गर्भनाल रक्त व्युत्पन्न प्रेरित प्लुरिपोटेंट स्टेम सेल से चोंड्रोजेनिक गोली संरचना

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहां, हम कॉर्ड रक्त मोनोन्यूक्लियर सेल-व्युत्पन्न मानव प्रेरित प्लुपीप्रोटेंट स्टेम सेल से चोंड्रोजेनिक भेदभाव के लिए एक प्रोटोकॉल का प्रस्ताव करते हैं।

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

मानव सांध्यासंबंधी उपास्थि में स्वयं की मरम्मत करने की क्षमता नहीं होती है। इस तरह कर्टिलिएज डिजनरेशन का इलाज रोगी द्वारा नहीं बल्कि रूढ़िवादी उपचारों द्वारा किया जाता है। वर्तमान में, पूर्व विवो विस्तारित चॉन्ड्रोसाइट्स या अस्थि मज्जा-व्युत्पन्न मेसेनचिमल स्टेम सेल (बीएमएससी) के साथ क्षतिग्रस्त कार्टिलेज को पुनर्जन्म करने के प्रयास किए जा रहे हैं। हालांकि, इन कोशिकाओं की प्रतिबंधित व्यवहार्यता और अस्थिरता उपास्थि पुनर्निर्माण में अपने आवेदन को सीमित करती हैं। मानव प्रेरित pluripotent स्टेम कोशिकाओं (hiPSCs) पुनर्योजी अनुप्रयोगों के लिए एक नया विकल्प के रूप में वैज्ञानिक ध्यान प्राप्त किया है। असीमित स्व-नवीकरण क्षमता और बहुतायत के साथ, उपास्थि मरम्मत के लिए एक नए प्रतिस्थापन सेल स्रोत के रूप में hiPSC को हाइलाइट किया गया है। हालांकि, उच्च गुणवत्ता वाली चोंड्रोजेनिक छर्रों की उच्च मात्रा प्राप्त करना उनके नैदानिक ​​आवेदन के लिए एक बड़ी चुनौती है। इस अध्ययन में, हमने भ्रूण निकाय (ईबी) का प्रयोग किया- चोंड्रोजेनिक भेदभाव के लिए निकला हुआ उत्थान कोशिकाएं। सफल चोंड्रोजेनेसिस को पीसीआर द्वारा पुष्टि की गई थीएलसीआई नीले, टोलुइडिन नीले, और कोलेजन प्रकार I और II (क्रमशः COL1A1 और COL2A1, के खिलाफ) के प्रति एंटीबॉडी के साथ धुंधला हो जाना। हम कॉर्ड रक्त मोनोन्यूक्लियर सेल-व्युत्पन्न आईपीएसएस (सीएलएमसी-एचपीएससी) के भेदभाव के लिए चोंड्रोजेनिक छर्रों में एक विस्तृत विधि प्रदान करते हैं।

Introduction

हायपीएससी का उपयोग दवा जांच और विभिन्न रोगों के यांत्रिक अध्ययन के लिए एक नई रणनीति का प्रतिनिधित्व करता है। एक पुनर्योजी परिप्रेक्ष्य से, क्षतिग्रस्त ऊतकों के प्रतिस्थापन के लिए एचपीएससी भी एक संभावित स्रोत हैं, जिनमें सीमित चिकित्सा क्षमता होती है, जैसे कि सांध्यात्मक उपास्थि 1 , 2

देशी सांप की उपाधि का पुनर्निर्माण कई दशकों के लिए एक चुनौती रहा है। विशिष्ट कार्टिलेज एक नरम, सफेद टिशू है जो कोट्स को हड्डियों के अंत में, घर्षण से बचाते हैं। हालांकि, क्षतिग्रस्त होने पर इसकी पुनर्योजी क्षमता सीमित है, जो स्व-मरम्मत लगभग असंभव बनाता है इसलिए, कई दशकों तक उपास्थि पुनर्जनन पर केंद्रित अनुसंधान चल रहा है।

पहले, चोंड्रोजेनिक वंश में इन विट्रो भेदभाव में आम तौर पर बीएमएससी या घुटने के संयुक्त 3 से पृथक देशी क्रोन्ड्रोसाइट्स के साथ प्रदर्शन किया जाता था। कारण टीओ उनकी चोंड्रोजेनिक क्षमता, बीएमएससी और देशी क्रोन्ड्रोसाइट्स में चोंड्रोजेनेसिस में उनके उपयोग के समर्थन में कई गुण हैं। हालांकि, उनके सीमित विस्तार और अस्थिर फेनोटाइप के कारण, इन कोशिकाओं में सांप के उपास्थि दोषों के पुनर्निर्माण में कई सीमाएं होती हैं। इन विट्रो संस्कृति की स्थितियों में, इन कोशिकाओं को 3-4 मार्गों के बाद अपनी विशेषताओं को खोना पड़ता है, जो अंततः उनकी भेदभाव क्षमता 4 को प्रभावित करता है। इसके अलावा, देशी कोशिका के मामले में, इन कोशिकाओं को प्राप्त करते समय घुटने के जोड़ को अतिरिक्त नुकसान अनिवार्य है।

बीएमएससी या देशी क्रोंड्रोसाइट्स के विपरीत, हायपीएससी इन विट्रो में अनिश्चित काल तक विस्तार कर सकते हैं। उचित संस्कृति की स्थिति के साथ, हायपीएससी को चोंड्रोजेनिक भेदभाव के लिए प्रतिस्थापन स्रोत के रूप में काफी संभावनाएं हैं। हालांकि, एचपीएससी 5 की आंतरिक विशेषताओं को बदलने के लिए चुनौतीपूर्ण है इसके अलावा, यह इन विट्रो स्टी में बहुत जटिल हैPs एक विशिष्ट सेल प्रकार के लिए hiPSCs के भाग्य को निर्देशित करने के लिए इन जटिलताओं के बावजूद, उच्च स्पी-नवीकरण क्षमता और उच्च स्तरीय कोशिकाओं में अंतर करने की उनकी क्षमताओं के कारण, उच्च पीएससी के प्रयोग को अभी भी अनुशंसित किया गया है।

चोंड्रोजेनिक भेदभाव आम तौर पर तीन-आयामी संस्कृति प्रणालियों के साथ किया जाता है, जैसे कि गोली संस्कृति या माइक्रोमास संस्कृति, एमएससी जैसी पूर्वज कोशिकाओं का उपयोग करते हुए। यदि hiPSCs का उपयोग करते हैं, तो प्रोटोकॉल एमएससी जैसे पूर्वज कोशिका उत्पन्न करने के लिए मौजूदा प्रोटोकॉल से अलग है। एमएससी-जैसी कोशिकाओं 7 में फ़नोटाइप को सीधे रूपांतरित करने के लिए कुछ समूह, हायपीएससी के मोनोलेयर संस्कृति का उपयोग करते हैं हालांकि, ज्यादातर अध्ययन एमएससी 8 , 9 , 10 , 11 के समान उत्थान कोशिकाओं को उत्पन्न करने के लिए ईबीएस का उपयोग करते हैं।

विभिन्न प्रकार के विकास कारक को चोंड्रोग को प्रेरित करने के लिए उपयोग किया जाता हैNesis। आमतौर पर, बीएमपी और टीजीएफ बी परिवार प्रोटीन का इस्तेमाल अकेले या संयोजन में किया जाता है। भेदभाव भी अन्य कारकों के साथ प्रेरित किया गया है, जैसे कि जीडीएफ 5, एफजीएफ 2, और आईजीएफ 1 12 , 13 , 14 , 15 । टीजीएफ बी 1 को एमएससी 16 में खुराक पर निर्भर तरीके से चोंड्रोजेनेसिस को उत्तेजित करने के लिए दिखाया गया है। अन्य आइसोटाइप के मुकाबले, टीजीएफ बी 3, टीजीएफ बी 1 प्री-उपास्थि मेसेनकैमल सेल कंडेनसेशन को बढ़ाकर चॉन्ड्रोजेनेसिस लाती है। टीजीएफ बी 3 ने मेन्काइचैमल सेल प्रसार 17 में काफी वृद्धि करके चोंड्रोजेनेसिस को प्रेरित किया। हालांकि, टीजीएफ बी 1 7 , 10 , 18 , 1 9 से अधिक शोधकर्ताओं द्वारा टीजीएफ बी 3 का प्रयोग अधिक बार किया जाता है। बीएमपी 2 मानव में चोंड्रोजेनिक मैट्रिक्स घटकों से संबंधित जीन की अभिव्यक्ति को बढ़ाता हैइन विट्रो स्थितियों में एपिक्युलर क्रोंड्रोसाइट्स 20 बीएमपी 2 टीजीएफ बी प्रोटीन 21 के साथ संयोजन में एमएससी में उपास्थि बनाने के लिए महत्वपूर्ण जीन की अभिव्यक्ति बढ़ाता है। यह भी दिखाया गया है कि बीएमपी 2 स्वाद और एमएपीके रास्ते 22 के माध्यम से टीजीएफ बीओ 3 के प्रभाव को बढ़ाती है।

इस अध्ययन में, सीबीएमसी-एचपीएससी को ईबी माध्यम का उपयोग करके कम-लगाव पेट्री डिश में ईबी माध्यम का उपयोग किया गया था। आउटग्राथ कोशिकाओं को ईबीएस को जिलेटिन-लेपित डिश में जोड़कर प्रेरित किया गया था। गुदगुदी कोशिकाओं का उपयोग करके चोंड्रोजेनिक भेदभाव गोली संस्कृति द्वारा किया गया था। बीएमपी 2 और टीजीएफ बी 3 दोनों के साथ उपचार ने कोशिकाओं को सघन कर दिया और चोंड्रोजेनिक गोली संरचना के लिए प्रेरित एक्स्ट्रासेल्यूलर मैट्रिक्स (ईसीएम) प्रोटीन संचय किया। यह अध्ययन सीबीएमसी-हायपीएससी का इस्तेमाल करते हुए एक सरल लेकिन कुशल chondrogenic भेदभाव प्रोटोकॉल का सुझाव देता है

Subscription Required. Please recommend JoVE to your librarian.

Protocol

इस प्रोटोकॉल को कैथोलिक यूनिवर्सिटी ऑफ कोरिया (केसी 12 टीआईएसआई 0861) के संस्थागत समीक्षा बोर्ड ने मंजूरी दे दी थी। पुनःप्रोग्रामिंग के लिए इस्तेमाल किए जाने वाले सीबीएमसी को सीधे सोल सेंट मैरीज अस्पताल के कॉर्ड ब्लड बैंक से प्राप्त किया गया था।

1. आईपीएससी से चोंड्रोजेनिक भेदभाव

  1. CBMC-iPSC पीढ़ी
    1. हमारे पिछले काम 23 में दिखाए गए प्रोटोकॉल का उपयोग करते हुए सीबीएमसी-एचपीएससी उत्पन्न करें
    2. 15 मिलीलीटर शंक्वाकार ट्यूब में रक्त कोशिकाओं को ले लीजिए और एक हेमोसाइटेटोमीटर का उपयोग कर उन्हें गिनें।
    3. 3 x 10 5 कोशिकाओं को तैयार करें और उन्हें 5 मिनट के लिए 515 xg और आरटी के लिए अपकेंद्रित करें चूषण द्वारा सतह पर तैरनेवाला को त्यागें और 0.5 मिलीलीटर रक्त कोशिका माध्यम में कोशिकाओं को पुन: resuspend।
    4. कोशिकाओं को एक गैर-लेपित 24-अच्छी तरह से थाली के एक कुएं में स्थानांतरित करें और निर्माता की सिफारिशों के बाद सेंडाइ वायरस मिश्रण जोड़ें।
    5. प्लेट को 30 मिनट के लिए 1,150 xg और 30 डिग्री सेल्सियस तक अपकेंद्रित करें
    6. पिछाड़ीएर सेंट्रीफ्यूजेशन, कोशिकाओं को रात भर (ओ / एन) 37 डिग्री सेल्सियस पर 5% सीओ 2 में सेते हैं।
    7. अगले दिन, ट्रांसडुस्ड कोशिकाओं को एक मैट्रिक्स-लेपित अच्छी तरह से स्थानांतरित करें। 30 डिग्री सेल्सियस पर 30 मिनट के लिए 1,150 xg पर प्लेट को अपकेंद्रित करें
    8. Centrifugation के बाद, सतह पर तैरनेवाला को हटा दें, आईपीपीएस माध्यम के 1 एमएल जोड़ें और 5% सीओ 2 में 37 डिग्री सेल्सियस पर ओ / एन कोशिकाओं को बनाए रखें।
    9. संलग्न कोशिकाओं को 37 डिग्री सेल्सियस और 5% सीओ 2 बनाए रखें। नए आईपीएसएससी मध्यम के साथ इसे प्रतिस्थापित करते हुए मध्यम दैनिक बदलें।
      नोट: पारगमन के बाद कलोनियों को 14-21 दिन दिखाई देगा।
  2. ईबी पीढ़ी
    1. 37 डिग्री सेल्सियस और 5% सीओ 2 में एचपीएससी बनाए रखें। माध्यमिक दैनिक बदलें, इसे नए आवश्यक 8 (ई 8) माध्यम से बदलकर
    2. ई 8 मध्यम में एक vitronectin-coated, 100-mm डिश में 2 x 10 6 hiPSCs तैयार करें।
    3. संस्कृति पकवान से ई 8 माध्यम निकालें और बाँझ फॉस्फेट-बफ़ेड खारा (पीबीएस) से धो लें।
    4. 1 जोड़ेंएमएल 1 एमएम एथिलेनेयमिनेटेट्रैसिटिक एसिड (ईडीटीए) और 37 डिग्री सेल्सियस और 2 मिनट के लिए 5% सीओ 2 में सेते हैं।
    5. 3 एमएल के ई 8 मध्यम वाले कोशिकाओं का फसल करें और उन्हें नए 15-एमएल शंक्वाकार ट्यूब में स्थानांतरित करें। 2 मिनट के लिए कमरे के तापमान (आरटी) पर 250 xg पर कोशिकाओं को अपकेंद्रित्र
    6. सेल गोली को परेशान किए बिना सतह पर तैरनेवाला का आकांक्षा करना और 5 एमएल के ई 8 माध्यम में कोशिकाओं को पुन: resuspend।
    7. एक हेमोसिटामीटर का उपयोग करके कोशिकाओं की गणना करें और प्रत्येक 100 मिमी पेट्री डिश के लिए 2 x 10 6 कोशिकाओं को तैयार करें। 10 माइक्रोन रोड-जुड़े किनेज (आरओसीके) अवरोधक के साथ ई 8 और ईबी मध्यम (1: 1) के 10-एमएल मिश्रण में तैयार कोशिकाओं को फिर से खोलें।
    8. 37 डिग्री सेल्सियस और 5% सीओ 2 पर एकत्रीकरण के लिए कोशिकाओं ओ / एन को सेते हैं।
    9. अगले दिन, पिपेटिंग द्वारा एकत्रित ईबीएस काटा। 1 मिनट के लिए 250 xg पर कोशिकाओं को अपकेंद्रित्र सतह पर तैरनेवाला निकालें और 10 एमएल का ताजा ई 8 मध्यम में ईबीस को फिर से खोलें।
    10. 5 दिन के लिए उत्पन्न ईबीएस बढ़ाएं, फ़्रेस के साथ दैनिक परिवर्तन करेंएच ई 8 मध्यम अधिक परिपक्वता के लिए, संस्कृति माध्यम को ई 7 मध्यम में बदल दें। ईबी के 37 डिग्री सेल्सियस और 5% सीओ 2 को दूसरे 5 दिनों के लिए बनाए रखें, ताजा ई 7 माध्यम के साथ दैनिक माध्यम परिवर्तन करें।
      नोट: ई 7 माध्यम ई -8 मध्यम है बिना एफजीएफ 2।
  3. ईबीएस से आउटग्रोथ सेल प्रेरण
    1. 1 मिमी जिलेटिन में 6 एमएल का 100 मिमी डिश में जोड़ें और 37 डिग्री सेल्सियस और 5 मिनट तक 30 मिनट के लिए सीओ 2 सेवन करें।
    2. जिलेटिन निकालें और उपयोग के पहले 2-3 घंटे के लिए पूरी तरह पकवान को सूखा।
    3. ईबीएस को 50 एमएल शंक्वाकार ट्यूब में स्थानांतरित करें। ईबीओ को शंक्वाकार ट्यूब के नीचे रहने की अनुमति दें EBs को परेशान किए बिना सतह पर तैरनेवाला निकालें
    4. 20 मिलीग्राम भ्रूण गोजातीय सीरम (एफबीएस) के साथ 10 मिलीलीटर डल्बेईको के संशोधित ईगल के मध्यम (डीएमईएम) में ईबी का पुन: आकार दें। जिलेटिन-लेपित, 100 मिमी डिश के लिए ईबीएस स्थानांतरण। 10 माइक्रोन रॉक अवरोधक जोड़ें।
    5. 37 डिग्री सेल्सियस पर सेल और 7 दिनों के लिए 5% सीओ 2 को सेते और बनाए रखें। थीम बदलेंरोज़ अवरोधक को बिना किसी दूसरे दिन डियाम करें
  4. चोंड्रोजेनिक गोली गठन
    1. पकवान से संस्कृति माध्यम की इच्छाशक्ति और पीबीएस के साथ कोशिकाओं को तीन बार धोएं।
    2. 1 एमएम EDTA के 1 एमएल लागू करें और 37 डिग्री सेल्सियस पर और 2 मिनट के लिए 5% सीओ 2 सेवन करें।
    3. 20 एमबी एफबीएस के साथ डीएमईएम के 5 एमएल का उपयोग करके कोशिकाओं को फसल डालें और उन्हें नए 15 एमएल शंक्वाकार ट्यूब में स्थानांतरित करें।
    4. 250 मिनट और आरटी पर 2 मिनट के लिए कोशिकाओं को अपकेंद्रित्र सतह पर तैरनेवाला को त्यागें और 20 एमएएल डीएमईएम में 20% एफबीएस के साथ गोली resuspend।
    5. फिल्टर और एक 40 सुक्ष्ममापी सेल झरनी का उपयोग कर सेल clumps त्यागें और एकल कोशिकाओं फसल। एक हेमोसिटामीटर का प्रयोग करके एकल कोशिकाओं की गणना करें।
    6. 250 मिनट और आरटी पर 2 मिनट के लिए कोशिकाओं को अपकेंद्रित्र 300 μL चोंड्रोजेनिक भेदभाव माध्यम (सीडीएम) के साथ एक 15 एमएल शंक्वाकार ट्यूब में सतह पर तैरनेवाला और बीज 3 x 10 5 कोशिकाओं प्रति गोली निकालें।
    7. गोली निर्माण के लिए, 5 मिनट के लिए कोशिकाओं को अपकेंद्रित करें680 xg और आरटी
      नोट: chondrogenic छर्रों के भेदभाव के दौरान छर्रों को 15 मिलीलीटर शंक्वाकार ट्यूबों में रखा जाता है।
    8. 37 डिग्री सेल्सियस और 5% सीओ 2 में रात भर सेते हैं।
    9. सीडीएम को हर 2-3 दिनों में बदलें 3 दिनों के भीतर, छर्रों को चपटे, गोलाकार मोर्फीज के प्रदर्शन का प्रदर्शन होगा। छर्रों को 37 दिनों के लिए 37 डिग्री सेल्सियस और 5% सीओ 2 बनाए रखें।

2. धुंधला द्वारा चेन्ड्रोजेनिक गोली विशेषता

  1. चैन्डरोजेनिक एम्बेडिंग
    1. एम्बेडिंग से पहले, तैयार करें और पैरागिन पिघल 58 डिग्री सेल्सियस पर
    2. एक 1.5 एमएल ट्यूब में आरटी पर 2 घंटे के लिए 4% पैराफॉर्मालाइडहाइड के 1 एमएल में छर्रों को ठीक करें।
      सावधानी: पैराफॉर्माडाइहाइड अत्यधिक विषैले है आंख, त्वचा, या श्लेष्म झिल्ली के साथ संपर्क से बचें एक्सपोजर को कम करें और इसे तैयार करते समय इनहेलेशन से बचें।
    3. कैसेट पर एक परत की धुंध रखें और एक विंदुक का उपयोग करके तय छर्रों को स्थानांतरित करें। वें तह से ढककर गोली को कवर करेंई धुंध और कैसेट ढक्कन बंद करें
    4. 100 एमएल 70% इथेनॉल (एटओएच) में दो बार, 10 मिनट प्रत्येक में निर्जलीकरण आरंभ करें। 80% और 95% एटओएच में अनुक्रमिक 10 मिनट की धुलाई के माध्यम से छर्रों को निर्जलीकरण।
    5. छर्रों को 10 मिनट के लिए 100% एटओएच में स्थानांतरित करें ताजा एटॉह के साथ तीन बार दोहराएं।
    6. "समाशोधन" के लिए, 100 एमएल, एटीओएच और xylene के 1: 1 मिश्रण का समाधान करें, उसके बाद 10 मिनट प्रत्येक के लिए एटओएच और xylene का 1: 2 मिश्रण। 100% xylene, 10 मिनट प्रत्येक में छर्रों से दोहराकर शेष EtOH को साफ़ करें।
    7. पैराफिन घुसपैठ के लिए, अनुक्रमिक xylene और पैराफिन मिश्रण में छर्रों सेते हैं। 58 डिग्री सेल्सियस पर पूरे पैराफिन घुसपैठ की प्रक्रिया करें 30 मिनट के लिए 2 एम 1 एल 0 एल 0 एल 080 मिलीलीटर और पैलेफीन में छर्रों को सेते हैं।
    8. एक्सलीन और पैराफिन के 1: 1 मिश्रण के 100 एमएल के समाधान का समाधान करें और 30 मिनट के लिए सेवन करें।
    9. एक्सलीन और पैराफिन के 1: 2 मिश्रण के 100 मिलीलीटर के समाधान का समाधान करें और 3 सेवन करें0 मिनट
    10. अंतिम घुसपैठ के लिए, छर्रों को 100% पैराफिन के पहले स्नान में स्थानांतरित करें और 2 घंटे के लिए सेवन करें।
    11. छर्रों को 100% पैराफिन के दूसरे स्नान में स्थानांतरित करें और 58 डिग्री सेल्सियस पर ओ / एन सेवन करें।
    12. अगले दिन, धीरे-धीरे छर्रों को एक चिमटी का उपयोग करके मोल्ड में स्थानांतरित करें। पैराफिन औषधि से मोल्ड को पैराफिन जोड़ें। पैरागिन को 4 डिग्री सेल्सियस पर 4 डिग्री सेल्सियस तक सिकुड़ें
    13. 7 माइक्रोन में वर्गों को स्लाइस करें और स्लाइड्स को स्लाइड पर स्थानांतरित करें। स्लाइड्स को रातोंरात सूखने की अनुमति दें और आरटी पर स्लाइड्स को स्टोर करें जब तक वे उपयोग के लिए तैयार न हों।
  2. स्लाइड तैयारी
    1. स्लाइड्स को 100%, 9 0%, 80%, और 70% एटोह क्रमशः 5 मिनट प्रत्येक के लिए 100 मिलीलीटर के माध्यम से स्थानांतरित करने से इन्हें छोड़ दें।
    2. एक ग्लास जार में स्लाइड्स रखें और 5 मिनट के लिए नल का पानी के साथ कुल्ला।
  3. एलिसियन नीले धुंधला हो जाना
    1. 30 मिनट के लिए 1% एलिसियन नीले समाधान के 50 मिलीलीटर में स्लाइड्स को सेते हैं।
      नहींई: एलिसियन नीले 3% एसिटिक एसिड समाधान में पतला है। पीएच को 2.5 एसिटिक एसिड का उपयोग करके समायोजित करें।
    2. एक ग्लास जार में स्लाइड्स रखें और 2 मिनट के लिए नल का पानी के साथ कुल्ला।
    3. विआयनीकृत पानी (डीडब्ल्यू) में स्लाइड्स को कुल्ला और 2 मिनट के लिए परमाणु फास्ट लाल समाधान के साथ काउंटरस्टैन करें।
    4. एक ग्लास जार में स्लाइड्स रखें और 1 मिनट के लिए नल का पानी के साथ कुल्ला।
    5. 2.3.5) कदम 2.6 में स्लाइड्स निर्जलीकरण और माउंट करने के लिए आगे बढ़ें।
  4. टोलुइडिन नीले धुंधला हो जाना
    1. 4 मिनट के लिए टोलुइडिन नीले समाधान के 50 एमएल में स्लाइड्स सेते।
    2. एक ग्लास जार में स्लाइड्स रखें और 5 मिनट के लिए नल का पानी के साथ कुल्ला।
    3. चरण 2.6 में स्लाइड्स को निर्जलीकरण और माउंट करने के लिए आगे बढ़ें।
  5. Immunohistochemical धुंधला
    1. अंतर्जात पेरोक्साइड अवरुद्ध करने के लिए 15 मिनट के लिए 3% H 2 O 2 में स्लाइड को सेते हैं।
    2. 200 μL प्राथमिक एंटीबॉडी (एंटी- COL1A1 और -COL2A1) को पतला 1: 100 ट्रिस-बी में पतला करेंनमक (टीबीएस) में 1% गोजाइन सीरम एल्बूमिन (बीएसए) और 5% सामान्य बकरी सीरम (एनजीएस) युक्त स्लाइड्स और ओ / एन से 4 डिग्री सेल्सियस से युक्त होता है।
    3. अगले दिन, एक ग्लास जार में स्लाइड्स रखें और उन्हें 50 एमएल की टीबीएस युक्त डालें, जिसमें 0.1% पॉलीसेर्बेट 20 (टीबीएसटी) 5 मिनट प्रत्येक के लिए तीन बार होता है।
    4. स्लाइड के लिए 200 μL माध्यमिक एंटीबॉडी (बकरी विरोधी खरगोश आईजीजी एंटीबॉडी, टीबीएस युक्त 1: 200 में 1% बीएसए पतला और 5% एनजीएस पतला) और 40 मिनट के लिए आरटी पर सेते हैं।
    5. स्लाइड्स को ग्लास जार में रखें और उन्हें 50 एमएल, 5 मिनट प्रत्येक के साथ तीन बार धो लें।
    6. सिग्नल प्रवर्धन के लिए, एचआरपी-संयुग्म स्ट्रेक्टिविडिन समाधान को स्लाइड्स पर लागू करें और 10 मिनट के लिए सेते हैं।
    7. स्लाइड्स को ग्लास जार में रखें और उन्हें 50 एमएल, 5 मिनट प्रत्येक के साथ तीन बार धो लें।
    8. डीएबी-पेरोक्सीडेस सब्सट्रेट समाधान को मिलाएं, प्रत्येक स्लाइड के 200 μL समाधान को लागू करें, और 1 मिनट तक सेवन करें।
    9. एक ग्लास जार में स्लाइड्स रखें और 5 मिनट के लिए नल का पानी के साथ कुल्ला।
    10. counterstain1 मिनट के लिए मेयर के हेमटैक्साइलिन के साथ
    11. डीडब्ल्यू के साथ स्लाइड्स धो लें
    12. चरण 2.6 में स्लाइड्स को निर्जलीकरण और माउंट करने के लिए आगे बढ़ें।
  6. निर्जलीकरण और बढ़ते
    1. स्लाइड्स को क्रमशः 100 एमएल 70%, 80%, 90%, और 100% एटओएच, 30 एस प्रत्येक के माध्यम से ले जाकर उन्हें निर्जलीकरण करें।
    2. स्लाइड्स को दो मिनट में 1 मिनट के लिए ज़ीलेन के दो बदलावों में डुबकी।
    3. कवर्लिप्स के लिए बढ़ते समाधान के 50 μL जोड़ें और शीर्ष पर स्लाइड रखें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

इस अध्ययन में, हमने सीबीएससी-एचपीएससी से चोंड्रोजेनिक छर्रों को ईबीएस से आउटग्राथ सेल से प्रेरित किया। चोंद्र्रोजनिक भेदभाव की पुष्टि उच्च पीढ़ी 11 के साथ CBMC-hiPSCs का उपयोग करके किया गया था। हमारे प्रोटोकॉल की एक सरल योजना चित्रा 1 ए में दिखाया गया है भेदभाव से पहले, आईपीएससी कॉलोनियों का विस्तार किया गया ( चित्रा 1 बी )। विस्तारित iPSCs को भेदभाव शुरू करने के लिए ईबी के रूप में इकट्ठा किया गया ( चित्रा -1 सी )। उत्पन्न ईबीएस परिणामस्वरूप कोशिकाओं ( चित्रा 1 डी ) को प्रेरित करने के लिए जिलेटिन-लेपित व्यंजनों से जुड़ा हुआ था। फिर, परिणाम की कोशिकाओं को काटा गया और चोंड्रोजेनिक छर्रों को उत्पन्न करने के लिए इस्तेमाल किया गया। विचलन के 21 दिनों के बाद, छोटे, मोती की तरह चोंड्रोजेनिक छर्रों को प्राप्त किया गया और आगे लक्षण वर्णन ( चित्रा 1 ई ) के लिए उपयोग किया गया। इन विट्रो जनित चोन में गुणवत्ताविभिन्न assays के माध्यम से drogenic छर्रों की पुष्टि की गई थी।

हमने 21 वीं सदी में चोंड्रोजेनिक छर्रों की गुणवत्ता का मूल्यांकन किया था। बीएमएससी चोंड्रोजेनिक छर्रों को सकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था। चित्रा 2 ए में एलिसियन नीले और टोलुइडिन नीले रंग की धुंधले द्वारा विभेदित chondrocytes द्वारा स्रावित ईसीएम प्रोटीन के संचय की पुष्टि की गई थी। स्वस्थ उपास्थि की प्रमुख विशेषताएं, जैसे कि लैकुना और प्रोटीोग्लैकेन उत्पादन, बढ़ने की प्रक्रिया 21 दिनों तक जारी रही। CBMC-hiPSCs से उत्पन्न चोंड्रोजेनिक छर्रों ने COL2A1 को व्यक्त किया, जो स्वस्थ उपास्थि ( चित्रा 2 बी ) में प्रमुख ईसीएम घटक है। CBMS-HIPSC- व्युत्पन्न छर्रों की COL2A1 अभिव्यक्ति बीएमएससी-व्युत्पन्न छर्रों की तुलना में अधिक थी। कोलाजन प्रकार I, फाइब्रोटिक उपास्थि के लिए एक मार्कर, अभिव्यक्ति की तुलना में सीबीएससी-हायपीएससी-व्युत्पन्न छर्रों में कम था, COL2A1 की अभिव्यक्ति की तुलना में दिन -21 चोंड्रोजेनिक छर्रों में उपास्थि ईसीएम प्रोटीन की जीन अभिव्यक्ति वास्तविक समय पीसीआर द्वारा पुष्टि की गई थी। CBMC-hiPSC- व्युत्पन्न छर्रों की एग्रग्रेकन (एसीएएन) अभिव्यक्ति बीएमएससी-व्युत्पन्न छर्रों ( चित्रा 3 ए ) के समान थी। सीओएलएसी-एचपीएससी-व्युत्पन्न छर्रों ( चित्रा 3 बी ) में COL2A1 की अभिव्यक्ति काफी अधिक थी। सेक्स-डिटेक्टिंग क्षेत्र की अभिव्यक्ति वाई-बॉक्स 9 (सॉक्स 9), एक चोंड्रोजेनिक पूर्वज, का भी मूल्यांकन किया गया था। CBMC-hiPSCs से उत्पन्न छरनी उच्च स्तर Sox9 ( चित्रा 3C ) व्यक्त की है। हमने पुष्टि की कि इन जीनों को बीएमसीसी नियंत्रण छर्रों की तुलना में सीबीएमसी-एचपीएससी चोंड्रोजेनिक छर्रों में 21 जनवरी को महत्वपूर्ण रूप से अपग्रेड किया गया था। एक hypertrophic marker, COL1A1 की अभिव्यक्ति का मूल्यांकन किया गया था ( चित्रा 3 डी )। सीएलएमसी-हायपीएससी-व्युत्पन्न छर्रों में COL1A1 की अभिव्यक्ति की तुलना बीएमएससी-डेरी में की गई।वेद छर्रों भेदभाव की दक्षता को COL2A1 से COL1A1 के अनुपात ( चित्रा 3 ई ) के द्वारा विश्लेषण किया गया था। सीएलएमसी-हायपीएससी-व्युत्पन्न छर्रों में अनुपात की वृद्धि ने COL1A1 की तुलना में COL2A1 की अपेक्षाकृत उच्च अभिव्यक्ति का प्रदर्शन किया। अंत में, हमने सीबीएमसी-एचपीएससी की चोंड्रोजेनिक भेदभाव क्षमता की पुष्टि की है। उत्पन्न सीबीएमसी-हायपीएससी-व्युत्पन्न चोंड्रोजेनिक छर्रों की गुणवत्ता में बीएमएससी के साथ एक गुणवत्ता सुसंगत थी।

आकृति 1
चित्रा 1: हायपीएससी के चोंड्रोजेनिक भेदभाव ( ) एचपीएससी से चोंड्रोजेनिक गोली उत्पादन की योजना ( बी ) उत्पन्न सीबीएमसी-हायपीएससी की आकृति विज्ञान ( सी ) उत्पन्न ईबीएस का आकृति विज्ञान ( डी ) अंडरग्राव कोशिकाओं को जिलेटिन-लेपित संस्कृति डिश से जुड़ी ईबीएस से प्राप्त किया गया। ( ) टी की छवि वह 21 दिनों के भेदभाव के बाद चोंड्रोजेनिक गोली अंतराल की इकाइयों को मिलीमीटर में दिखाया गया है। स्केल बार = 200 माइक्रोन इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र 2
चित्रा 2: चोंड्रोजेनिक गोली का हिस्टोलॉजिकल विश्लेषण। ( ) एलिसियन नीले और टोलुइडिन नीले धुंधला होकर दिन 21 पर चोंड्रोजेनिक छर्रों का हिस्टोलॉजिकल मूल्यांकन। ( बी ) COL1A1 और COL2A1 एंटीबॉडीज के साथ दाग वाले चोंड्रोजेनिक छर्रों की इम्यूनोहिस्टोकेमिस्ट्री छवि। स्केल सलाखों = 100 माइक्रोन इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

1 "> चित्र तीन
चित्रा 3: चोंड्रोजेनिक गोली की जीन अभिव्यक्ति ( ) एसीएएन के रिलेटिव जीन एक्सप्रेशन ( बी ) COL2A1 की रिलेटिव जीन एक्सप्रेशन ( सी ) एसओएक्स 9 की रिलेटिव जीन एक्सप्रेशन ( डी ) COL1A1 के रिलेटिव जीन एक्सप्रेशन ( ) COL1A1 की जीन अभिव्यक्ति ( एफ ) COL10A1 की जीन अभिव्यक्ति ( जी ) COL2A1 का अनुपात: COL1A1 जीन अभिव्यक्ति भेदभाव के 21 दिनों के बाद छर्रों का विश्लेषण और विश्लेषण किया गया। वास्तविक समय पीसीआर का उपयोग करके डेटा प्राप्त किया गया था और प्रति नमूना (एन = 3) प्रति तीन प्रयोगों की औसत मानक त्रुटि के रूप में प्रदर्शित किया गया था। आंतरिक नियंत्रण के रूप में जीएपीडीएच को जीन की अभिव्यक्ति सामान्यीकृत थी (* P <0.05, ** p <0.01, *** p <0.001)।K "> कृपया इस आंकड़े के एक बड़े संस्करण को देखने के लिए यहां क्लिक करें।

मोबाइल नम्बर आउटग्राथ सेल उपज गोली उपज
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
एमएससी 2 x 10 6 - 6

तालिका 1: एमएससी और एचईपीएससी की यील्ड तुलना

लक्ष्य नाम दिशा प्राइमर अनुक्रम आकार
आगे TTCCGCGACGTGGACAT 77 बीपी
रिवर्स TCAAACTCGTTGACATCGAAGGT
एक कर सकते हैं आगे AGCCTGCGCTCCAATGACT 107 बीपी
रिवर्स TAATGGAACACGATGCCTTTCA
COL2A1 आगे GGCAATAGCAGGTTCACGTACA 79 बीपी
रिवर्स CGATAACAGTCTTGCCCCACTTA
COL1A1 आगे CCCCTGGAAAGAATGGAGATG 148 बीपी
रिवर्स TCCAAACCACTGAAACCTCTG

तालिका 2: रीयल-टाइम पीसीआर में चोंड्रोजेनिक मार्कर के खिलाफ प्राइमरों की श्रेणी।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस प्रोटोकॉल ने सीबीएससी से एचपीएससी को सफलतापूर्वक जनरेट किया है। हमने यमनका कारक 24 युक्त एक सेंडाइ वायरल वेक्टर का उपयोग करके एचपीसीएस के लिए सीबीएमसी को पुन: प्रोग्राम किया है। अलग-अलग मामलों में तीन मामलों का इस्तेमाल किया गया, और सभी प्रयोगों ने इस प्रोटोकॉल का उपयोग करके सफलतापूर्वक चोंड्रोजेनिक छर्रों को उत्पन्न किया। कई अध्ययनों में एचपीएससी के भेदभाव के लिए प्रोटोकॉल 25 , 26 , 27 , 28 के चॉन्ड्रोसाइट्स में बताए गए हैं। हालांकि, सीबीएमसी-एचपीएससी के उपयोग के उपास्थली पुनर्जनन और वसूली के लिए एक उम्मीदवार की पुष्टि करने के लिए अतिरिक्त शोध की आवश्यकता है।

चांड्रोजेनेसिस की पुष्टि की गई थी, जो विभिन्न स्नायेटिक सेल प्रकार 11 , 25 , 26 , 27 , 2 9 से उत्पन्न hiPSCs थे। कई रिपोर्टें प्रदर्शित होती हैंकि पुनप्रोग्रामिंग में इस्तेमाल की गई दैहिक सेल की उत्पत्ति, हायपीएससी 30 , 31 , 32 , 33 के भेदभाव के परिणाम को प्रभावित कर सकती है। गर्भनाल रक्त एक स्रोत है जो एचएससी और एमएससी के साथ समृद्ध है। गर्भनाल रक्त व्युत्पन्न कोशिकाओं, जैसे रक्त कोशिकाओं या एमएससी के बीच अंतर पर कोई रिपोर्ट नहीं है। हालांकि, पिछले अध्ययनों से पता चला है कि क्लोर्रॉसाइट-व्युत्पन्न हायपीएस सील्स को गर्भनाल रक्त या त्वचा फाइब्रोब्लास्ट 29 से उत्पन्न hiPSCs की तुलना में chondrogenesis के माध्यम से जाने की अधिक संभावना है। फाइब्रोब्लास्ट्स, कार्डियक पूर्वपुस्र्ष कोशिकाओं और एंडोथेलियल कोशिकाओं से उत्पन्न हायपीएस सील्स का उपयोग करके एन्डोथेलियल भिन्नता का परिणाम दर्शाता है कि मूल ऊतक-विशिष्ट दैहिक स्मृति को विशेष रूप से शुरुआती अंशों में, विशेष रूप से शुरुआती अंशों में, 10 से 20 के बीच, ऊतक-विशिष्ट दैहिक स्मृति को प्रतिबिंबित कर सकता है। हायपीएससी के प्रारंभिक दौर में, एंडोथेलियल सेल-डेरीवेद HIPSCs एंडोथेलियल वंश में और अधिक कुशलता से विभेदित। हालांकि, इन सेल लाइनों के बीच महत्वपूर्ण अंतर 20PS से अधिक hiPSCs में गायब हो गया। इसलिए, जब चिकित्सकीय अनुसंधान में उपयोग किया जाता है, तब प्रारंभिक परिच्छेदों में hiPSCs द्वारा किए गए दैहिक स्मृति को सावधानीपूर्वक ध्यान रखना महत्वपूर्ण है।

हाल ही में, दोषपूर्ण पुष्पकात्मक कार्टिलेज की मरम्मत के लिए विभिन्न प्रक्रियाएं विकसित की गई हैं। प्राकृतिक सुधार के लिए अस्थि मज्जा की बाढ़ को प्रेरित करने के लिए हड्डी में कई छेद ड्रिल करने से माइक्रोफ्रैक्ट किया जाता है। घुटने के प्रतिस्थापन, जिसे घुटने के आर्थोप्लास्टी के नाम से भी जाना जाता है, का उपयोग क्षतिग्रस्त उपास्थि को बदलने के लिए किया जाता है। हालांकि, सूक्ष्म संवारक गंभीर सांध्यात्मक उपास्थि क्षति के लिए उपयोगी नहीं है, और घुटने के प्रतिस्थापन के लिए इस्तेमाल किए गए साधन को हर 10-15 वर्षों में बदला जाना चाहिए।

इन दिनों, सेल आधारित चिकित्सा उपास्थि मरम्मत के लिए एक आशाजनक वैकल्पिक तरीका है। ऑटोलॉगस चॉन्ड्रोसाइट इम्प्लांटेशन (एसीआई) व्यापक हैली सेल-आधारित कार्टिलेज रिकवरी के लिए इस्तेमाल किया एसीआई सीधे ऑटोलॉगस क्रोन्ड्रोसाइट्स को दोष में इंजेक्शन द्वारा किया जाता है। हालांकि, एटोलॉगस चॉन्ड्रोसाइट्स इन विट्रो खेती परिस्थितियों में फाइब्रोब्लास्ट जैसी कोशिकाओं में परिवर्तित हो जाते हैं। ऑटोलॉगस चॉन्ड्रोसाइट्स की कटाई प्रक्रिया के दौरान अतिरिक्त नुकसान भी अनिवार्य है। एमएससी को उपास्थि वसूली के लिए एक सेल स्रोत के रूप में सुझाया गया है। इंजीनियरिंग कार्टिलेज 36 के लिए कॉर्ड रक्त MSCs का एक उपयोगी और सुलभ सेल स्रोत है। कॉर्ड-रक्त एमएससी को अलग करने के लिए सफलता दर, हालांकि विवादास्पद है 37 , 38 । कई अध्ययनों में कॉर्ड-रक्त एमएससी की सफल अलगाव की रिपोर्ट है। कई अध्ययनों से पता चला है कि गर्भनाल रक्त मात्रा एक महत्वपूर्ण पैरामीटर है जो एमएससी अलगाव 36 , 39 के उपज दर को प्रभावित कर सकता है। उच्च गुणवत्ता वाले एमएससी प्राप्त करने के लिए, कोशिकाओं का मार्ग भी महत्वपूर्ण है। पिछला अध्ययनों से संकेत मिलता हैटीएससीएस के पास एक निश्चित सेल डिवीजन नंबर के बाद सीमित जीवन अवधि है। शताब्दी में प्रवेश करके, एमएससी की कमी हुई प्रसार के रूप में होती है, जैसा कि किसी सामान्य स्नायेटिक सेल 40 के साथ । इसलिए सेल सेलनेसस और क्रोमोसोमल असामान्यताएं से बचने के लिए छठे मार्ग से पहले गर्भनाल रक्त-व्युत्पन्न एमएससी का उपयोग किया जाना चाहिए।

इन सीमाओं से बचने के लिए, मानव आईपीएसएससी ने उच्च उत्पादकता 11 के साथ व्यक्तिगत, सेल आधारित चिकित्सा के लिए एक नई संभावना खोली। स्थापित hiPSCs सैद्धांतिक रूप से अमर्यादित रूप से फैल सकता है साथ ही, दाता के रूप में एक ही प्रतिरक्षा पहचान के साथ, वे विवो में प्रत्यारोपित होने पर अस्वीकृति और निम्न दुष्प्रभावों से बच सकते हैं। गर्भनाल रक्त बैंकों में एलओसीसी बैंकों में एलोगीनिक चिकित्सा उपचार के लिए संक्रमण की काफी संभावना है और संभावित 42 हैं । रिपो्रोग्रामिंग से पहले होमोजीजुस एचएलए टाइप टाइप सीबीएमसी की स्क्रीनिंग ऑलोजेनिक आईपीएससी लाइनों का व्यापक रूप से उपयोग कर सकती हैआर नैदानिक ​​उपचार होमोझीजीस आईपीएससी लाइन ऑलोग्राफ़्ट ट्रांसप्लांटेशन के बाद इम्युनोलॉजिकल प्रतिक्रियाओं से बच सकते हैं। इस अवधारणा को एचएलए-होमोजीग्ज कार्टिलेज 11 उत्पन्न करके उपास्थि पुनर्जनन के लिए भी लागू किया जा सकता है।

आमतौर पर, दो महत्वपूर्ण चरणों के माध्यम से चोंड्रोजेनिक भेदभाव किया जाता है: ईबी-व्युत्पन्न आउटग्राथ कोशिकाओं और गोली संरचना को शामिल करना। ईबी-व्युत्पन्न आउटगोव्थ कोशिकाओं में hiPSCs का प्रारंभिक भेदभाव उनके चोंड्रोजेनिक भेदभाव की क्षमता को बढ़ाने के लिए महत्वपूर्ण है। एचआईपीएससी से विभेदित आउटग्रोथ कोशिकाओं कार्यात्मक रूप से और आणविक रूप से देशी बीएमएससी 7 , 43 के समान हैं । पिछला अध्ययन मोनोलेयमर संस्कृति या ईबी संस्कृति का उपयोग पूर्व-भेदभाव के चरण के रूप में, मेसेनचिमल-जैसे सेल 10 , 43 को प्रेरित करता है। हालांकि, monolayer संस्कृति द्वारा प्रत्यक्ष भेदभाव ईबी के उपयोग की तुलना में समय-उपभोक्ता है, और सीएच Ondrogenic छर्रों hypertrophic विशेषताओं के साथ fibrocartilage में अंतर करने के लिए करते हैं। यह बताया गया कि सेल मॉर्फोलॉजी और सेल मॉलायर 9 के सेल घनत्व के अनुसार उत्पन्न मेसेनचिमल जैसे पूर्वपुस्र्ष कोशिकाओं की चोंड्रोजेनिक भेदभाव की क्षमता काफी भिन्न होती है।

हम बड़े पैमाने पर कोशिकाओं को प्रेरित करने के लिए ईबीएस का उपयोग करते थे, जो कि मोनोलेयर संस्कृति की तुलना में एक अपेक्षाकृत तेज और आसान तरीका है। इस प्रोटोकॉल का उपयोग करते हुए, हम अपेक्षाकृत छोटी संख्या में hiPSCs ( तालिका 1 ) का उपयोग करते हुए कई छर्रों को उत्पन्न करने में सक्षम थे। सफल चोंड्रोजेनिक गोली बड़े पैमाने पर उत्पादन के लिए आकार और ईबी की संख्या महत्वपूर्ण थी। इस कारण से, हमने ई 8 माध्यम में समेकित ईबी का विस्तार किया, जब तक कि उत्पन्न ईबी के आधे से अधिक 100 माइक्रोन से अधिक न हो। ईबी के विस्तार के बाद, हमने ईजीएस ई 8 माध्यम में एफजीएफ 2 के बिना बनाए रखा। इससे पहले, शोधकर्ताओं ने एमईएसोडर्मल वंशावली के लिए एफजीएफ 2 के बिना उत्पन्न ईबीएस बनाए रखाXref "> 9

हालांकि हमने बेहतर गुणवत्ता के लिए उच्च घनत्व में उत्पन्न आउटग्राथ कोशिकाओं को बनाए रखने का प्रयास किया, फिर भी कई सीमाएं अभी भी रहती हैं। हालांकि हमने पुष्टि की है कि जेनरेट किए गए आउटग्राथ सेल एक समान आकारिकी साझा करते हैं, फिर भी कोशिकाओं में हीटरोजीनस हो सकता है पिछले अध्ययनों ने एक विशिष्ट सेल प्रकार के लिए सॉर्ट करने का प्रयास किया है; हालांकि, इस प्रक्रिया के परिणामस्वरूप कोशिकाओं की कम संख्या का संग्रह किया गया है। एक बड़े पैमाने पर समरूप आउटग्राथ कोशिकाओं को अलग करने का एक नया प्रयास करने के लिए उन्नत विशेषताओं के साथ बड़ी मात्रा में चोंड्रोजेनिक छर्रों उत्पन्न करने की आवश्यकता होगी।

विभिन्न समूहों monolayer या EB संस्कृति का उपयोग करके hiPSCs से पूर्व कोशिकाओं उत्प्रेरण कर रहे हैं एमएससी को उच्च समानता के साथ पूर्व कोशिका कोशिकाओं को शामिल करना उच्च गुणवत्ता के चोंड्रोजेनिक छर्रों को प्राप्त करने की कुंजी हो सकता है। ईबीओं से ली गई ये पूर्वज कोशिकाओं में एमएससी की तरह के लक्षण हैं। हालांकि, इसका कारण यह हो सकता है किऔर फाइब्रोब्लास्टिक प्रकृति इसलिए, वृहद कोशिकाओं पर एक विस्तृत प्रमाणीकरण अध्ययन आवश्यक है।

इस अध्ययन में, हम एक प्रोटोकॉल का सुझाव देते हैं जो अपेक्षाकृत बड़ी मात्रा में चोंड्रोजेनिक छर्रों का उत्पादन कर सकते हैं। हमने पुष्टि की है कि CBMC-hiPSCs का उपयोग कर पुनर्जीवित उपास्थि ने एक स्वस्थ फेनोटाइप दिखाया और ऊतक पुनर्जनन के लिए सामग्री के रूप में उपयोग किया जा सकता है। हालांकि, आगे के आवेदन के लिए एक छोटे से भिन्नता समयरेखा के साथ एक बेहतर तरीका आवश्यक है। उच्चतर स्तर के हाइलाइन के साथ उपास्थि को मान्य करने के लिए गुणवत्ता नियंत्रण मानकों का और विकास भी उपास्थि पुनर्जनन के लिए सेल सामग्री के रूप में सीबीएमसी-एचपीएससी के भविष्य के अनुप्रयोगों के लिए आवश्यक है। प्रोटोकॉल सरल अभी तक प्रभावी है और गोली संरचना से पहले किसी भी अतिरिक्त सॉर्टिंग प्रक्रिया की आवश्यकता नहीं है। निष्कर्ष में, इस प्रोटोकॉल का उपयोग करते हुए, उच्च गुणवत्ता वाले चोंड्रोजेनिक छर्रों को हमारी बीमारी के बारे में हमारी समझ को आगे बढ़ाने के लिए रोग मॉडलिंग, दवा स्क्रीनिंग, और पुनर्योजी चिकित्सा पर अध्ययन के लिए तैयार किया जा सकता है।वह उपास्थि की प्रकृति

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgements

यह काम कोरिया हेल्थकेयर टेक्नोलॉजी आर एंड डी प्रोजेक्ट, स्वास्थ्य, कल्याण और परिवार मामलों के मंत्रालय, कोरिया गणराज्य (HI16C2177) से अनुदान द्वारा समर्थित था।

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics