Yaşayan Hücreleri Mühendise Sentetik Biyoloji kullanarak That Programlanabilir Malzemelerle Arayüzü

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu yazıda mühendislik hücreleri ve sentetik kontrol ve programlanabilir malzeme yüzeylerini işlemek için E. coli mühendislik enable işlevselleştirilmiş yüzeylerin geliştirilmesi için bir dizi protokol sunar.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Biz mühendislik hücreler işlevsel yüzey malzeme özelliklerini kontrol sağlayan bir abiyotik-biyotik bir arayüz geliştirdik. E. coli hücrelerinin bir sentetik tasarlanmış suşu ve işlevselleştirilmiş ara yüzüne: Bu sistem, iki modül oluşturarak yapılır. Bu metinde yer alan, biz detay genetik moleküler klonlama stratejileri kullanarak E.coli suşu içinde seçilen davranışları mühendislik için bir protokol. Bir kimyasal uyarıcı maruz kaldığında kez geliştirilen bu suş biotin yüksek seviyelerde üretir. Buna ek olarak, hücre sentezlenmiş biyotin cevap verebilecek her biri iki farklı işlevselleştirilmiş yüzeyler oluşturmak için ayrıntılarıyla protokolleri. Birlikte ele alındığında, biz cansız yüzeylerde malzeme bileşimi ve montaj kontrol hücreleri mühendislik sağlayan bir bağlantılı, abiyotik-biyotik sistemi oluşturmak için bir metodoloji sunuyoruz.

Introduction

Burada, bir mühendislik hücre hattından bir kimyasal sinyali cevap verebilen bir programlanabilir alt tabakanın geliştirilmesi için prosedürler bildirmektedir. 1 Biz sentetik tasarlanmış Escherichia coli (E. coli) hücreler tarafından üretilen biyotin yanıt veren bir biyotin-streptavidin arayüz oluşturarak bunu. Daha önce, programlanabilir yüzeyler toksin tespiti 2 ve nokta-bakım teşhisi 3 savunma ve güvenlik için geniş bir uygulama yelpazesi için tasarlanmış edilmiştir. Programlanabilir yüzeyler sensörler ve aktüatörler olarak yararlı olabilir 4, onlar farklı çevresel zorluklara uyum yeteneği ile donatarak, "akıllı" hale getirilebilir. Bunun aksine, örneğin, E. coli gibi daha basit bir mikroorganizmalar doğal uyum ve karmaşık ve çoğu zaman, beklenmedik çözümlerle zorluklara yanıt yeteneğine sahiptir. Bu uyum E. sağladıkompleks gen ağları tarafından kontrol coli popülasyonları, maliyet-etkin bir kaynak aramaya, 5 katma değerli ürünler, 6 ve hatta güç mikro ölçekli robotik oluşturun. 7 programlanabilir yüzeylerin kullanımı ile yaşayan hücrelerin adaptif avantajlarını birleştirerek, farklı çevre koşullarına cevap verebilecek bir akıllı substrat oluşturabilirsiniz.

Sentetik biyoloji canlıların davranışlarını programlamak için araştırmacılara yeni yetenekler vermiştir. yeni gen düzenleyici ağları içeren hücrelerin mühendislik, araştırmacılar programlanmış bir dizi davranışı gösteren hücreleri tasarlayabilirsiniz. Temel araştırma ötesinde 8, 9, bu davranışlar gibi katma değerli ürünler malzeme düzeneğini kontrol ve biyolojik üretmek gibi uygulamalar için kullanılabilir. 10 Burada, sentetik biyoloji araçlarını kullanılan ayrıntılarıyla nasıl trindüksiyondan sonra biotin sentezleyen bir E. coli suşu disi. Bu soy, bir plazmid, pKE1-lacl-biyobalistik monte sınırlama enzimi klonlama yöntemleri kullanılarak geliştirilmiştir. E. coli K-12 MG1655 dönüştürülmüştür, bu plasmid, biyobalistik, biyotin sentezi için gerekli bir enzimin, yüksek seviyelerde ifade yeteneğine sahip hücrelerin endows. dönüştürülmüş hücreler izopropil β-D-1-tiogalaktopiranosid (IPTG) ile teşvik ve bir biyotin ön, destiobiyotin (DTB) ile sağlanan zaman, biotin yüksek seviyelerde üretildi.

streptavidin, biyotin en bağlanma etkileşimi doğada bulunan güçlü kovalent olmayan bağlar biridir. örneğin, biyotin-streptavidin interaksiyonundan iyi karakterize edilmiş ve son derece biyoteknoloji kullanılan hem de. Bu yazının içinde 11 biz duygusu ve işlevsel yüzey hücre üretilen biyotin algılamak için biyotin-streptavidin etkileşimi kullanan iki strateji sunuyoruz. Biz"Dolaylı" ve "doğrudan" kontrol programları gibi bu zıt yüzeylere bakın. Dolaylı kontrol şeması, hücre üretilen biyotin konjuge ve bağlayıcı siteler streptavidin bir polistiren yüzey üzerine immobilize edilmiş biotin ile rekabet eder. Buna ek olarak, streptavidin-yaban turpu peroksidaz (HRP) ile konjuge edilir. HRP 3, 3 ', 5, 5'-tetrametilbenzidin (TMB), 450 nm (OD 450), spektral emicilik (yani, optik yoğunluk) miktarının izlenebilir bir optik sinyalin, 12 üretilmesi için değiştirir. Böylece, dolaylı kontrol düzeni araştırmacılar OD 450 sinyal attentuation izleyerek hücre üretilen biyotin ölçmek için sağlar.

doğrudan kontrol şeması bir malzeme yüzeyine doğrudan streptavidin hareketsiz hale ve bağlayıcı siteleri streptavidin için rekabet hücre üretilen biyotin ve biyotinile HRP izin vererek streptavidin-biotin olay patlatır. Yine,Hücre üretilen biyotin nispi seviyeleri, bir OD 450 sinyalinin ölçülmesi ile takip edilir.

Birlikte ele alındığında, mühendislikten geçirilen hücreler ve fonksiyonalize yüzeyler US canlı hücre ağları uyararak programlanabilir yüzey özelliklerini kontrol sağlar. Diğer bir deyişle, biz birlikte bu sistemleri birbirine bağlayarak bir mühendislik malzemesi arayüzü canlıların uyum ve güvenilirlik ve şartname yararlanır bir sistem oluşturduk.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Medya ve Kültür Hazırlık

  1. Deiyonize (Dİ) su, 1 L LB tozu stokunun 25 g karıştırma ve sterilize edilmesi için 20 dakika için 121 ° C'da, çözelti otoklav ile lizojeni etsuyu (LB) ortamı hazırlar.
    1. LB plakaları hazırlamak sterilizasyondan önce LB ortamı 15 g agar (% 1.5) eklemek için
    2. DI su 1,000x karbenisilin (Cb) (50 mg / ml) stok çözelti hazırlayın.
    3. Sterilize LB medyanın sıcaklığı 60 ° C'nin altında olduğu kadar dirençli transformantların seçimi için bir antibiyotik içeren LB ortamı hazırlamak ise, bekleyin ve sonra her 1 ml LB medya için antibiyotik stokunun 1 mcL ekleyin.
  2. 5X M9 tuzlan (56.4 g / L), 1 M MgSO 4, 1 M CaCl2,% 20 glikoz,% 2 biyotin içermeyen kasamino asitleri: M9 minimal ortam (Tablo 1), aşağıdaki ayrı stok çözelti hazırlayın.
    1. Bir otoklav güvenli şişede, birleştirmek 20 ml 5x M9 tuzları, 200# 181; 1 M MgSO 4 ve saf su, 1 M CaCl2,% 20 glikoz 2 mL,% 2 biyotin içermeyen kasamino asitleri, 1 mL ve 76.8 mL, 10 uL L.
    2. 20 dakika boyunca 121 ° C 'de aşama 1.2.1'de hazırlanan çözelti otoklava.
  3. 400 rpm'de çalkalanarak 37 ° C'de tüm kültürleri inkübe edin. İnkübasyon süreleri deney ve gerginlik bağlı olarak, ancak genellikle 8 ila 12 saat kadar sürer değişir.

Biotin Üreten E. coli 2. Nesil (plazmid pKE1-lacl-biyobalistik)

Not: Genetik devresi iki parça içerir: laeI represörü, P, L ile tahrik teto-1 nedeniyle tetR represör proteininin yokluğu, hem de P TRC-2 ihtiva eden bir biyotin sentezleme sistemine konstitütif ekspresyonu ile sonuçlanan promotör biyobalistik ekspresyonunu tahrik güçlü ribozom bağlanma yeri (RBS), ardından hızlandırıcı. Tüm klonlama ticari, hızla bölünen, E. coli Stra çalıştırıldıiçinde. Nihai yapı testleri için, E. coli MG1655WT dönüştürüldü. Primerler (Tablo 2), ticari olarak satın alındı.

  1. Bütün hücre, polimeraz zincir reaksiyonu (PCR) gerçekleştirilmesi E. coli genomundan biyobalistik geni izole:
    1. 37 ° C'de gece boyunca E.coli MG 1655WT hücreleri büyütün.
    2. 0.2 ml PCR tüpü steril Dİ su 9 uL aşama 2.1.1 hazırlanan bir gece boyunca kültür 1 uL birleştirir.
    3. bir PCR, 5 dakika boyunca 95 ° C'de tüp inkübe hemen hücreleri lize etmek için 10 dakika boyunca -80 ° C dondurucuda tüp aktarın. Bu PCR şablon olarak hizmet etmek üzere, genomik DNA sağlar.
    4. (I) 2.5 uL nBioB2-F1 ve nBioB2-R primerlerin her biri, çözelti çözülme ekleyin, (ii) 5 5x DNA polimeraz tamponu uL, (iii) DNA polimerazın, 0.25 uL, (iv) dNTP karışımı 0.5 uL ve (v) 25 uL bir toplam reaksiyon hacmi DI su 6.75 uL(Tablo 4).
    5. İçeriğini karıştırmak için (yani, fiske) tüpün yan grev. Sonra, hemen örnek tüpün dibinde olduğundan emin olmak için (~ 2 s) hızla tüp aşağı doğru döndürün.
    6. PCR PCR Tüp ve protokol başında 95 ° C de 3 dakika ek bir adım Tablo 3'te tarif edilen programı kullanımı.
    7. Tris baz, asetik asit ve EDTA tampon maddesi (TAE) içinde - (DI su + etidyum bromür içinde% 1.2 agaroz 1.0) başarılı bir şekilde PCR kullanılarak jel elektroforezi teyit edin. PCR ürünü, uzun 1.070 baz çifti (bp) uzunluğunda olmalıdır.
    8. Aşama 2.1.7 jelin DNA fragmanları elde etmek için, üreticinin talimatlarına uygun olarak, ticari kitler kullanın.
  2. P trc-2 promotör ve plazmid pKDL071 13 (MIT James Collins laboratuvarda izniyle) den laeI operonunu yalıtmak:
    1. Içeren E. coli hücreleri büyütün37 ° C'de LB + CB gece boyunca pKDL071 plazmid.
    2. üreticinin talimatlarına göre bir ticari bir miniprep kiti kullanılarak hücrelerden plazmid DNA ekstrakte edin. Plazmid bir PCR şablonu olarak hizmet edecektir.
    3. adımlar 2.1.4 PCR protokolü uygulayın. 2.1.8 için. şu değişiklikler yapılmaktadır:
    4. Aşama 2.2.2 plazmid ekstre ile lize hücrelerinin yerine geçer.
    5. 2.5 mcL 1-f ve laeI kaset çıkarma 1-r primerlerin her kullanın. Alternatif olarak, 2.5 uL p TRC-2 çıkarılması için primerler nBioB1-f ve nBioB1-r her kullanın.
    6. PCR ürünleri laeI kaset ve P trc-2 promotör Site olduğunuzu onaylamak için jel elektroforezi (adım 2.1.7) gerçekleştirin. Onlar sırasıyla 1213 bp ve 109 bp uzunluğunda olmalıdır.
  3. Içeren biyobalistik kasetini oluşturmak üzere üstüste binme uzantısı (SOE) PCR ile yapıştırma kullanarak P TRC-2 primeri nBioB2-f2 sentetik ribozom bağlanma yeri (RBS) ve biyobalistik Tablo 3'te bulunmaktadır.
  4. Insert yapıları (P L TETO-1 + lacl ve P trc-2 + biyobalistik) pKE1-MCS plazmid vektörü 13 omurgası içine vektör sindiren ve sınır enzimleri ile insert tarafından (MIT James Collins laboratuar nezaket):
    1. restriksiyon enzimleri ve jel elektroforezi kullanılarak genleri ayıklayın. Her reaksiyon içerir: (i) 10 x reaksiyon tamponu 5 uL, (ii) kısıtlama enzimi 1 ile 1 uL, (iii) kısıtlama enzimi 2 1 uL, (iv) DNA, en az 1 ug, ve (v) DI suya 50 uL (Tablo 5) son hacim getir. LaeI kaset için enzimler AatII ve EcoRI ile ve biyobalistik kaset için enzimler HindIII ve Sacll ile sindiremez.
    2. reaksiyonları monte edildikten sonra, hızlı bir şekilde 37 ° C 'de 1 saat süre ile inkübasyondan önce onları ve kısaca santrifüj (~ 2S) girdap.
    3. sırasındasindirim, standart protokollere göre elektroforez için jeller hazırlar.
    4. jel elektroforezi 6x yükleme tamponu ile sindirilmiş DNA birleştirin.
    5. Istenen yapının konumunu kontrol jel DNA fragmanı kesilerek ve jelden DNA fragmanlarının elde etmek için, üreticinin talimatlarına uygun olarak, ticari jel özütleme kitleri kullanmak için bir 2-log merdiven kullanın.
  5. Denklem 1 ile vektör ucun 1 mol oranı: 1, 1: 1 ve 3 spektroskopisi kullanarak DNA ölçme ve 0 hacimlerini hesaplamak:
    denklem 1 denklem 1
    Denklem 1 'de, E vektörüne ekin oranıdır (0, 1, veya 3), x uç DNA miktarıdır, bipolar I baz çiftleri içindeki ara parçanın uzunluğu olan, BP v vektörü uzunluğudur baz çifti olduğunda, ve X v vektörü (50 ng) miktarıdır.
  6. birleştirerek ligasyon reaksiyon karışımında (i) 1 ila uL 10X ligaz tamponu (II)1 pL T4 Ligaz (III), 50 ng vektör DNA (IV) 'ün 10 ul toplam reaksiyon hacmi (Tablo 6), her bir reaksiyonun özel uç DNA, ve (v) DI su kütlesi.
  7. 1 saat boyunca, oda sıcaklığında (RT) enkübe edilir.
  8. Adım 2.7 ligasyonu inkübasyon sırasında, kimyasal yetkili hücreleri hazırlamak.
    1. 1.5 ml santrifüj tüplerine gece boyunca kültürler kısım 1 mi.
    2. 1 dakika için 16,200 x g'de santrifüjleyin.
    3. Süpernatant boşaltacaktır ve (buz üzerinde) soğutulmuş 200 uL 100 mM CaCI2 içinde pelletini. hafifçe pipetleme pelletini. Vorteks etmeyin.
    4. 10 dakika boyunca buz üzerinde mikrosantrifüj tüpü yerleştirin.
    5. Santrifüj, süpernatant kaldırmak soğutulmuş 100 mM CaCl2 100 uL pelet tekrar süspansiyon ve tekrar buz üzerinde tüp yerleştirin.
    6. Tüpü son bir kez santrifüj ve soğutulmuş 100 50 uL mM CaCl2 içinde pelletini.
    7. yerve buz üzerinde boru derhal kimyasal yetkin hücreleri kullanır.
  9. Adım 2.8'de hazırlanan yeterli hücrelerini, her bir tüpe, adım 2.6 ve 2.7'de hazırlanan bağlanan DNA 5 uL ekleyin.
  10. yan (yani çevirme hareketi) tüpler çarpıcı kısaca tüp karıştırın ve daha sonra 30 dakika boyunca buz üzerinde tüpleri.
  11. Isıtma 42 ° C'de 45 s için tüpler şok ve 2 dakika için buza geri tüpleri döndürür.
  12. seçici LB agar + antibiyotik plakaları ve üzerine Pipet hücreleri cam kaplama boncuklar kullanarak hücrelerin yayıldı.
  13. 37 ° C'de gece boyunca inkübe edin.
  14. Sonraki sabah, sokma-pozitif plakalar ile koloniler (yani, 1: 1 ve 3: 1 levha). 1 negatif kontrol plakası hiçbir büyümeyi gösterir, ya da 0 ise 5-8 koloniler almak: 0 eğer 3 koloniler almak 1 tabak bazı büyüme vardır. 5 ml LB + antibiyotik inoküle ve ajitasyon ile 37 ° C 'de 8 saat süre ile büyümeye aldı koloniler kullanın.
  15. Bir minipr kullanılarak hücrelerden plazmid DNA ekstrakteep kiti, üretici talimatlarına göre. kısıtlama enzimleri kullanılarak bir test kesim yapın (adım 2.4.1 detaylı aynı prosedür takip.).
  16. Doğru bir yapının beklenen sonuçlar ile sindirilmiş DNA fragmanlarının uzunluğu karşılaştırarak başarılı konstraktlarla hücrelerin belirlenmesi. Başarılı bir plazmid yapıları taşıyan kültürler (DI su) steril süzüldü,% 40 gliserol çözeltisi ile eşit parçaya kültür karıştırılması ve -80 ° C'de karışımın dondurularak korunabilir.
    Not: diğer E.coli suşları (örneğin, MG1655WT) Plazmidlerin dönüşümler kimyasal kompetan hücreler yapmak için yukarıdaki prosedür takip edilerek gerçekleştirilebilir.

3. Hücre Karakterizasyonu: Büyüme Eğrisi ve Doz Tepki

  1. Uygun antibiyotik ile bir gecede LB ortamında tasarlanmış suşları büyür.
  2. Büyüme eğrileri için, ve 0.5 M s IPTG (olmadan asgari M9 medya 50 mL hazırlamaktak) ve / veya 500 ug / ml stok DTB () aşağıdaki gibi:
    1. 0 ng / ml DTB (stok 0 uL) / 0 mM IPTG (stok 0 ul) hazırlayın.
    2. 200 ng / ml DTB (stok 200 uL) / 0 mM IPTG (stok 0 uL) hazırlayın.
    3. 0 ng / ml DTB (stok 0 uL) / 0.5 mM IPTG (stok 50 ul) hazırlayın.
    4. 200 ng / ml DTB (stok 200 uL) / 0.5 mM IPTG (stok 50 uL) hazırlayın.
    5. 1 gece boyunca kültür inoküle: Yukarıda belirtilen ortam içinde 100.
    6. üç kez, her bir oyuğa, 96 oyuklu bir plaka, kısım kültürünün 200 uL, İN.
    7. OD 600 plaka okuyucusu içinde 37 ° C'de sürekli çalkalanarak ve inkübasyon ile her 5 dakika 24 üzerinde saat ölçün.
  3. Doz karşılığı çalışmaları için, gerçek zamanlı olarak, optik ölçümü için mCherry ile pKE1-lacl-biyobalistik bölgesindeki biyobalistik gen (kırmızı flüoresan protein) değiştirin.
  4. 0.1 mM ila ekspresyonunu indüklemek için 5 mm arasında değişen IPTG değişen miktarlarda eklemeLB ortamında.
  5. 100: 1 dilusyondaki gecede kültürü ile inoküle edin.
  6. Floresans 15 saat boyunca her 30 dakikada bir ölçün.

Mühendislik yardımıyla düzenlenmiş hücreler ve süpernatan Preparasyon biotinin indükleyebileceği 4.

  1. LB ortamında gecede, E. coli MG1655 suşu pKE1-lacl-biyobalistik büyür.
  2. DTB 30 ile 200 ng / mL arasında değişen M9 ortam katkısı.
  3. biyotin sentezini indüklemek için 0.5 mM IPTG ekleyin.
  4. 1 gece boyunca kültür ile desteklenmiş biyotin içermeyen minimal M9 ortam inoküle: 100 seyreltme.
  5. ve büyüme santrifüj hücrelerinin 24 saat sonra biyotin-zenginleştirilmiş supernatant toplamak.
  6. Dolaylı kontrol ve doğrudan kontrol fonksiyonlaşmış yüzeyler ile biotin zenginleştirilmiş süpernatant ölçün. adımlar sırasıyla 5.23 ve 6.12, biotin numunenin yerine süpernatant kullanın.

5. Dolaylı Kontrol Programı Fonksiyonlu Yüzey Hazırlama

  1. th hazırlayıne çözümleri aşağıdaki.
    1. 20 mg içeren bir SMCC çözeltisi hazırlayın / sukinimidil trans-4- (maleimidylmethyl) sikloheksan-1-karboksilat ml dimetil sülfoksit içinde (SMCC) (DMSO).
    2. 20 mg içeren bir SPDP çözeltisi hazırlayın / süksinimidil 3- (2-piridilditiyo) propiyonat DMSO (SPDP) çözeltisi.
    3. DMSO içinde 20 mg / ml LC-LC-biyotin hazırlayın.
    4. fosfat tamponlu tuzlu su (PBS) içinde 10 mg / ml arasında bayır turpu peroksidazı (HRP) hazırlayın.
    5. 10 mg / ml'lik son yoğunluğa seyreltildi streptavidin (SA) hazırlayın.
    6. PBS içinde 10 mg / ml sığır serumu albümini (BSA) hazırlayın.
    7. DI su içinde 100 mM ditiyotreitol (DTT) hazırlayın.
    8. PBS içinde 5 mM ethylenediaminetetaacetic asit (EDTA) hazırlayın.
    9. PBS içinde% 0.5 kazein hazırlayın.
    10. DI su içinde% 20 Tween 80 stok hazırlayın.
    11. PBS içinde% 0.05 Tween 80 (% 20 stok) hazırlayın.
    12. DI su içinde sodyum asetat ve 50 mM hazırlayın.
    13. DMSO% 1 TMB hazırlayın.
    14. % 3 H 2 O 2 i hazırlayınn DI su.
    15. DI su 2 MH 2 SO 4 hazırlayın.
  2. 20 uL SA çözeltisine SPDP çözeltisinin 1.4 uL ekleyin.
  3. Işığa maruz önlemek için alüminyum folyo ile sarılmış, oda sıcaklığında 1.5 saat boyunca 5.2 solüsyonun inkübe edin. Bu adım, SPDP Çapraz bağlayıcı piridilditiyo aktive SA oluşturan bir amino grubu yoluyla SA bağ sağlar.
  4. Aşama 5.3 den çözeltiye DDT çözeltisi 2.4 ul ekleyin ve oda sıcaklığında 1 saat inkübe edin. Bu sülfhidril aktive SA sonuçlanan bir piridin-2-tion bölünme sağlar.
  5. 72 uL HRP çözeltisine 7.5 uL SMCC solüsyonu eklenir ve ışığa maruz kalmasını önlemek için alüminyum folyo ile sarılmış, oda sıcaklığında 1.5 saat süreyle inkübe edin. Bu, bir amino grubu ile bağlanan bir maleimid ile aktive edilmiş HRP ile sonuçlanır.
  6. 200 uL BSA çözeltisi ile 17 uL LC-LC-biyotin çözeltisi karıştırın ve ışığa maruz kalmasını önlemek için alüminyum folyo ile sarılmış, oda sıcaklığında 1.5 saat süreyle inkübe edin. Bu adım eşlenik t biotin veriyorbir amid bağı aracılığıyla O BSA.
  7. adımlarda 5.4, 5.5 çözümler aktarın ve 5.6 Spin tüpler içinde santrifüj konsantratörü ayırmak için.
  8. Tüp hacmi kadar 10.000 xg'de adım 5.4, santrifüj SA-SPDP içeren tüpler için 100 uL veya 16 dakika ulaşır. PBS-EDTA ile 500 mcL Spin tüp doldurun.
    1. Adımı yineleyin 5,8 beş kez. 4 ° C'de stok saklayın.
  9. Hacmi 25 uL ulaştığında veya 16 dakika kadar 10,000 xg'de adım 5.5, santrifüj HRP-SMCC içeren tüpler için. PBS ile 500 mcL Spin tüp doldurun.
    1. Adımı yineleyin 5,9 beş kez. 4 ° C'de stok saklayın.
  10. Hacmi 100 uL ulaştığında veya 12 dakika kadar 10,000 xg'de adım 5.6, santrifüj, BSA-biyotin içeren tüpler için. PBS ile 500 mcL Spin tüp doldurun.
    1. Adımı yineleyin 5.10 dört kez.
    2. 10.000 x g'de santrifüj hacmi 100 uL ulaşıncaya kadarya da 12 dakika karıştırıldı. tüpe 100 ul PBS ilave edin. 4 ° C'de stok saklayın.
  11. Gece boyunca 4 ° C 'de, 10 mg / ml SA çözeltisi ve mağaza 25 uL 10 mg / mL HRP çözeltisinin 25 uL ekleyin. Bu SA tiyoeter bağı yoluyla HRP ile konjuge hale gelmesine neden olur.
    1. 4 ° C buzdolabında bir gecede çözüm ve mağaza ile 4 çalışma çözüm: 1 hazırlayın. -20 ° C'de saklayın kalan çözüm.
  12. PBS 490 uL BSA-biyotin Stokta (veya 10 uL BSA stokunun) 10 mcL ekleyerek, PBS içinde BSA-Biyotin (veya BSA) 'den oluşan iki çözüm hazırlayın.
  13. 96 çukurlu bir polistiren plakanın her bir adım 5.12 çözelti, 100 uL ekleyin.
  14. folyo ile sarılmış, 1 saat boyunca 37 ° C'de levha, inkübe edilir.
  15. % 0.05 Tween 80 ile plakanın kuyularının yıkayın.
    1. oyuklara% 0.05, PBS-Tween 80 200 uL ekleyin. Oda sıcaklığında 2 dakika süreyle inkübe edilir. sıvı Durusu.
    2. <li> adımı yineleyin 5.15.1 üç kez.
  16. 96 gözlü plaka içindeki deliklerin her biri% 0.5 kasein çözeltisi 200 uL ekleyin.
  17. 1 saat boyunca 37 ° C'de inkübe plakası.
  18. Adımı yineleyin 5.15 wells üç defa yıkamak.
  19. % 0.05 Tween 80 7.5 uL% 0.5 kasein çözeltisi 12 ml karıştırılarak bir çözelti hazırlayın.
  20. Adım 5.19 hazırlanan çözüm kullanarak 10,000: SA-HRP stok 1 seyreltin.
  21. 96 oyuklu bir plakanın her bir oyuğuna adım 5.20 hazırlanan çözelti 80 uL ekleyin.
  22. polistiren plakanın her oyuğuna hazırlanan biyotin örneğin 20 uL ekleyin. 4.6 hazırlanan yüzer bu adımda biyotin örnek olarak kullanılabilir.
  23. 1 saat boyunca 37 ° C'de inkübe plakası. Bu adım, rekabetçi serbest biotin arasındaki bağlanma ve SA-HRP bağlayıcı siteler için BSA-biyotin immobilize sağlar.
  24. Adımı yineleyin 5.15 wells üç defa yıkamak.
  25. 50 mM sodyum asetat çözeltisi,% 1 TMB çözeltisi karıştırınve 1000 de% 3 H2O 2 çözeltisi: 10: 1 oranında (20 mL toplam hacim).
  26. her bir adım 5.25 çözelti 200 ul ekleyin ve folyo ile kaplanmış, oda sıcaklığında 15 dakika boyunca bekletin.
  27. Reaksiyonu durdurmak için her bir oyuğa 2 MH 2 SO 4 50 ul ekleyin. Bir plaka okuyucusu kullanılarak OD 450 ölçün.

6. Doğrudan Kontrol Programı Fonksiyonlu Yüzey Hazırlama

  1. Aşağıdaki çözümleri hazırlayın.
    1. DMSO içinde 20 mg / ml LC-LC-biyotin hazırlayın.
    2. 10 mg / PBS ml HRP hazırlayın.
    3. PBS içinde 0.17 mcg / ml SA hazırlayın.
    4. PBS içinde% 0.5 kazein hazırlayın.
    5. DI su içinde% 20 Tween 80 stok hazırlayın.
    6. PBS içinde% 0.05 Tween 80 (% 20 stok) hazırlayın.
    7. DI su içinde sodyum asetat ve 50 mM hazırlayın.
    8. DMSO% 1 TMB hazırlayın.
    9. DI su içinde% 3 H2O 2 hazırlayın.
    10. Hazırlayın 2 MH 2 SO 4 su.
  2. 72 uL HRP 7.5 mL LC-LC-biyotin ekleyin ve ışığa maruz kalmasını önlemek için alüminyum folyoya sarılmış, oda sıcaklığında en 1.5 saat kuluçkaya yatmaktadır. Bu adım, bir amid bağı aracılığıyla HRP konjugat biyotin neden olur.
  3. Spin tüpü içinde bir merkezkaç konsantratör adım 6.2 çözüm aktarın
    1. hacmi 100 uL ulaştığında veya 12 dakika kadar 10,000 xg'de çözüm santrifüj. PBS ile 500 mcL Spin tüp doldurun ve santrifüj ve PBS ek dört kez tekrarlayın. 4 ° C'de stok saklayın.
  4. 96 çukurlu bir polistiren plaka içindeki her bir oyuğa 6.1.3 SA çözeltisi 100 uL ekleyin.
  5. folyo ile sarılmış, 1 saat boyunca 37 ° C'de levha, inkübe edilir.
  6. % 0.05 Tween 80 ile plakanın kuyularının yıkayın.
    1. Wells 0.05 ila% 200 ul Tween 80 ekleyin. Oda sıcaklığında 2 dakika süreyle inkübe edilir. sıvı Durusu.
    2. 6.6.1 üç kez tekrarlayın.
  7. 96 gözlü plaka içindeki deliklerin her biri% 0.5 kasein çözeltisi 200 uL ekleyin.
  8. 1 saat boyunca 37 ° C'de inkübe plakası.
  9. Adımı yineleyin 6.6 üç kez kuyuları yıkayın.
  10. biyotin-HRP stok 1 seyreltin: 10.000 adım 6.3 hazırlanan çözüm kullanarak.
  11. 96 oyuklu bir plakanın her bir oyuğuna adım 6.10 hazırlanan çözelti 80 uL ekleyin.
  12. polistiren plakanın her oyuğuna hazırlanan biyotin örneğin 20 uL ekleyin. 4.6 hazırlanan yüzer bu adımda biyotin örnek olarak kullanılabilir.
  13. 1 saat boyunca 37 ° C'de inkübe plakası. Bu adım, rekabetçi hareketsiz SA bağlanma siteleri için ücretsiz biotin ve biyotin-HRP arasındaki bağlanmanın sağlar.
  14. Adımı yineleyin 6.6 wells üç defa yıkamak.
  15. 10: 1 oranında (20 mL toplam hacim), 1.000 50 mM sodyum asetat çözeltisi,% 1 TMB solüsyonu ve% 3 H2O 2 çözeltisi karıştırılır.
  16. Aşama 6'daki çözeltisi 200 uL ekleyin.15 de her ve folyo ile kaplanmış, oda sıcaklığında 15 dakika boyunca inkübasyona.
  17. Reaksiyonu durdurmak için her bir oyuğa 2 MH 2 SO 4 çözeltisinin 50 ul ekleyin. Bir plaka okuyucusu kullanılarak OD 450 ölçün.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Temsilcisi sonuçları ekteki beş şekillerde sunulmaktadır. Okuyucu görsel sentetik mühendislik E.coli suşu oluşturmak için kritik adımları böylece Öncelikle, biz grafiksel klonlama işlemini (Şekil 1) sunuyoruz. Hücrelerin popülasyon dinamiklerini karakterize etmek amacıyla, nüfusun, 600 nm (OD 600) de optik yoğunluk ölçümü ile üretilen bir büyüme eğrisi (Şekil 2) bulunur. Sonra, biz düzenleyici gen ağı bize optik IPTG ile indüksiyon üzerine hücre tarafından üretilen olacağını biyobalistik nispi miktarını ölçmek için izin biyobalistik için bir vekil olarak (Şekil 3) mCherry kullanarak, doğrulanmaktadır nasıl gösterir. Sonra, dolaylı kontrolü ve direkt kontrol fonksiyonlaşmış yüzeyler için yanıt verileri sunmak. Bu veriler araziler (Şekil 4) ücretsiz ölçülen çözümlerini kullanılarak geliştirilenBiotin işlevselleştirilmiş yüzeylerin tepki profillerini karakterize etmek. Son olarak, bu şekilde fonksiyonalize yüzey modifiye üzerine dizayn edilen hücreler, biyotin (Şekil 5) üretilmesi için indüklenir gösteren karakteristik verilerini sunmaktadır.

Şekil 1
Şekil 1: Tasarım ve İndüklenebilir, Engineered Hücreleri inşaatı. (A), primerler biyotin sentez yolağındaki önemli bir enzimi kodlayan, E. coli genomu, adlı biyobalistik geni izole etmek için tasarlandı. (B) p L teto-1 -lacI ve p TRC-2 karşılık gelen sekanslar primerler ile genetik değiştirme anahtarını ihtiva eden bir plazmidden izole edilebilir. (Cı) ile ekstre biyobalistik geni ve geçiş anahtarı iki fragman daha sonra gen devre oluşturmak için de kullanılabilir. IND'ye olabilir IPTG eklenmesiDTB biyobalistik için alt-tabaka olarak ilave edildiğinde biyobalistik ve böylece biyotin sentezi ifade üçe. (D) bir araya plazmid K-12 MG1655 E. coli 'ye transforme edildi. Bu DTB bir alt-tabaka olarak temin edilmiştir zaman işlenmiş hücre hattı ile biyobalistik ve böylece biyotin sentez ekspresyonunu indükleme IPTG varlığında neden oldu. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Şekil 2: İşlenmiş Hücreleri Büyüme Eğrileri. Işlenmiş, uyarılabilir MG1655 doğal tipte hücreler, büyütüldü ve minimal ortam (örneğin, biyotin içermeyen M9 ortam), hem de minimal ortam DTB ile takviye (200 ng / ml) ve / veya IPTG (0.5 mm) içinde izlenmiştir. Araziler OD 600 okuma ölçülen her 5 ml göstermektedir 24 saat boyunca n. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3: Engineered Gen Ağı Test. floresan protein MCherry yerine kullanılmıştır mühendislik hücreler IPTG ile uyarılmıştır zaman biz optik indüksiyon profili ölçmek böylece biyobalistik gen. Biz IPTG (mavi elmas) ile uyarılan değil hücreleri ile IPTG (kırmızı elmas) ile uyarılan hücreler kontrast. Bu sonuçlar, uyanlabilir gen ağ etkinliğini göstermektedir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

/55300/55300fig4.jpg "/>
Şekil 4: Fonksiyonel Malzeme Arayüz doğrulanması. Biotin konsantrasyonları için fonksiyonalize yüzey teşhir ederek, OD 450 absorbansı ölçülerek optik cevap ölçebilir. Bu sonuçlar, karşılık optik yoğunluğuna biyotin konsantrasyonu bağlama ABD bir kalibrasyon eğrisi oluşturmak için izin verir. Burada, hem dolaylı (solda) ve doğrudan (sağ) fonksiyonelleştirilmiş yüzey düzenleri için optik sinyal eğrileri vs biotin sunuyoruz. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 5,
Şekil 5: İşlenmiş Hücreler Malzeme Arayüzü kontrol edin. protokol bölümleri 5 veya 6 yararlanarak, biz kaynaklı, mühendislik c ürünlerini kullanmak mümkünarşın kimyasal fonksiyonalize yüzeyini değiştirmek için. Biz OD 450 ölçerek optik bu yanıtları izleyebilirsiniz. Bundan başka, Şekil 4 içinde geliştirilen kalibrasyon eğrisi kullanılarak, yoğunlaştırma olan biyotine karşılık optik yoğunluğu bağlantı olabilir. Burada doğal tipte hücreler (beyaz), pKE1-lacl-biyobalistik plazmid (turuncu) ihtiva eden indüklenmemiş hücreleri için dolaylı bir kontrol şeması fonksiyonalize yüzey ile ölçülen farklı biyotin konsantrasyonları, ve pKE1-lacl-biyobalistik ihtiva eden bağlı hücrelerin mevcut plazmid (gri). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Kimyasal nihai konsantrasyon Tutar
5x M9 tuzları 1x 20 mL
1 M MgSO 4 2 mM 200 uL
1 M CaCI2 0.1 mM 10 uL
% 20 glükoz % 0,40 2 mL
% 2 biyotin-serbest kasamido asit % 0.02 1 mL
DI Su N / A 76.8 ml

Tablo 1: M9 aracı tarifi.

isim primer sekans kullanım
1-F CCGCCGGAATTCTCCCTATCAGTGATAGAGATT laeI kaset çıkarma
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC laeI kaset çıkarma
nBioB1-F CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-2 çıkarma
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-2 çıkarma
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG biyobalistik çıkarma
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC biyobalistik çıkarma
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Sentetik RBS ekleme

Tablo 2: astar listesi.

Adım 1
Adım 2 Aşama 3 Aşama 4 Adım 5 Aşama 6 Aşama 7 Aşama 8 Aşama 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
12 kez tekrarlayın 25 kez tekrarlayın
-1 C / döngüsü °

Tablo 3: PCR Programı.

isim hacim
Hücre lizatı (şablon) 10 uL
Astar (her biri) 0.625 uL (her biri)
5x Q5 tampon 5 uL
Q5 Polimeraz 0.25 uL
dNTP karışımı 0.5 uL
DI Su 6.75 uL

Tablo 4: Tüm Hücre PCR Reaksiyon (25 ul).

isim hacim
10x reaksiyon tamponu 5 uL
enzim 1 1 pL
Enzim 2 1 pL
Şablon DNA, 1 ug
DI Su 43 uL - DNA hacmi

Tablo 5: kısıtlayıcı enzim sindirimi Reaksiyon (50 ul).

isim hacim
DNA + X ug insert 50 ug vektör
10x ligaz tamponu 1 pL
T4 ligaz 1 pL
DI Su 8 uL - DNA hacmi

Tablo 6: ligasyon reaksiyonu (10 uL).

isim konsantrasyon notlar
CaCl2 100 mM
Carbeniccilin 50 mg / ml (1000x)
DTB 50 ug / ml
IPTG 0.5 M
SMCC 20 mg / ml 100uL DMSO içinde 2mg
SPDP 20 mg / ml 100uL DMSO içinde 2mg
LC-LC-biyotin 20 mg / ml 100uL DMSO içinde 2mg
HRP 10 mg / ml PBS içinde
SA (dolaylı) 10 mg / ml PBS içinde
SA (doğrudan) 0.17 ug / ml PBS içinde
BSA 20 mg / ml PBS içinde
DTT 100mM DI Water
EDTA 5 mM 10 ml PBS içine 18.6 mg
Kazein % 0,50 PBS içinde
Tween 80 % 20 DI Water
PBS Tween 80 % 0.05
Sodyum asetat 50 mM DI Water, 3 M HCI kullanılarak 5.1 pH ayarlayın
TMB % 1 DMSO içinde
H2O 2 % 3 DI Water
H 2 SO 4 2M DI Water

Tablo 7: Reaktif Solutions listesi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Biz bir fonksiyonelleştirilmiş malzeme yüzeyi ile yaşayan mühendislik hücrelerin arayüz için yeni bir strateji sundu. Bu IPTG ile indüklenmiştir zaman biyotin yüksek seviyelerde sentez edebilme yeteneğine sahip olan bir hücre hattı geliştirilmesi ile gerçekleştirildi. biotin yüksek seviyeler daha sonra fonksiyonalize yüzeyini değiştirmek için kullanılabilir. Protokoller E.coli hücre hattını mühendis nasıl ve iki farklı fonksiyonalize yüzeyler oluşturmak için nasıl ayrıntılı.

Bu protokol kritik adımlar mühendislik hücre hattı inşaatı boyunca meydana gelir. Mansap sorunları, hem de büyüme eğrileri ile tasarlanmış hücre suşları karakterize (Şekil 2) ve floresan yanıt (Şekil 3) önlemek için teşvik edilmektedir. Usul sorunları ortaya çıkarsa, bu tür PCR çıkarma ve Gibson montajı 14 gibi diğer moleküler klonlama stratejileri, nerede adımlar için uygun ikame edilebilir. biotin Yie optimize içinişlenmiş hücre çizgisinin LD, DTB yeterli bir miktarda hücrelere sağlanan sağlamak için çok önemlidir. Çalışmalarımızda olarak, hücreler, IPTG ile indüklenmiştir zaman 200 ng / ml DTB biyotin üretiminde önemli ve anlamlı bir artış ortaya bulundu. Ayrıca, BSA-Biotin, SA-HRP ve Biotin-HRP başarılı çekimleri etkili bir performans ve dolaylı ve doğrudan kontrol şemaları izlemek için çok önemlidir. ışığa, gereksiz maruz kalmasını önlemek ve konjugatları etkin konjugat oluşturulmaktadır sağlamak için 4 ° C'de bir gece boyunca inkübe izin dikkat edin.

Bizim protokolünün örneğin 4'-hydroxyazobenzene-2-karboksilik asite dayanan ticari olarak biyotin tespit kiti ile karşılaştırıldığında (pg / ml ölçeği) biyolojik olarak alakalı biyotin küçük miktarlarda tespit edebilme kabiliyeti için alternatif yöntemler 15 göre avantajlar sunar kompetitif bağlanma stratejileri. streptavidin bio kullanarak rağmenkalay sistem biyoteknoloji 16, 17 yaygındır, biotin küçük miktarlarda yanıt vermek sistemin yeteneği doğrudan işlevsel yüzey ile genetiği değiştirilmiş hücre hattını bağlamak için bize izin verir.

Bizim protokol potansiyel bir sınırlama biotin algılama ortaya çıkan dinamik aralık olduğunu. Dolaylı ve doğrudan kontrol şemaları, biz (4 Şekil) sırasıyla / mL pg 4 -10 6 3 -10 2 10 ila 10 biyotin tespit edebiliyoruz. Neyse ki, dolaylı kontrol şeması düşük aralık bizi kolayca tasarlanmış hücrelerden biyotin üretimini algılamasını sağlar. Ancak, dolaylı kontrolü dinamik aralık sıkı bant biyotin konsantrasyonlarında büyük değişiklikler (100 kat) anlamda kabiliyetini sınırlar. hem dolaylı ve doğrudan kontrol şemaları için dinamik aralığı değiştirilmesi ek mühendislik gerektirir. Bununla birlikte, saptama hücre-üretmek eğerd biotin dolaylı kontrol şeması (Şekil 5) dinamik aralık hedef araştırmacı izin vermelidir adım 4.6 biotin süpernatant dilüsyonları hazırlamak, bir konudur. süpernatant 5 seyreltme bizi etkili dolaylı kontrol planın dinamik aralığı hedeflemesine izin: Biz 1 bulundu. Bu seyreltme stratejisi doğrudan dinamik aralığını değiştirmek ihtiyacını hafifletmek gerekir.

Burada yer alan iki parçalı, hücre malzeme sistemi işlevsel yüzey bileşimini değiştirmek için hücreleri işenmiş sağlar. Dinamik, canlı hücreler genetik yanıt üretmek için kimyasal çevresi yorumlayabilir. biyotin üretimini artırmak için bu genetik yanıtı mühendislik, biz bir fonksiyonlaşmış yüzeyi kontrol ve manipüle etme yeteneği ile mühendislik yaşam hücreleri bağışlamak olabilir. sunulan protokolleri takip ederek, mühendislik hücreler okuma, işleme kapasitesine sahip olduğu dinamik sensörleri, hareket edebiliyoruz, ve inci etrafında koşulları kayıtfonksiyonlaşmış arabirimler üzerinden em. Bu teknoloji moleküler tıp çevresel iyileştirme için analit algılama değişen alanları etkileyebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgments

Yazarlar minnetle ABD Bilimsel Araştırma Hava Kuvvetleri Ofisi ödül FA9550-13-1-0108 destek kabul. Yazarlar ayrıca Virginia Politeknik Enstitüsü ve Devlet Üniversitesi'nde Kritik Teknoloji ve Uygulamalı Bilimler Enstitüsü'nde ve Ulusal Bilim Vakfı Lisansüstü Research fon, ABD Donanma Araştırma Ofisi ödül N00014-15-1-2502 destek kabul Burs Programı, ödül sayısı 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics