1-R para P extração TRC-2.
    6. Execute eletroforese em gel (passo 2.1.7) para confirmar os produtos de PCR são a cassete de lacl e TRC-2 sites promotor P. Eles devem ser 1.213 pb e 109 pb de comprimento, respectivamente.
  3. Use de splicing por extensão de sobreposição (SOE) PCR para construir a cassete de BIOB contendo P trc-2, um local de ligação de ribossoma sintético (RBS) no iniciador nBioB2-F2, e o BIOB Tabela 3.
  4. Construções de inserção (P L, tetO-1 + lacl e P TRC-2 + BIOB) no pKE1-MCS plasmídeo vector 13 backbone (cortesia do laboratório de James Collins no MIT) por digestão do vector e inserir com enzimas de restrição:
    1. Extrair genes utilizando enzimas de restrição e electroforese em gel. Cada reacção contém (i) 5 ul de 10 x tampão de reacção, (ii) 1 ul de enzima de restrição 1, (iii) 1 ul de enzima de restrição 2, (iv) pelo menos 1 ug de ADN, e (v) de água desionizada para levar o volume final para 50 uL (Tabela 5). Digerir com enzimas Aatll e EcoRI para a cassete de lacl e com as enzimas HindIII e SacII para a cassete BIOB.
    2. Após as reacções são montados, de forma rápida e vortex los Centrifugar brevemente (~ 2 s) antes da incubação durante 1 h a 37 ° C.
    3. Durantedigestão, preparar geles de electroforese de acordo com protocolos padrão.
    4. Combinar ADN digerido com electroforese em gel tampão de carga 6x.
    5. Usar uma escada 2-log para verificar a localização de construção desejada, cortar fragmento de ADN a partir do gel, e utilizar kits comerciais de extracção de gel de acordo com as instruções do fabricante para extrair fragmentos de ADN a partir do gel.
  5. Quantificar DNA usando espectroscopia e calcular volumes para o 0: 1, 1: 1 e 3: 1 proporções molares de inserção para vector usando a equação 1:
    equação 1 equação 1
    Na equação 1, F é a relação de inserção de vector (0, 1, ou 3), X i é a quantidade de ADN de inserção, BP i é o comprimento do inserto em pares de bases, pb v é o comprimento do vector em pares de bases, e X v é a quantidade de vector (50 ng).
  6. Mistura de reacção de ligação por combinação de (i) 1 uL ligase 10X Tampão, (ii)1 uL de ligase de T4, (iii) ADN de vector 50 ng, (iv) uma massa de inserção de ADN específico para cada reacção, e (v) de água desionizada a 10 mL de volume total de reacção (Tabela 6).
  7. Incubar à temperatura ambiente (TA) durante 1 h.
  8. Durante a incubação na etapa de ligação 2.7, preparar células quimicamente competentes.
    1. Aliquota de 1 ml de culturas durante a noite em 1,5 mL tubos de centrífuga.
    2. Centrifugar a 16.200 xg por 1 min.
    3. Decantar o sobrenadante e ressuspender o sedimento em 200 ul de solução arrefecida (em gelo) 100 mM de CaCl2. Ressuspender o sedimento com cuidado pipetando. Não vortex.
    4. Colocar o tubo de microcentrifugadora em gelo durante 10 min.
    5. Centrífuga, remover o sobrenadante, ressuspender o sedimento em 100 ul de 100 mM CaCl refrigerado 2, e colocar o tubo em gelo novamente.
    6. Centrifuga-se o tubo de uma última vez e ressuspender o sedimento em 50 mL de refrigerados 100 mM de CaCl2.
    7. Lugar, colocaro tubo em gelo e usar as células quimicamente competentes imediatamente.
  9. Adicionam-se 5 ul de DNA ligado, preparados nos passos 2.6 e 2.7, a cada tubo de células competentes, preparado no passo 2.8.
  10. Agitar o tubo brevemente, batendo o lado (isto é, passar rapidamente) os tubos e, em seguida, colocar os tubos em gelo durante 30 min.
  11. Choque térmico dos tubos durante 45 s a 42 ° C e devolver os tubos em gelo durante 2 min.
  12. células de pipeta em agar LB seletivo + placas com antibiótico e espalhar as células usando pérolas de revestimento de vidro.
  13. Incubar as placas durante a noite a 37 ° C.
  14. Na manhã seguinte, pegar colónias de placas de inserção positiva (ou seja, 1: 1 e 3: 1 placas). Escolha 3 colónias se a 0: Placa de controle negativo 1 mostra nenhum crescimento, ou pegar 5-8 colônias se o 0: placa 1 tem algum crescimento. Use as colónias escolhidas para inocular 5 ml de LB + antibiótico e crescer durante 8 h a 37 ° C com agitação.
  15. Extrai-se a ADN de plasmídeo a partir das células utilizando uma miniprEP kit, seguindo as instruções do fabricante. Realizar um teste de corte usando enzimas de restrição (seguindo o mesmo procedimento descrito no passo 2.4.1.).
  16. Identificar células com construções com sucesso, comparando o comprimento dos fragmentos de ADN digeridos com os resultados esperados a partir de uma construção correcta. As culturas que transportam as construções de plasmídeos bem sucedidos podem ser conservadas através da mistura de cultura partes iguais com uma solução de estéril-filtrada, glicerol a 40% (em água desionizada) e congelação da mistura a -80 ° C.
    NOTA: As transformações de plasmídeos em outras estirpes de E. coli (isto é, MG1655WT) pode ser realizada seguindo o processo acima para tornar as células quimicamente competentes.

3. celular Caracterização: curva de crescimento e Resposta a Dose

  1. Crescer as estirpes modificadas durante a noite em meio LB com um antibiótico apropriado.
  2. Para curvas de crescimento, preparar 50 mL de minimal media M9 com e sem IPTG (a partir de um 0,5 M stac) e / ou DTB (a partir de um estoque de 500 ug / mL) como se segue:
    1. Prepare 0 ng / mL DTB (0 ul de estoque) / 0 IPTG mM (0 ul de estoque).
    2. Prepare 200 ng / mL DTB (200 mL de estoque) / 0 IPTG mM (0 ul de estoque).
    3. Prepare 0 ng / mL DTB (0 ul de estoque) / IPTG 0,5 mM (50 ul de estoque).
    4. Prepare 200 ng / mL DTB (200 mL de estoque) / IPTG 0,5 mM (50 ul de estoque).
    5. Inocular com a cultura durante a noite a 1: 100 na mídia especificada acima.
    6. Numa placa de 96 poços, alíquota de 200 ul de cultura, em triplicado, para cada poço.
    7. Medida OD600 a cada 5 minutos ao longo de 24 h, com agitação contínua e incubação a 37 ° C no leitor de placas.
  3. Para os estudos de resposta à dose, substituir o gene BIOB em pKE1-LACI-BIOB com mCherry (uma proteína fluorescente vermelho) para a quantificação óptico em tempo real.
  4. Adicionar diferentes quantidades de IPTG variando desde 0,1 mM até 5 mM para induzir a expressãoem meio LB.
  5. Inocular com a cultura durante a noite a uma diluição de 1: 100.
  6. Medir a fluorescência a cada 30 min durante 15 h.

4. Induzir Biotina Produção de células manipuladas e sobrenadante Preparação

  1. Cresça pKE1-LACI-BIOB na estirpe de E. coli MG1655 durante a noite em meio LB.
  2. Suplementar meios M9 com DTB variando de 30 a 200 ng / mL.
  3. Adicionar IPTG 0,5 mM para induzir a síntese de biotina.
  4. Inocular suplementadas, mínimo media M9 livre de biotina com a cultura durante a noite a diluição 1: 100.
  5. Após 24 h de crescimento, as células de centrífuga e recolher o sobrenadante enriquecido em biotina.
  6. Meça sobrenadante enriquecido com biotina com o controle indireto e do controle direto superfícies funcionalizadas. Utilizar o sobrenadante em lugar da amostra de biotina nos passos 5.23 e 6.12, respectivamente.

5. indireta Preparação de Superfície Esquema de Controle funcionalizados

  1. Prepare the seguintes soluções.
    1. Prepara-se uma solução de SMCC que consiste em 20 mg / ml de succinato de ácido trans-4- (maleimidylmethyl) ciclo-hexano-1-carboxilato (SMCC) em sulfóxido de dimetilo (DMSO).
    2. Prepara-se uma solução de SPDP que consiste em 20 mg / mL de succinimidil-3- (2-piridiltio) propionato (SPDP) em DMSO.
    3. Prepare a 20 mg / mL LC-LC-biotina em DMSO.
    4. Prepare a 10 mg / ml de peroxidase de rábano (HRP) em solução salina tamponada com fosfato (PBS).
    5. Prepare a 10 mg / mL de estreptavidina (SA) em PBS.
    6. Prepare a 10 mg / mL de albumina de soro bovino (BSA) em PBS.
    7. Prepare ditiotreitol 100 mM (DTT) em água DI.
    8. Prepare ácido 5 mM ethylenediaminetetaacetic (EDTA) em PBS.
    9. Prepare a 0,5% de caseína em PBS.
    10. Prepare 20% estoque Tween 80 em água DI.
    11. Prepare 0,05% de Tween 80 (20% a partir de estoque) em PBS.
    12. Preparar 50 mM de acetato de sódio em água desionizada.
    13. Prepare 1% de TMB em DMSO.
    14. Prepare a 3% de H 2 O 2 in DI água.
    15. Prepare 2 MH 2 SO 4 em água DI.
  2. Adicionar 1,4 mL da solução de SPDP a 20 uL solução SA.
  3. Incubar a solução a partir de 5,2 para 1,5 h à TA, envolvido em folha de alumínio para evitar a exposição à luz. Este passo permite que o agente de reticulação para ligar SPDP ao SA através de um grupo amino formando um SA-piridilditio activado.
  4. Adicionar 2,4 mL da solução de DDT para a solução do passo 5.3 e incubar durante 1 h à TA. Isto permite uma clivagem piridina tiona-2, resultando em um SA activado por sulfidrilo.
  5. Adicionar 7,5 mL solução SMCC a 72 solução ul HRP e incubar durante 1,5 horas em temperatura ambiente, embrulhados em papel de alumínio para evitar a exposição à luz. Isto resulta numa HRP activada por maleimida ligado por um grupo amino.
  6. Misturar a solução de 17 mL LC-LC-biotina com 200 uL de BSA solução e incubar durante 1,5 h à TA, envolvido em folha de alumínio para evitar a exposição à luz. Este passo permite que a biotina conjugado tO BSA através de uma ligação amida.
  7. Transferir as soluções dos passos 5.4, 5.5 e 5.6 para separar concentradores centrífugos dentro de tubos de centrifugação.
  8. Para tubos contendo SA-SPDP, a partir do passo 5.4, de centrifugação a 10.000 xg até que o volume do tubo atinge 100 uL ou durante 16 min. Encha o tubo de centrifugação para 500 mL com PBS-EDTA.
    1. Repita o passo 5.8 de cinco vezes. Armazenar o estoque a 4 ° C.
  9. Para tubos contendo HRP-SMCC, a partir do passo 5.5, de centrifugação a 10.000 xg até que o volume atinge 25 uL ou durante 16 min. Encha o tubo de centrifugação para 500 mL com PBS.
    1. Repita o passo 5.9 de cinco vezes. Armazenar o estoque a 4 ° C.
  10. Para tubos contendo BSA-biotina, a partir do passo 5.6, de centrifugação a 10.000 xg até que o volume atinge 100 uL ou durante 12 min. Encha o tubo de centrifugação para 500 mL com PBS.
    1. Repita o passo 5.10 quatro vezes.
    2. Centrifugar a 10.000 xg até que o volume atinge 100 uLou durante 12 min. Adicionar 100 uL de PBS ao tubo. Armazenar o estoque a 4 ° C.
  11. Adicionar 25 ul da solução de HRP a 10 mg / mL com 25 uL de 10 mg / ml solução SA e armazenar a 4 ° C durante a noite. Isto faz com que a SA para tornar conjugado com HRP por meio de uma ligação tioéter.
    1. Prepare uma solução 1: trabalho 4 com a solução durante a noite e armazenar em 4 ° C frigorífico. restante solução Armazenar a -20 ° C.
  12. Preparar duas soluções que consistem em BSA-biotina (ou BSA) em PBS, por adição de 10 ul de estoque de BSA-biotina (ou 10 uL da BSA) a 490 uL de PBS.
  13. Adicionar 100 ul da solução a partir do passo 5.12 a cada poço de uma placa de poliestireno de 96 poços.
  14. Incubar a placa a 37 ° C durante 1 h, envolvido em folha.
  15. Lavam-se as cavidades da placa com 0,05% de Tween 80.
    1. Adicionar 200 mL de 0,05% de PBS-Tween 80 para os poços. Incubar durante 2 min à temperatura ambiente. Decanta-se o líquido.
    2. <li> Repita o passo 5.15.1 três vezes.
  16. Adicionar 200 ul da solução de caseína a 0,5% a cada um dos poços da placa de 96 poços.
  17. Incubar a placa a 37 ° C durante 1 h.
  18. Repetir o passo de 5,15 a lavar os poços três vezes.
  19. Prepara-se uma solução por mistura de 12 mL de uma solução de caseína a 0,5% com 7,5 mL de 0,05% de Tween 80.
  20. Dilui-se o estoque SA-HRP 1: 10.000, utilizando a solução preparada no passo 5.19.
  21. Adicionar 80 ul da solução preparada no passo 5.20 a cada poço de uma placa de 96 poços.
  22. Adicionar 20 ul da amostra a biotina preparado a cada poço da placa de poliestireno. O sobrenadante preparado em 4,6 pode ser utilizado como a amostra biotina neste passo.
  23. Incubar a placa a 37 ° C durante 1 h. Esta etapa permite a ligação competitiva entre a biotina livre e imobilizar BSA-biotina para sítios de ligação SA-HRP.
  24. Repetir o passo de 5,15 a lavar os poços três vezes.
  25. Misturar a solução de acetato de sódio 50 mM, solução de TMB 1%,e 3% de solução de H 2 O 2 a uma 1000: razão 1 (20 mL de volume total): 10.
  26. Adicionar 200 ul da solução a partir do passo de 5,25 a cada cavidade e deixa-se repousar por 15 min à temperatura ambiente, coberto com a folha.
  27. Adicionar 50 ul de 2 H 2 SO 4 a cada poço para parar a reacção. Medir DO450 utilizando um leitor de placas.

Preparação de Superfície 6. Directa Controlo Esquema funcionalizados

  1. Prepare as seguintes soluções.
    1. Prepare a 20 mg / mL LC-LC-biotina em DMSO.
    2. Prepare a 10 mg / ml em PBS com HRP.
    3. Prepare a 0,17 ug / ml em PBS SA.
    4. Prepare a 0,5% de caseína em PBS.
    5. Prepare 20% estoque Tween 80 em água DI.
    6. Prepare 0,05% de Tween 80 (20% a partir de estoque) em PBS.
    7. Preparar 50 mM de acetato de sódio em água desionizada.
    8. Prepare 1% de TMB em DMSO.
    9. Prepare a 3% de H 2 O 2 em água Dl.
    10. Prepare 2 MH 2 SO 4 DI.
  2. Adicionar 7,5 uL LC-LC-biotina a 72 ul de HRP e incuba-se a, durante 1,5 h à TA, envolvido em folha de alumínio para evitar a exposição à luz. Este passo provoca a biotina conjugado com HRP por meio de uma ligação amida.
  3. Transferir a solução a partir do passo 6.2 para um concentrador centrífugo dentro de um tubo de centrifugação
    1. Centrifugar a solução a 10.000 xg até que o volume atinge 100 uL ou durante 12 min. Encha o tubo de centrifugação para 500 mL com PBS e repetir a centrifugação e além PBS quatro vezes. Armazenar o estoque a 4 ° C.
  4. Adicionar 100 ul da solução de 6.1.3 SA a cada cavidade dentro de uma placa de 96 poços de poliestireno.
  5. Incubar a placa a 37 ° C durante 1 h, envolvido em folha.
  6. Lavam-se as cavidades da placa com 0,05% de Tween 80.
    1. Adicionar 200 mL de 0,05% de Tween 80 aos poços. Incubar durante 2 min à temperatura ambiente. Decanta-se o líquido.
    2. Repita 6.6.1 três vezes.
  7. Adicionar 200 ul da solução de caseína a 0,5% a cada um dos poços da placa de 96 poços.
  8. Incubar a placa a 37 ° C durante 1 h.
  9. Repetir passo 6.6 três vezes para lavar os poços.
  10. Dilui-se o estoque biotina-HRP 1: 10.000, utilizando a solução preparada no passo 6.3.
  11. Adicionar 80 ul da solução preparada no passo 6.10 a cada poço de uma placa de 96 poços.
  12. Adicionar 20 ul da amostra a biotina preparado a cada poço da placa de poliestireno. O sobrenadante preparado em 4,6 pode ser utilizado como a amostra biotina neste passo.
  13. Incubar a placa a 37 ° C durante 1 h. Esta etapa permite a ligação competitiva entre a biotina livre e biotina-HRP para sítios de ligação SA imobilizadas.
  14. Repetir o passo 6.6 para lavar os poços três vezes.
  15. Misturar a solução 50 mM de acetato de sódio, solução de TMB 1%, 3% e solução H 2 O 2 a uma 1000: razão 1 (20 mL de volume total): 10.
  16. Adicionar 200 ul da solução a partir do passo 6.15 a cada poço e incubar durante 15 min à temperatura ambiente, coberto com a folha.
  17. Adicionar 50 ul de 2 H 2 SO 4 solução a cada poço para parar a reacção. Medir DO450 utilizando um leitor de placas.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Os resultados representativos são apresentados nas figuras em anexo cinco. Em primeiro lugar, é apresentado o processo de clonagem graficamente (Figura 1), de modo que o leitor pode acompanhar visualmente os passos críticos para criar a estirpe de E. coli sinteticamente. A fim de caracterizar a dinâmica das populações de células, que proporcionam uma curva de crescimento (Figura 2) gerado pela medição da densidade óptica a 600 nm (DO600) da população. Em seguida, mostra-se como a rede de genes reguladores é verificado, usando mCherry como um proxy para BIOB (Figura 3), o que nos permite medir opticamente a quantidade relativa de BIOB que seria produzido pela célula após indução com IPTG. A seguir, apresentamos os dados de resposta para a indireta de controle e superfícies funcionalizadas de controle direto. Estes gráficos de dados (Figura 4) foram desenvolvidos usando soluções de medição de livrebiotina para caracterizar perfis de resposta das superfícies funcionalizadas. Por último, apresenta-se os dados característicos que mostram como as células manipuladas são induzidas a produzir a biotina (Figura 5), modificando deste modo as superfícies funcionalizadas.

figura 1
Figura 1: Projeto e Construção de induzíveis, células manipuladas. Os iniciadores (A) foram concebidos para isolar o gene BIOB a partir do genoma de E. coli, que codifica uma enzima crucial na via de síntese de biotina. (B) A P G, sequências tetO trc-2-1 -lacI e P pode ser isolado a partir de um plasmídeo contendo um interruptor genético com iniciadores correspondentes. (C) O gene BIOB extraído e os dois fragmentos a partir do interruptor de alavanca pode então ser utilizado para criar o circuito de gene. A adição de IPTG pode então indUCE a expressão de BIOB síntese e, assim, quando a biotina DTB é adicionado como um substrato para BIOB. (D) O plasmídeo foi transformado em montado K-12 de E. coli MG1655. Isto causou a presença de IPTG para induzir a expressão de BIOB e, assim, a síntese da biotina pela linha celular de engenharia quando DTB foi fornecida como um substrato. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: curvas de crescimento para as células manipuladas. As células, do tipo selvagem MG1655 indutíveis modificadas foram cultivadas e monitorizados em meio mínimo (isto é, livre de biotina meios M9), bem como meio mínimo suplementado com DTB (200 ng / mL) e / ou de IPTG (0,5 mM). Os gráficos mostram a leitura de DO a 600, medido a cada 5 mi N, durante 24 h. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Testando o Gene Rede Engineered. A proteína fluorescente mCherry foi usado em lugar do gene BIOB para que pudéssemos opticamente medir o perfil de indução quando as células modificadas foram induzidos com IPTG. Nós contrastar as células induzidas com IPTG (diamantes vermelhos) com as células não induzidas com IPTG (diamantes azuis). Estes resultados demonstram a eficácia da rede de gene indutível. Por favor clique aqui para ver uma versão maior desta figura.

/55300/55300fig4.jpg "/>
Figura 4: Verificação da funcionalizados material de interface. Ao expor a superfície funcionalizada em diferentes concentrações de biotina, que são capazes de medir a resposta óptica medindo a OD 450 absorvância. Estes resultados permitem gerar uma curva de calibração, que liga a concentração de biotina com a intensidade óptica da resposta. Aqui, apresentamos a biotina vs. curvas de sinais ópticos para ambos os esquemas de superfície indireta (à esquerda) e direto (direita) funcionalizados. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5: Projetado células controle material de interface. Ao utilizar seções de protocolo 5 ou 6, somos capazes de usar os produtos de induzido, c engenhariaells para modificar quimicamente a superfície funcionalizada. Podemos monitorar essas respostas opticamente medindo OD 450. Além disso, usando a curva de calibração desenvolvido na Figura 4, pode-se ligar a intensidade óptica da resposta à biotina na concentração. Apresentamos aqui as diferentes concentrações de biotina, medida pelo nosso esquema funcionalizado superfície de controle indireto, por células do tipo selvagem (branco), células não induzidas contendo o plasmídeo pKE1-LACI-BIOB (laranja), e células induzidas contendo o pKE1-LACI-BIOB plasmídeo (cinza). Por favor clique aqui para ver uma versão maior desta figura.

Químico concentração final Montante
sais de 5x M9 1x 20 ml
1 H MgSO4 2 mM 200 uL
1 M de CaCl2 0,1 mM 10 ul
20% de glucose 0,40% 2 ml
casaminoácido livre de biotina a 2% 0,02% 1 mL
DI água N / D 76,8 mL

Tabela 1: M9 mídia Receita.

Nome sequência iniciadora Uso
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT extração cassete lacl
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC extração cassete lacl
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-extracção 2
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-extracção 2
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG extração BIOB
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC extração BIOB
nBioB2-F2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Além RBS sintético

Tabela 2: Lista de iniciadores.

Passo 1
Passo 2 etapa 3 passo 4 passo 5 passo 6 etapa 7 passo 8 passo 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
Repetir 12 vezes Repetir 25 vezes
-1 ° C / ciclo

Tabela 3: Programa PCR.

Nome Volume
Lisado celular (modelo) 10 ul
Primer (cada) 0,625 mL (cada)
tampão Q5 5x 5 uL
Polymerase Q5 0,25 mL
dNTP Mix 0,5 ul
DI água 6,75 mL

Tabela 4: células inteiras reacção de PCR (25 uL).

Nome Volume
10x tampão de reacção 5 uL
enzima 1 1 uL
enzima 2 1 uL
ADN molde 1 ug
DI água 43 ul - volume de DNA

Tabela 5: Enzima de Restrição A digestão de reacção (50 ul).

Nome Volume
DNA 50 ug do vetor + X inserção ug
De tampão ligase 10x 1 uL
ligase de T4 1 uL
DI água 8 mL - volume de DNA

Tabela 6: reacção de ligação (10 mL).

Nome Concentração Notas
CaCl2 100 mM
Carbeniccilin 50 mg / mL (1000x)
DTB 50 ug / mL
IPTG 0,5 M
SMCC 20 mg / mL 2 mg em 100 ul DMSO
SPDP 20 mg / mL 2 mg em 100 ul DMSO
LC-LC-biotina 20 mg / mL 2 mg em 100 ul DMSO
HRP 10 mg / mL em PBS
SA (indireta) 10 mg / mL em PBS
SA (directa) 0,17 ug / ml em PBS
BSA 20 mg / mL em PBS
DTT 100 mM Em água Dl
EDTA 5 mM 18.6 mg em 10 ml de PBS
Caseína 0,50% em PBS
Tween 80 20% Em água Dl
Tween 80 em PBS 0,05%
Acetato de sódio 50 mM Em água DI, Ajuste para 5,1 pH usando HCl 3 M
TMB 1% em DMSO
H 2 O 2 3% Em água Dl
H 2 SO 4 2 M Em água Dl

Tabela 7: Lista de reagente Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nós apresentamos uma nova estratégia para a interface células manipuladas viver com uma superfície do material funcionalizado. Isto foi conseguido através do desenvolvimento de uma linha de células capazes de sintetizar níveis elevados de biotina quando induzido com IPTG. Os níveis elevados de biotina pode então ser utilizado para modificar a superfície funcionalizada. Os protocolos detalhados como engenheiro da linha de células E. coli e como criar duas superfícies funcionalizadas diferentes.

passos críticos neste protocolo ocorrer durante toda a construção da linha de células de engenharia. Para evitar problemas de jusante, que caracterizam as estirpes celulares manipuladas com ambas as curvas de crescimento (Figura 2) e de resposta fluorescente (Figura 3) é encorajada. Caso surjam questões processuais, outras estratégias de clonagem molecular, tais como extração de PCR e montagem Gibson 14, pode ser substituída por medidas, quando apropriado. Para otimizar o Yie biotinaLD da linha de células de engenharia, é crucial para assegurar que uma quantidade suficiente de DTB é fornecida às células. Nos nossos estudos, encontramos que 200 ng / mL DTB causou um aumento substancial e estatisticamente significativo na produção de biotina quando as células foram induzidas com IPTG. Além disso, a conjugação bem sucedida da BSA-biotina, SA-HRP, e biotina-HRP é crucial para a realização e acompanhamento dos regimes de controlo directo e indirecto de forma eficaz. Tomar cuidado para evitar a exposição desnecessária a luz e permitem que os conjugados a incubar durante a noite a 4 ° C para assegurar uma eficaz conjugado é formado.

Nosso protocolo oferece vantagens sobre os métodos alternativos 15, devido à sua capacidade para detectar pequenas quantidades de biotina que são biologicamente relevante (escala pg / ml) em comparação com kits de detecção de biotina comercialmente disponíveis, tais como aqueles baseados em ácido 4'-hydroxyazobenzene-2-carboxílico estratégias de ligação competitiva. Embora a utilização do estreptavidina-biosistema de estanho é comum em biotecnologia 16, 17, a capacidade do nosso sistema para responder a pequenas quantidades de biotina nos permite ligar diretamente a nossa linha de células geneticamente modificadas com a superfície funcionalizada.

Uma limitação potencial do nosso protocolo é a faixa dinâmica resultante da detecção de biotina. Nos esquemas de controle diretos e indiretos, que são capazes de detectar a biotina entre 10 2 -10 3 e 10 4 -10 6 pg / mL, respectivamente (Figura 4). Felizmente, a gama baixa do esquema de controle indireto nos permite detectar prontamente a produção de biotina a partir de células modificadas. No entanto, a banda apertado da gama dinâmica de controlo indirecto limita a sua capacidade de detectar grandes mudanças (100 vezes) em concentrações de biotina. Alterando a faixa dinâmica para ambos os esquemas de controlo directo e indirecto exigiria engenharia adicional. No entanto, se a detecção de células-produzird biotina é um problema, a preparação de diluições do sobrenadante biotina no passo 4.6 deve permitir que o investigador para alvejar a gama dinâmica do sistema de controlo indirecto (Figura 5). Descobrimos que uma diluição 1: 5 de sobrenadante nos permitiu atingir o intervalo dinâmico do esquema de controle indireto eficaz. Esta estratégia de diluição deve aliviar a necessidade de modificar a gama dinâmica directamente.

A de duas partes, o sistema de célula-material aqui apresentado permite que as células manipuladas para modificar a composição de uma superfície funcionalizada. células dinâmicos, vivos podem interpretar seus arredores químicos para produzir uma resposta genética. Por engenharia genética essa resposta para aumentar a produção de biotina, que pode dotar células vivas modificadas com a capacidade de controlar e manipular uma superfície funcionalizada. Ao seguir os protocolos apresentados, as células modificadas são capazes de agir como sensores dinâmicos, capazes de leitura, processamento e gravação as condições em torno them meio de interfaces funcionalizados. Esta tecnologia pode impactar áreas que vão desde a medicina molecular para a detecção de analitos para a remediação ambiental.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os autores agradecem o apoio do prémio FA9550-13-1-0108 da Força Aérea Instituto de Investigação Científica dos EUA. Os autores adicionalmente reconhecer o apoio da adjudicação N00014-15-1-2502 do Office of Naval Research dos EUA, o financiamento do Instituto de Tecnologia da Critical e Ciência Aplicada na Virginia Polytechnic Institute e State University, e da Science Foundation Graduate Research Nacional Programa de bolsas, concessão número 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics